CCATClinical Analysis Tool
‹ Knowledge base

Browse the corpus

Walk the evidence base by book and chapter — the raw source passages that ground Ask, Differential, and the rest.

473 passages

fulltextpubmed· Body· item PMC5861180

Introduction Thalassemia is the most common single-gene disorder worldwide and is considered a major public health issue. β-Thalassemia major (β-TM) occurs in homozygous or compound heterozygous states for β-hemoglobin gene mutations that either reduce (β+-thal) or abolish (β0-thal) expression of the affected β-globin genes [1]. The patients require long-term regular blood transfusions and chelation therapy, and children with untreated or partially treated β-TM die in the first or second decade of life [2]. β-TM has become a public health problem in mainland China. In the 1980s, a large-scale survey of hemoglobinopathies was carried out [3]. In recent years, 13,397 samples from Guangdong Province have been analyzed for both hematological and molecular parameters showing a high prevalence of carriers of α-thal (8.53%), β-thal (2.54%), and both α- and β-thal (0.26%) [4]. Hematopoietic stem cell transplantation (HSCT) has remained the only cure for β-TM [5] since the first bone marrow transplantation (BMT) for β-TM reported in December 1981 [6]. This expensive procedure was not successfully performed in mainland China until 1998 [7]. In China, many patients with β-TM cannot afford life-long regular blood transfusions and iron chelation. Although HSCT is expensive, it is a one-time treatment that is possible for some patients. Due to differences in medical, socioeconomic and cultural situations, there is wide variation in the treatment of β-TM between developed and developing countries. The disease-free survival rates after HSCT have ranged 52–82% in China [8–12]. The majority of patients with β-TM are distributed throughout southern China and HSCT is performed by several qualified hospitals. Each center has reported a few cases, though most are without systemic analysis [8–10, 12–15]. To provide a comprehensive review of the outcomes of children receiving HSCT for β-TM in China, the present study retrospectively analyzed the data from children receiving HSCT for β-TM between 1998 and 2009 in a multicenter study group of the Pediatric Branch of the Chinese Medical Association.

fulltextpubmed· Body· item PMC5861180

analysis [8–10, 12–15]. To provide a comprehensive review of the outcomes of children receiving HSCT for β-TM in China, the present study retrospectively analyzed the data from children receiving HSCT for β-TM between 1998 and 2009 in a multicenter study group of the Pediatric Branch of the Chinese Medical Association. Methods Patient characteristics The study was approved by the Institutions’ Ethical Committee, and informed consent was obtained from the patients’ parents. The recipient and donor characteristics are summarized in Table 1. The study included patients with β-TM younger than 18 years at transplantation who received HSCT between January 1998 and December 2009 in mainland China. Fifty cases of first HSCT for genetically and symptomatically transfusion-dependent thalassemia were included in this retrospective study. Complete human leukocyte antigen (HLA) matches between 6 points of the -A, -B and -DR alleles were required. Patients were stratified according to the Pesaro risk factors [16, 17]: 37.0% of the patients were Pesaro class 3, 44.4% were class 2, and 18.5% were class 1.Table 1 Recipient and donor characteristics (n = 50)

fulltextpubmed· Body· item PMC5861180

Complete human leukocyte antigen (HLA) matches between 6 points of the -A, -B and -DR alleles were required. Patients were stratified according to the Pesaro risk factors [16, 17]: 37.0% of the patients were Pesaro class 3, 44.4% were class 2, and 18.5% were class 1.Table 1 Recipient and donor characteristics (n = 50) Variables Values Gender, n (%) Male 28 (56.0) Female 22 (44.0) Age at HSCT, n (%) 5.0 (1.0–14.0) < 7 y 32 (64.0) ≥ 7 y 18 (36.0) Pesaro class, n (%) 1 5 (18.5) 2 12 (44.4) 3 10 (37.0) NA 23 Donor type, n (%) Related 35 (70.0) Unrelated 15 (30.0) Graft type, n (%) PBSC 10 (20.0) UCB 22 (44.0) BM 9 (18.0) BM + PBSC/UCB 9 (18.0) BM + PBSC 5 (10.0) BM + UCB 4 (8.0) Conditioning regimen, n (%) BUCYATG 11 (22.0) BUCYATG + Flu + Hu 14 (28.0) BUCY + X 25 (50.0) GVHD prophylaxis, n (%) CsA 16 (32.0) CsA + MTX 21 (42.0) CsA + MMF 5 (10.0) CsA + MTX + MMF 6 (12.0) CsA + MTX + zenepax 2 (4.0) HSCT hematopoietic stem cell transplantation, PBSC peripheral blood stem cell, UCB umbilical cord blood, BM bone marrow, BU busulfan, CY cyclophosphamide, ATG anti-thymocyte globulins, Flu fludarabine, Hu hydroxyurea, CsA cyclosporine A, MTX short courses of methotrexate, MMF mycophenolate mofetil, NA not available, BUCYATG conditioning regimen consisting of BU, CY and ATG, BUCYATG + Flu + Hu conditioning regimen consisting of BU, CY and ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens

fulltextpubmed· Body· item PMC5861180

Flu fludarabine, Hu hydroxyurea, CsA cyclosporine A, MTX short courses of methotrexate, MMF mycophenolate mofetil, NA not available, BUCYATG conditioning regimen consisting of BU, CY and ATG, BUCYATG + Flu + Hu conditioning regimen consisting of BU, CY and ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens The stem cell sources included bone marrow, peripheral blood stem cells, umbilical cord blood (UCB) and a combination of cord blood/peripheral blood stem cells and bone marrow (BM) from a single sibling donor. If the sibling donor was too young to reach the criterion of 15 kg, combined transplantation was considered. Nucleated cell counts (NC) were 8.0–10.0 × 108/kg recipient weight at the time of BMT or peripheral blood stem cell transplantation (PBSCT). NCs were 3.5–3.7 × 107/kg recipient weight at umbilical cord blood transplantation (UCBT). The proportion of CD34+ was 0.5–1%.

fulltextpubmed· Body· item PMC5861180

n of 15 kg, combined transplantation was considered. Nucleated cell counts (NC) were 8.0–10.0 × 108/kg recipient weight at the time of BMT or peripheral blood stem cell transplantation (PBSCT). NCs were 3.5–3.7 × 107/kg recipient weight at umbilical cord blood transplantation (UCBT). The proportion of CD34+ was 0.5–1%. Transplantation procedures Details regarding conditioning regimens and graft-versus-host disease (GVHD) prophylaxis are provided in Table 1. Patients received myeloablative BUCY-based conditioning regimens [intravenous busulfan (total 11.2–12.8 mg/kg, divided into 16 fractions from days − 9 to − 6) combined with cyclophosphamide (total 120–200 mg/kg, divided into 4 fractions between days − 5 and − 2)] without blood concentration monitoring. Forty-eight (96%) patients accepted anti-thymocyte globulins [ATG (horse ATG before 2001, total 90–100 mg/kg, 3 or 4 fractions, started at day − 4; rabbit ATG after 2001, total 7.5–11.5 mg/kg)]. Fludarabine (Flu), thiotepa (TT) or melphalan (Mel) were added to the myeloablative conditioning regimen to maximize the elimination of the recipients’ hematopoietic stem cells, especially in the extramedullary hematopoietic sites. Total body irradiation was seldom (2 of 50) applied for children with non-malignant conditions due to its growth-retarding effects and risk for secondary malignancies. Beginning in 2001, hydroxyurea (Hu, 30 mg/kg daily) and azathioprine (Aza, 3 mg/kg daily) were given together 3–4 weeks before busulfan conditioning. For GVHD prophylaxis, patients received cyclosporine A (CsA) starting at 2.5–3.0 mg/kg intravenously daily on day − 1 with a plasma concentration of 150 to 250 ng/mL or in combination with short courses of methotrexate (MTX, 15 mg/m2 on day 1 and 10 mg/m2 on days 3, 5 and 11), mycophenolate mofetil (MMF, 30 mg/kg/day divided into 2 fractions starting on day 1), methylprednisolone (1 mg/kg) or daclizumab (1 mg/kg on day − 1, repeated every 2 weeks; 5 doses in total). In the majority of patients (74.0%), GVHD prophylaxis consisted of CsA alone (n = 16) or a combination of CsA and short courses of MTX (n = 21). Fourteen of 22 cord blood recipients accepted GVHD prophylaxis that included CsA along. Five of the cord blood recipients accepted CsA together with MMF. Supportive therapy and the post-transplantation use of hematopoietic growth factors was in accordance with the policies of each individual center.

fulltextpubmed· Body· item PMC5861180

es of MTX (n = 21). Fourteen of 22 cord blood recipients accepted GVHD prophylaxis that included CsA along. Five of the cord blood recipients accepted CsA together with MMF. Supportive therapy and the post-transplantation use of hematopoietic growth factors was in accordance with the policies of each individual center. Definition of end points The endpoints of the primary study were thalassemia-free survival (TFS) and overall survival (OS). For the analysis of OS, failure was defined as death from any cause, and surviving patients were censored at the date of last contact. TFS was defined as survival without graft failure or a second transplantation. Graft failure (GF) was clinically defined as persistent pancytopenia with no hematological recovery or recurrent β-TM. Chimerism data were incomplete, and when available, were captured using different techniques over time (e.g., sex chromosome hybridization in situ, analysis of variable number tandem repeat polymorphisms, or microsatellite analysis).

fulltextpubmed· Body· item PMC5861180

y defined as persistent pancytopenia with no hematological recovery or recurrent β-TM. Chimerism data were incomplete, and when available, were captured using different techniques over time (e.g., sex chromosome hybridization in situ, analysis of variable number tandem repeat polymorphisms, or microsatellite analysis). Statistical analyses The characteristics of patients and transplantation were studied with descriptive analyses. Univariate comparisons were made using the Chi-square test or Fisher’s exact test for dichotomous variables and Pearson’s exact Chi-square test for qualitative variables of more than two categories. For continuous variables, the medians were calculated and compared using the nonparametric Mann–Whitney U test. The univariate probabilities of OS and TFS were calculated using the Kaplan–Meier estimator, and their 95% confidence intervals (CI) were constructed using arcsine-transformed intervals. The log-rank test was used to compare the probabilities of survival. A stratified univariate analysis of OS and TFS was performed using the Mantel–Haenszel test. A univariate analysis of GF was performed using the Kruskal–Wallis test. Multivariate Cox regressions were performed for the variables identified as being associated with one of the endpoints, those that were marginally significant in the univariate analyses, or those with clinical relevance (e.g., age). For all tests, the P values were 2-sided and statistical significance was defined as P < 0.05. All analyses were performed using PASW statistics version 19.0 (IBM SPSS, Inc., Chicago, IL).

fulltextpubmed· Body· item PMC5861180

of the endpoints, those that were marginally significant in the univariate analyses, or those with clinical relevance (e.g., age). For all tests, the P values were 2-sided and statistical significance was defined as P < 0.05. All analyses were performed using PASW statistics version 19.0 (IBM SPSS, Inc., Chicago, IL). An exhaustive identification of patients was attempted through the Children HSCT Study Group in a multicenter study conducted by the Pediatric Branch of the Chinese Medical Association. Between January 1998 and December 2009, a total of 50 patients with β-TM underwent 6-allele-matched HSCT in 5 different transplantation centers in mainland China. The patient charts were analyzed retrospectively, and the data analysis was performed in December 2015. All survivors had at least 5 years of follow-up after HSCT.

fulltextpubmed· Body· item PMC5861180

n January 1998 and December 2009, a total of 50 patients with β-TM underwent 6-allele-matched HSCT in 5 different transplantation centers in mainland China. The patient charts were analyzed retrospectively, and the data analysis was performed in December 2015. All survivors had at least 5 years of follow-up after HSCT. Results General characteristics The post-HSCT follow-ups lasted for 44.7 months on average due to mortality. The longest follow-up lasted for 11 years. Over 5 years, the probabilities of accumulated OS and TFS were 83.1 ± 6.9 and 67.3 ± 7.9%, respectively (Fig. 1). The OS pre-2001 and post-2001 were 88.9 ± 10.5 and 85.0 ± 6.4% (P = 0.548), respectively. The TFS pre-2001 and post-2001 were 60.0 ± 15.5 and 72.6 ± 7.6% (P = 0.614), respectively. Six cases (12.0%) of death were recorded: one recipient died of severe acute respiratory syndromes in the 51st month after complete engraftment, one recipient died after transplantation without engraftment, one case of death occurred due to severe GVHD with multiple organ failure after the second transplantation, and 3 patients died of severe cytomegalovirus infection or pulmonary fungal infection 6 months after successful transplantation. Both acute GVHD (aGVHD) and chronic GVHD (cGVHD) were generally controllable and not fatal. The incidence of aGVHD was 62.0% (n = 31), and ten of these cases were grade 2 or above. The incidence of cGVHD was 24.0% (n = 12). According to the Seattle clarification, 5 of the cGVHD cases were extensive and 7 were localized. All the 12 patients survived. The incidence of aGVHD pre-2001 and post-2001 was 80.0% (8/10) and 57.5% (23/40) (P = 0.173), respectively. The incidence of cGVHD pre-2001 and post-2001 was 30.0% (3/10) and 22.5% (9/40), respectively. The proportion of complete chimerism reached 80.0% (95% CI 71.4–89.8%), whereas the proportion of incomplete chimerism was 16.0%. When compare Pesaro class 1/2 and class 3, the proportion of complete chimerism of two groups was 82.4 and 60.0% (P = 0.204), respectively. There were 17 recipients with incomplete chimerism or secondary graft failure after complete chimerism, and 15 of them eventually experienced graft failure. Secondary graft rejection was the major reason for the decrease in TFS.Fig. 1 Curve of 5-year accumulated overall survival (OS) and thalassemia-free survival (TFS). The probability of 5-year accumulate OS and TFS was 83.1% (95% CI 90.0–76.2%) and 67.3% (95% CI 59.4–75.2%), respectively. CI confidence interval

fulltextpubmed· Body· item PMC5861180

failure. Secondary graft rejection was the major reason for the decrease in TFS.Fig. 1 Curve of 5-year accumulated overall survival (OS) and thalassemia-free survival (TFS). The probability of 5-year accumulate OS and TFS was 83.1% (95% CI 90.0–76.2%) and 67.3% (95% CI 59.4–75.2%), respectively. CI confidence interval Univariate analyses of OS and TFS Univariate analyses showed that gender, UCBT (the transplanted graft contained umbilical cord blood only), the use of MTX and the use of MMF were potential key factors for OS: the impacts of donor type (related donor versus unrelated donor), graft type, conditioning regimen group and age of the recipient at transplantation (< 7 versus ≥ 7 years) on OS were not significant (P > 0.05). Univariate analyses also showed that graft type, UCBT and the use of MTX were potentially related to TFS; the effects of gender, donor type, conditioning regimen group, transplant age and the use of MMF on TFS were not significant. These results are displayed in Table 2.Table 2 Univariate analysis of OS and TFS Variables OS,  % P TFS,  % P

fulltextpubmed· Body· item PMC5861180

Univariate analyses of OS and TFS Univariate analyses showed that gender, UCBT (the transplanted graft contained umbilical cord blood only), the use of MTX and the use of MMF were potential key factors for OS: the impacts of donor type (related donor versus unrelated donor), graft type, conditioning regimen group and age of the recipient at transplantation (< 7 versus ≥ 7 years) on OS were not significant (P > 0.05). Univariate analyses also showed that graft type, UCBT and the use of MTX were potentially related to TFS; the effects of gender, donor type, conditioning regimen group, transplant age and the use of MMF on TFS were not significant. These results are displayed in Table 2.Table 2 Univariate analysis of OS and TFS Variables OS,  % P TFS,  % P Gender, mean ± SE Male 96.2 ± 3.8 0.031 81.3 ± 7.5 0.091 Female 64.3 ± 14.7 47.7 ± 14.2 Age at transplantation, mean ± SE < 7 y 89.3 ± 5.9 0.256 77.1 ± 7.7 0.103 ≥ 7 y 58.3 ± 24.4 32.4 ± 23.6 UCBT, mean ± SE Yes 73.3 ± 10.2 0.051 47.1 ± 11.0 0.002 No 83.3 ± 15.2 77.4 ± 14.7 Donor type, mean ± SE Related 87.4 ± 7.1 0.092 70.0 ± 8.9 0.452 Unrelated 78.6 ± 11.0 66.7 ± 12.2 Graft type, mean ± SE PBSC 83.3 ± 15.2 0.227 75.0 ± 15.8 0.020 UCB 73.3 ± 10.2 47.1 ± 11.0 BM 100 100 BM + PBSC/UCB 100 88.9 ± 10.5 Conditioning regimen group, mean ± SE BUCYATG 100 0.387 70.0 ± 14.5 0.625 BUCY + X 74.9 ± 10.2 59.7 ± 11.0 BUCYATG + Flu + Hu 92.9 ± 6.9 85.7 ± 9.4 Use of MTX, mean ± SE Yes 100 0.006 92.6 ± 5.0 < 0.001 No 66.9 ± 11.4 42.1 ± 11.4 Use of MMF, mean ± SE Yes 62.3 ± 15.0 0.011 53.0 ± 15.5 0.229 No 89.7 ± 7.6 71.7 ± 9.1 PBSC peripheral blood stem cell, UCB umbilical cord blood, BM bone morrow, UCBT transplanted graft contained umbilical cord blood only, BU busulfan, CY cyclophosphamide, ATG anti-thymocyte globulins, Flu fludarabine, Hu hydroxyurea, MTX short courses of methotrexate, MMF mycophenolate mofetil, BUCYATG conditioning regimen consisting of BU, CY and ATG, BUCYATG + Flu + Hu conditioning regimen consisting of BU, CY, ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens, use of MTX MTX was used for the prophylaxis of graft-versus-host disease, use of MMF MMF was used for the prophylaxis of graft-versus-host disease, OS 5-year accumulated overall survival, TFS 5-year accumulated thalassemia-free survival, SE standard error

fulltextpubmed· Body· item PMC5861180

ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens, use of MTX MTX was used for the prophylaxis of graft-versus-host disease, use of MMF MMF was used for the prophylaxis of graft-versus-host disease, OS 5-year accumulated overall survival, TFS 5-year accumulated thalassemia-free survival, SE standard error Umbilical cord blood transplantation UCBT for TM exhibited much lower OS (UCBT versus non-UCBT: 73.3 ± 10.2 versus 83.3 ± 15.2%, P = 0.051) and TFS (UCBT versus non-UCBT: 47.1 ± 11.0 versus 77.4 ± 14.7%, P = 0.002) than other types of grafts in the univariate analysis. Table 3 displays detailed comparisons of the recipient and donor characteristics as well as the conditioning regimens and GVHD prophylaxis between the UCBT and non-UCBT groups. UCBT used to be popular (22/50 of the cases in this study) in China. Seventeen of 35 HLA-matched HSCT from related donors involved UCBT. However, in three of these cases, engraftment failure occurred, and in five cases, recurrence occurred after engraftment. Only nine achieved continued TFS maintenance. There were only five cases of UCBT in the unrelated donor HSCT cases, and all of these achieved engraftment. However, three of these recipients died of complications, and secondary graft failure occurred in one recipient. The comparisons of GVHD incidence, GVHD severity, mortality, and study end points between the UCBT and non-UCBT groups are displayed in Table 3. Since 2005, four cases of UCB-BM combined transplantation were performed. One of these patients experienced recurrence, but the other three were persistently thalassemia free. Accordingly, the risks of mortality and recurrence decreased when PBSC or UCB were transplanted in combination with bone marrow, but this was still inferior to BMT (TFS: 88.9%, OS: 100%). A multivariate COX analysis indicated that in spite of the significantly different use of MTX between the UCBT and non-UCBT groups and tremendous difference in TFS and OS between the MTX (GVHD prophylaxis with MTX) and the non-MTX groups (GVHD prophylaxis without MTX), the use of MTX was not the key factor leading to the differences in TFS and OS between the UCBT and non-UCBT groups [relative risk (RR) = 6.265, 95% CI 0.794–49.433, P = 0.082]. The use of MMF was not the key factor (RR = 0.250, 95% CI 0.165–1.596, P = 0.515), either.

fulltextpubmed· Body· item PMC5861180

the non-MTX groups (GVHD prophylaxis without MTX), the use of MTX was not the key factor leading to the differences in TFS and OS between the UCBT and non-UCBT groups [relative risk (RR) = 6.265, 95% CI 0.794–49.433, P = 0.082]. The use of MMF was not the key factor (RR = 0.250, 95% CI 0.165–1.596, P = 0.515), either. Further analysis demonstrated that, in the UCBT group, related donor transplantation produced more favorable results than unrelated donor transplantation in OS (related donor versus unrelated donor: 86.2 ± 9.1 versus 25.0 ± 21.7%, P = 0.009) but not in TFS (related donor versus unrelated donor: 55.6 ± 12.6 versus 20.0 ± 17.9%, P = 0.217).Table 3 Detailed comparisons between the UCBT and non-UCBT groups Variables UCBT Non-UCBT P

fulltextpubmed· Body· item PMC5861180

Further analysis demonstrated that, in the UCBT group, related donor transplantation produced more favorable results than unrelated donor transplantation in OS (related donor versus unrelated donor: 86.2 ± 9.1 versus 25.0 ± 21.7%, P = 0.009) but not in TFS (related donor versus unrelated donor: 55.6 ± 12.6 versus 20.0 ± 17.9%, P = 0.217).Table 3 Detailed comparisons between the UCBT and non-UCBT groups Variables UCBT Non-UCBT P Gender, n Male 13 15 0.696 Female 9 13 Transplantation age (y), median (range) 5.0 (1.3–12.0) 5.0 (1.0–14.0) 0.945 Donor type, n RD 17 18 0.320 UD 5 10 Hu usage, n Yes 6 12 0.254 No 16 16 Conditioning regimen, n BUCYATG 6 5 0.366 BUCYATG + Flu + Hu 4 10 BUCY + X 12 13 MTX usage, n Yes 2 26 < 0.001 No 20 2 aGVHD incidence, n (%) 14 (63.6) 17 (60.7) 0.833 aGVHD grade 2-4, n (%) 3 (13.6) 7 (25.0) 0.325 cGVHD incidence, n (%) 4 (18.2) 8 (28.6) 0.393 Limited, n (%) 2 (9.1) 5 (17.9) 0.295 Extensive, n (%) 2 (9.1) 3 (10.7) 0.849 Mortality, n (%) 5 (26.3) 1 (3.6) 0.022 Graft failure, n (%) 9 (40.9) 2 (7.1) 0.004 OS, % (95% CI) 73.3 (83.5–63.1) 83.3 (98.5–68.1) 0.051 TFS, % (95% CI) 47.1 (58.1–36.1) 77.4 (92.1–62.7) 0.002 Details on recipient and donor characteristics as well as conditioning regimens and graft-versus-host disease (GVHD) prophylaxis comparisons between the umbilical cord blood transplantation (UCBT) and non-UCBT groups

fulltextpubmed· Body· item PMC5861180

95% CI) 73.3 (83.5–63.1) 83.3 (98.5–68.1) 0.051 TFS, % (95% CI) 47.1 (58.1–36.1) 77.4 (92.1–62.7) 0.002 Details on recipient and donor characteristics as well as conditioning regimens and graft-versus-host disease (GVHD) prophylaxis comparisons between the umbilical cord blood transplantation (UCBT) and non-UCBT groups RD related donor, UD unrelated donor, BU busulfan, CY cyclophosphamide, ATG anti-thymocyte globulins, Flu fludarabine, Hu hydroxyurea, aGVHD acute GVHD, cGVHD chronic GVHD, BUCYATG conditioning regimen consisting of BU, CY and ATG, BUCYATG + Flu + Hu conditioning regimen consisting of BU, CY, ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens, OS 5-year accumulated overall survival, TFS 5-year accumulated thalassemia-free survival

fulltextpubmed· Body· item PMC5861180

oxyurea, aGVHD acute GVHD, cGVHD chronic GVHD, BUCYATG conditioning regimen consisting of BU, CY and ATG, BUCYATG + Flu + Hu conditioning regimen consisting of BU, CY, ATG, Flu, Hu and Aza, BUCY + X all other conditioning regimens, OS 5-year accumulated overall survival, TFS 5-year accumulated thalassemia-free survival Conditioning regimen groups For the analysis of the conditioning regimens, the incidences of TFS, OS and GF were compared among 3 groups: BUCYATG (n = 11), BUCY + X (n = 25) and BUCYATG + Flu + Hu (n = 14). The OS of the BUCYATG BUCY + X and BUCYATG + Flu + Hu groups was 100%, 74.9 ± 10.2% and 92.9 ± 6.9%, respectively (P = 0.387), and the TFS of these three groups was 70.0 ± 14.5%, 59.7 ± 11.0% and 85.7 ± 9.4%, respectively P = 0.625). The relationship between the conditioning regimen group and GF was analyzed, and the between-group differences in the GF incidence were not significant (BUCYATG versus BUCYATG + Flu + Hu: 27.3 versus 14.3%, P = 0.763; BUCYATG versus BUCY + X: 27.3 versus 24.0%, P = 1.00; BUCY + X versus BUCYATG + Flu + Hu: 24.0 versus 14.3%, P = 0.759). The difference among all three groups was also insignificant (P = 0.723).

fulltextpubmed· Body· item PMC5861180

-group differences in the GF incidence were not significant (BUCYATG versus BUCYATG + Flu + Hu: 27.3 versus 14.3%, P = 0.763; BUCYATG versus BUCY + X: 27.3 versus 24.0%, P = 1.00; BUCY + X versus BUCYATG + Flu + Hu: 24.0 versus 14.3%, P = 0.759). The difference among all three groups was also insignificant (P = 0.723). Discussion At the beginning phase of HSCT for the treatment of β-TM, doctors in mainland China were faced with numerous difficulties, including HLA matching techniques, the toxicity of conditioning regimens, graft rejection, severe GVHD, infections, patients’ high risk status, and a lack of appropriate donors. However, none of these challenges stopped the advancement of HSCT in mainland China. Doctors kept searching for advanced techniques to improve prognoses; for example, ATG was introduced in 48 of 50 cases and different conditioning regimens were applied.

fulltextpubmed· Body· item PMC5861180

ons, patients’ high risk status, and a lack of appropriate donors. However, none of these challenges stopped the advancement of HSCT in mainland China. Doctors kept searching for advanced techniques to improve prognoses; for example, ATG was introduced in 48 of 50 cases and different conditioning regimens were applied. In our study, BMT has been proven to be the safest and most efficient technique for treating β-TM. However, in cases of younger sibling donors and unrelated donors, the bone marrow volume harvested is usually limited. Other types of grafts and combined transplantation were considered and developed. UCBT, which used to be popular in China due to its low cost and less traumatic procedures, has been used to cure leukemia with outcomes similar to those of sibling donor transplantation, as reported previously by our study group [18]. However, the situation was exactly the opposite in β-TM, as shown by the results. Compared with reports from other centers, UCBT in mainland China did not provide equivalent outcomes. According to the previous reports in mainland China, most UCBT recipients achieved autologous recovery or eventually died of complications; by contrast, the implantation after PBSCT was much better [8]. Global data have suggested that UCBT from related donors had similar engraftment levels compared to BMT but lower incidences of GVHD, which further promoted the use of UCBT in treating β-TM [19–22]. Similar to the global experience, doctors from Taiwan District reported their experiences with UCBT in 2009, suggesting that an adequate NC count was the key to successful UCBT [23]. In 2012, researchers in Taiwan of China presented another informative single-center experience reporting that the most important risk factors for a poor prognosis were iron overload and the elevated panel-reactive antibody (PRA) caused by hypertransfusion. Thus, they recommended the use of UCBT at a young age, when the transfusion volume is not large [24]. Researchers from Europe claimed that the NC was not relevant to the outcome. UCBT from unrelated donors resulted in lower TFS (21%), whereas UCBT from matched sibling donors had a similar TFS to that of BMT [22]. However, in the UCBT group, related donor transplantation did not produce more favorable TFS results compared to unrelated donor transplantation (related donor versus unrelated donor: 55.6 ± 12.6 versus 20.0 ± 17.9%, P = 0.217).

fulltextpubmed· Body· item PMC5861180

TFS (21%), whereas UCBT from matched sibling donors had a similar TFS to that of BMT [22]. However, in the UCBT group, related donor transplantation did not produce more favorable TFS results compared to unrelated donor transplantation (related donor versus unrelated donor: 55.6 ± 12.6 versus 20.0 ± 17.9%, P = 0.217). According to a retrospective study, graft rejection after UCBT may be related to conditioning regimens and GVHD prophylaxis. The use of MTX for GVHD prophylaxis was associated with a greater risk of treatment failure [21]. In the present study, NC and the use of MTX were controlled as recommended but graft failure was still the major cause of UCBT failure. The conditioning regimen, elevated PRA and cellular activities of UCB were presumed to be the main reasons.

fulltextpubmed· Body· item PMC5861180

HD prophylaxis was associated with a greater risk of treatment failure [21]. In the present study, NC and the use of MTX were controlled as recommended but graft failure was still the major cause of UCBT failure. The conditioning regimen, elevated PRA and cellular activities of UCB were presumed to be the main reasons. Before 2000, most patients accepted whole-blood transfusions without white cell depletion, which induced elevated PRA levels and thus increased the risks of graft rejection and interfered with stem cell proliferation [25]. Furthermore, irregular and inadequate transfusions led to the expansion of bone marrow and extramedullary hematopoiesis. Hypertransfusion and the suppression of hematopoiesis have proven to be successful in improving engraftment [26, 27]. However, due to the limited blood resources in mainland China, more relatives were needed as blood donors to the recipients when hypertransfusion was required, inducing elevated minor histocompatibility antigen alloimmunization as well as rejection incidence and primary graft failure [28, 29]. Overcoming extramedullary hematopoiesis without stimulating PRA is probably the major task for controlling the incidence of complications.

fulltextpubmed· Body· item PMC5861180

recipients when hypertransfusion was required, inducing elevated minor histocompatibility antigen alloimmunization as well as rejection incidence and primary graft failure [28, 29]. Overcoming extramedullary hematopoiesis without stimulating PRA is probably the major task for controlling the incidence of complications. In this study, the OS and TFS tended to differ among the three conditioning regimen groups, though these differences were not significant. The BUCYATG treatment was shown to be the safest, whereas the BUCY + X treatment was the least safe. The safety of the conditioning regimen of BUCYATG + Flu + Hu was between these values. However, the safest regimen was not the most successful, as the TFS of the BUCYATG group was lower than that of the BUCYATG + Flu + Hu group. The intensified conditioning regimen of BUCY + X was disappointing and was eventually eliminated, whereas the conditioning regimen of BUCYATG + Flu + Hu has become dominant in HSCT for β-TM over the comparably simple BUCYATG regimen.

fulltextpubmed· Body· item PMC5861180

, as the TFS of the BUCYATG group was lower than that of the BUCYATG + Flu + Hu group. The intensified conditioning regimen of BUCY + X was disappointing and was eventually eliminated, whereas the conditioning regimen of BUCYATG + Flu + Hu has become dominant in HSCT for β-TM over the comparably simple BUCYATG regimen. As reported lately, the appropriately modified conditioning regimen can successfully improve the outcomes of class 3 recipients [30]. For the impaired heart and liver functions of class 3 recipients, these patients had difficulty tolerating the intensified conditioning regimen that was previously recommended [31–33]. The BUCYATG + Flu + Hu conditioning regimen has been performed since 2001. This modified protocol in the retrospective cohort has shown improvements in disease-free survival and reductions of treatment-related mortality in high-risk patients. Before transplantation, patients, especially those who tended to be high risk, strongly required regular transfusions and iron chelation, which tend to reduce extramedullary hematopoiesis. Unlike in Protocal 26 reported by Sodani et al. from Italy [26], granulocyte colony-stimulating factor, erythropoietin and growth factor were not provided to recipients due to the inconvenient procedures. By contrast, the comparably shorter courses of Hu and Aza prevented outpatient infections and severe liver damage. This new and simple conditioning regimen should be promoted, and further study should be conducted to conclusively demonstrate its efficiency and safety.

fulltextpubmed· Body· item PMC5861180

d to recipients due to the inconvenient procedures. By contrast, the comparably shorter courses of Hu and Aza prevented outpatient infections and severe liver damage. This new and simple conditioning regimen should be promoted, and further study should be conducted to conclusively demonstrate its efficiency and safety. Previous studies recommended intensified conditioning regimens for Asian populations. Increasing the dose of Bu to 20 mg/kg [34] and the addition of Mel and TT [13] both helped to decrease the rejection rate. Those conditioning regimens that were not sufficiently intensified were not able to maximally eliminate marrow and extramedullary hematopoiesis, which might explain why the BUCYATG conditioning regimen did not achieve the highest TFS among the three groups. The recipient’s T lymphocytes, which may be responsible for the rejection of a donor’s grafted cells, are effectively depleted by ATG, but the value of including ATG in conditioning regimens is still controversial [17, 19, 26, 27, 35–37]. In the present study, all but two patients accepted ATG-containing conditioning regimens for the most intensive depletion of recipient T lymphocytes without the use of other T cell-depleting agents. The use of ATG in HSCT from different donors and different types of grafts should be further investigated, and designing an accurate regimen for each individual would be an important step toward successful HSCT.

fulltextpubmed· Body· item PMC5861180

or the most intensive depletion of recipient T lymphocytes without the use of other T cell-depleting agents. The use of ATG in HSCT from different donors and different types of grafts should be further investigated, and designing an accurate regimen for each individual would be an important step toward successful HSCT. In conclusion, in HLA-matched HSCT for β-TM performed between 1998 and 2009, probabilities of 5-year accumulated OS and TFS found in this study were 83.1 ± 6.9 and 67.3 ± 7.9%, respectively. GF was the main cause of transplantation failure, especially in UCBT. UCBT from related donors did not produce favorable TFS. For patients with β-TM in mainland China, a variety of factors affecting OS and TFS after HSCT seem to exist. A suitable conditioning regimen is a key factor for the success of HSCT. The modified myeloablative regimen of BUCYATG + Flu + Hu warrants further clinical study, and the combined transplantation of UCB and BM could improve the prognosis of UCBT. However, this was a non-prospective and non-randomized study, and the conditioning regimens and GVHD prophylaxis were too heterogeneous to allow robust conclusions. We strongly recommend conducting a prospective randomized clinical trial to evaluate risk factors and the new protocols. We also recommend increased attention to be directed toward the quality of life of post-HSCT patients.

fulltextpubmed· Body· item PMC5861180

e conditioning regimens and GVHD prophylaxis were too heterogeneous to allow robust conclusions. We strongly recommend conducting a prospective randomized clinical trial to evaluate risk factors and the new protocols. We also recommend increased attention to be directed toward the quality of life of post-HSCT patients. Acknowledgements We thank Pediatric Branch of Chinese Medical Association and Children HSCT study group members. We also thank the physicians and nurses of SCT-units for their dedicated work and the patients and their families for their cooperation. Author contributions LXY designed the study, analyzed the data, and wrote the paper. FJP designed the study, analyzed the data, wrote the paper, and contributed the essential data and patient charts. SX, CJ, QMQ, LZ and ZYP contributed the essential data and patient charts. All authors contributed to the critical revision and final approval of the manuscript. Funding This work was partially supported by grants for a Clinical Key Discipline (the Subtropical Disease Center for Thalassemia) from the Chinese Ministry of Health (1311200006107). This study was supported by National Natural Science Foundation of China (81100370 and 81370603). Compliance with ethical standards Ethical approval The study protocol was approved by local ethics committee of Sun Yat-Sen University. Conflict of interest The authors report no conflicts of interests and have no relevant disclosures.

fulltextpubmed· Body· item PMC5920009

Introduction Liver function tests, including assays for alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), γ-glutamyltansferase (GGT), total protein (TP), albumin (ALB), total bilirubin (TBIL), and direct bilirubin (DBIL), are generally ordered as a “test of exclusion” in patients with non-specific symptoms or as part of routine health checks. In children, reference intervals of liver function tests should reflect the different phases of physiological development from birth to adolescence. However, appropriate age- and gender-specific pediatric reference intervals for most tests are often incomplete. Reference intervals are basic dimension to explain laboratory tests and analyze tests information. Proper and accurate laboratory tests and reference intervals are vitally necessary for medical assessment and care of patients. Current guidelines define a reference interval as the interval between two values in which 95% of the results for apparently healthy individuals would fall, usually between the 2.5 and 97.5 centiles of the distribution of test results for a reference population [1].

fulltextpubmed· Body· item PMC5920009

ecessary for medical assessment and care of patients. Current guidelines define a reference interval as the interval between two values in which 95% of the results for apparently healthy individuals would fall, usually between the 2.5 and 97.5 centiles of the distribution of test results for a reference population [1]. For several years, there are few systematic reference interval studies based on Chinese people. The reference intervals now applied in Chinese laboratory are mainly based on European and American populations study tens of years ago. Until now, there are still no reference intervals about pediatric population. As a completely different group, children have different physical size, organ maturity, nutrition and metabolism status with adults. Thus, it is inappropriate for children and adult to use a common reference interval. Pediatric reference interval should reflect children’s different phases of physiological development from birth to adolescence which can profoundly influence the concentrations of liver function tests routinely measured in the clinical laboratory.

fulltextpubmed· Body· item PMC5920009

inappropriate for children and adult to use a common reference interval. Pediatric reference interval should reflect children’s different phases of physiological development from birth to adolescence which can profoundly influence the concentrations of liver function tests routinely measured in the clinical laboratory. Recent studies including the Canadian Laboratory Initiative on Pediatric Reference Intervals (CALIPER) and reports from America, Sweden and Taiwan of China have added some novel information [2–5]. For example, the CALIPER has established a comprehensive covariate-stratified reference intervals based on a healthy nonhospitalized, and multiethnic pediatric population [3]. However, it is not appropriate to directly apply these reference intervals to Chinese pediatric population, because some parameters may vary significantly among different races and regions. Furthermore, several studies have decided to recruit participants who have been hospitalized or approximately “healthy” individuals due to the difficulties recruiting study participants [6–8]. Nevertheless, with a view to physical, nutritional, and developmental status, it is also not appropriate to apply these reference intervals to common pediatric population. Thus, taking into account finding from these studies, the present study will recruit children from communities and schools for conventional check-up before starting entering nursery, kindergarten, elementary school, and middle school. Moreover, taking into account other significant covariates of age, gender, region and ethnicity on pediatric reference intervals, this study presents age- and gender-specific pediatric reference intervals for liver function tests based on definitely healthy reference individuals in Changchun, China.

fulltextpubmed· Body· item PMC5920009

and middle school. Moreover, taking into account other significant covariates of age, gender, region and ethnicity on pediatric reference intervals, this study presents age- and gender-specific pediatric reference intervals for liver function tests based on definitely healthy reference individuals in Changchun, China. Methods Subjects From February 2015 to March 2016, healthy children aged from 2 to 14 years were recruited in this study. In order to obtain samples from healthy children, the recruitment of study population aged from 2 to 5 years took place in the community and health-care center (Lvyuan Maternal and Children Health Hospital) for common physical examination which national rules require before going to nursery. The children with age range of 6–14 years were enrolled in primary school (Lvyuan District Primary School of Changchun) and middle school (No. 78 Middle High School of Changchun). All the serum samples were collected after obtaining parental permission. All the potential participants or their parents completed a questionnaire including questions on diseases, prescribed and over-the-counter medication, the presence of fever, allergy and eczema, and a general question concerning subjective health. The demographic data included diet, exercise status, ethnicity, and body mass index parameters. Participants were excluded if they had a history of illness such as acute infection, metabolic or any system disease, surgery experiences within 6 months, use of prescription medications over the previous 2 weeks. The included children would be further removed according to the following testing criterion: positive in hepatitis B surface antigen, hepatitis c virus antibody, and human immunodeficiency virus antibody; creatinine above 120 μmol/L; creatine kinase above 500 U/L; uric acid above 475 μmol/L; glucose above 7.0 mmol/L; C reaction protein above 12.0 mg/L. Therefore, a total of 1394 individuals, 649 females and 745 males, were included.

fulltextpubmed· Body· item PMC5920009

surface antigen, hepatitis c virus antibody, and human immunodeficiency virus antibody; creatinine above 120 μmol/L; creatine kinase above 500 U/L; uric acid above 475 μmol/L; glucose above 7.0 mmol/L; C reaction protein above 12.0 mg/L. Therefore, a total of 1394 individuals, 649 females and 745 males, were included. This study was approved by the institutional ethics committee of the First Hospital of Jilin University. For all the children, their parents provided written informed consent and when possible, child subjects provided written assent. Specimen collection and handling All participants kept a normal diet and exercise in the last 3 days. Before blood collection in the morning, each participant fasted for at least 8 hours over night. Samples were collected in serum separator tubes (SST™; BD), then centrifuged, separated and aliquoted within 2 hours of collection. Excluding unqualified samples which were hemolysis, lipidemia, and jaundice, all qualified samples were sent to the laboratory for examination as soon as possible. Instruments, reagents and methods All 8 liver function tests were performed on Hitachi 7600-210 automatic analyzer (Hitachi High-Technologies, Tokyo, Japan). ALT (UV-LDH method), AST (UV-MDH method), GGT (l-γ-glutamyl-3-carboxy-4-nitranilide method), and ALP (AMP buffer method) were measured using reagents from Kehua bio-engineering company (Shanghai, China); TP (biuret reaction), ALB (bromocresol green method), TBIL, and DBIL (DCA method) were measured using reagents from DiaSys Diagnostics (Shanghai, China).

fulltextpubmed· Body· item PMC5920009

od), GGT (l-γ-glutamyl-3-carboxy-4-nitranilide method), and ALP (AMP buffer method) were measured using reagents from Kehua bio-engineering company (Shanghai, China); TP (biuret reaction), ALB (bromocresol green method), TBIL, and DBIL (DCA method) were measured using reagents from DiaSys Diagnostics (Shanghai, China). Quality control Sample determinations were carried out in the Department of Laboratory Medicine at the First Hospital of Jilin University. The Laboratory was accredited to ISO 15189:2012 Medical Laboratories-Particular Requirements for Quality and Competence by China National Accreditation Service for Conformity Assessment in 2012. All the doctors, technicians, and nurses participating in the physical examination and sample analysis were through strict training. Hitachi 7600-210 automatic analyzer were calibrated per 12 months by the manufactures, so as to ensure the performance of detection system like precision, accuracy, analytical measurement range, clinical reportable range and carryover rate were controlled.

fulltextpubmed· Body· item PMC5920009

l examination and sample analysis were through strict training. Hitachi 7600-210 automatic analyzer were calibrated per 12 months by the manufactures, so as to ensure the performance of detection system like precision, accuracy, analytical measurement range, clinical reportable range and carryover rate were controlled. Validation of reference intervals The established pediatric reference intervals are based on the population living in Changchun. As recommended by the Clinical and Laboratory Standards Institute (CLSI) C28-A3 [1], the reference intervals need to be assessed applicability for different testing conditions. We performed the validation in five representative hospitals located in different areas in Changchun including Lab 1 (The First Hospital of Jilin University), Lab 2 (The branch, First Hospital of Jilin University), Lab 3 (The Second Hospital of Jilin University), Lab 4 (The Fourth Hospital of Jilin University), and Lab 5 (The Pediatric Hospital of Changchun). For each subgroup of reference intervals 20 healthy participants were recruited regionally for each of the five hospitals. Routine instruments, reagents and methods were used to test samples from recruited individuals in each laboratory. For each reference subgroup, the results of analytes were validated with the newly established reference intervals. If no more than 10% of the results outside the limits, the established reference interval was considered applicable for the population.

fulltextpubmed· Body· item PMC5920009

used to test samples from recruited individuals in each laboratory. For each reference subgroup, the results of analytes were validated with the newly established reference intervals. If no more than 10% of the results outside the limits, the established reference interval was considered applicable for the population. Statistics analysis and determination of reference intervals Statistical analysis was performed with EXCEL (Microsoft) and SPSS 21.0 (IBM) software and in accordance with CLSI C28-A3 guideline [1]. Briefly, the data were inspected using scatter and distribution plots; outliers were removed with the Dixon’s rule; distribution was identified with the Shapiro–Wilk Statistic. Age and gender partitions were first determined by visually inspecting the distribution and scatter plots for overall trends. It was then justified with Harris and Boyd’s test which is recommended currently by the CLSI [1]. According to Harris and Boyd’s method [9], we calculated Z values with the standard deviation and a modified Z-statistic for two groups to determine whether each group is sufficiently different statistically to its own grouping. If the results of Harris and Boyd’s test did not demonstrate partition, the two groups were then combined and revaluated. The reference interval of each group was calculated using the nonparametric method to calculate the lower and higher reference limits, respectively. For each reference interval, 90% confidence intervals were calculated for either ends.

fulltextpubmed· Body· item PMC5920009

est did not demonstrate partition, the two groups were then combined and revaluated. The reference interval of each group was calculated using the nonparametric method to calculate the lower and higher reference limits, respectively. For each reference interval, 90% confidence intervals were calculated for either ends. Results A total of 1394 samples from 649 males and 745 females (2–14 years) were used to calculate age- and gender-specific reference intervals, and the male: female ratio was 1:1.15. The 8 liver function tests in this study were measured on Hitachi 7600-210 automatic biochemical analyzer, along with the assay of detection, as specified in the manufacturer’s package insert. The cumulative frequency of each measured value for each partition was calculated. After removing outliers, the value for each partition followed Gaussian distribution. With the Harris and Boyd’s test, we observed that it was necessary to derive separate reference intervals by age and gender in children. For each reference interval, 90% confidence intervals were calculated for either ends. Table 1 shows the 2.5th and 97.5th percentiles for 8 liver function tests (serum enzymes, proteins, and bilirubins) of each age and gender group. Table 2 includes both the calculated age- and gender-specific reference intervals for respective analytes of combined groups and points for each interval. As Table 1 shows, most analytes required some amount of partitionings, by age, gender, or both. There were apparent age variations of the reference intervals for all 8 liver function tests. Interestingly, all four enzymes required no gender partition within the initial several age groups but required in the later age groups. However, bilirubins (TBIL, DBIL) and proteins (TP, ALB) displayed no gender partition in the whole groups. All the analytes required a minimum of 2 age-specific reference intervals. ALB only required two different age partitions: 2–10 years, and 11–14 years. However, AST required 7 different age- and gender-specific partitions: 2 years, 3–5 years, 6 years, 7–12 years (female), 7–12 years (male), 13–14 years (female), and 13–14 years (male).Table 1 Age and gender specific 2.5th and 97.5th percentile results for 8 liver function tests in healthy children aged 2–14 years (n = 1394)

fulltextpubmed· Body· item PMC5920009

r, AST required 7 different age- and gender-specific partitions: 2 years, 3–5 years, 6 years, 7–12 years (female), 7–12 years (male), 13–14 years (female), and 13–14 years (male).Table 1 Age and gender specific 2.5th and 97.5th percentile results for 8 liver function tests in healthy children aged 2–14 years (n = 1394) Age (y) Sex n ALT (U/L) AST (U/L) GGT (U/L) ALP (U/L) TP (g/L) ALB (g/L) TBIL (µmol/L) DBIL (µmol/L) 2.5 97.5 2.5 97.5 2.5 97.5 2.5 97.5 2.5 97.5 2.5 97.5 2.5 97.5 2.5 97.5 2 M 109 8 22 27 49 8 15 174 361 59.5 73.2 40.1 53.3 2.7 9.3 0.9 2.6 F 87 9 25 27 47 7 16 173 426 61.6 72.0 41.4 51.9 3.3 14.0 0.9 3.6 3 M 135 7 25 26 45 7 17 156 364 60.8 74.6 41.1 52.5 3.0 13.8 1.0 3.5 F 121 9 22 20 42 8 16 162 365 59.2 73.7 39.7 53.1 3.2 10.6 0.8 2.9 4 M 79 7 20 25 39 8 15 148 337 60.3 76.3 40.8 50.5 3.9 15.2 0.9 3.8 F 72 7 19 20 44 8 16 150 326 53.7 75.9 39.7 51.2 3.2 16.3 1.1 4.0 5 M 78 7 22 25 44 9 20 144 369 60.9 76.9 40.3 52.5 4.4 13.6 1.4 3.7 F 75 6 21 21 41 7 19 143 360 59.8 74.0 39.7 52.2 3.9 12.4 1.3 3.2 6 M 57 6 23 20 40 9 17 152 356 58.8 75.2 40.7 52.1 4.1 11.8 1.2 3.7 F 46 6 23 19 39 8 16 180 372 59.9 76.8 38.6 50.1 3.4 12.9 0.9 3.2 7 M 43 4 18 8 35 10 16 129 359 63.9 77.1 41.2 51.4 2.8 13.5 1.1 3.6 F 35 4 16 10 37 8 16 136 345 63.8 78.5 40.9 53.3 3.6 14.9 1.2 3.6 8 M 32 4 18 16 34 9 21 153 333 61.1 76.2 40.8 50.6 5.4 14.1 1.9 4.0 F 23 6 20 14 30 7 22 165 290 66.4 73.2 42.8 47.6 5.5 12.5 1.6 3.7 9 M 24 6 18 18 30 7 19 144 367 65.4 74.6 41.7 51.9 6.0 14.6 1.8 4.4 F 24 5 16 14 34 5 25 151 351 64.7 75.0 42.3 49.0 6.9 12.6 1.9 3.6 10 M 41 4 19 16 30 8 20 151 359 62.2 76.7 41.0 50.2 5.2 15.3 1.7 4.5 F 53 3 19 13 29 7 22 137 462 59.4 79.1 39.0 50.2 4.0 16.6 1.6 5.3 11 M 29 5 33 14 35 11 27 153 412 55.8 81.3 37.4 52.8 5.3 15.4 1.7 4.3 F 27 6 17 12 34 10 27 110 366 62.5 77.5 39.9 51.6 4.6 13.6 1.6 4.3 12 M 33 5 30 15 42 10 45 160 516 65.4 79.0 41.0 53.0 5.7 12.6 1.8 3.5 F 30 5 18 13 29 9 22 97 354 65.7 78.3 42.2 51.8 4.5 15.0 1.6 4.1 13 M 31 7 33 15 36 10 32 134 437 64.0 77.2 43.4 51.8 5.1 15.4 1.5 3.8 F 23 5 16 15 22 8 18 68 224 66.2 76.4 43.2 51.2 3.4 21.3 0.9 5.3 14 M 54 7 35 14 30 10 40 126 424 64.7 81.9 41.3 53.7 4.5 16.0 1.7 4.3 F 33 5 30 14 23 9 33 49 152 67.6 78.2 42.7 51.9 4.4 18.4 2.0 5.3 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female

fulltextpubmed· Body· item PMC5920009

40 126 424 64.7 81.9 41.3 53.7 4.5 16.0 1.7 4.3 F 33 5 30 14 23 9 33 49 152 67.6 78.2 42.7 51.9 4.4 18.4 2.0 5.3 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female Table 2 Age- and gender-specific reference intervals for 8 liver function tests in healthy children aged 2–14 years (n = 1394)

fulltextpubmed· Body· item PMC5920009

40 126 424 64.7 81.9 41.3 53.7 4.5 16.0 1.7 4.3 F 33 5 30 14 23 9 33 49 152 67.6 78.2 42.7 51.9 4.4 18.4 2.0 5.3 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female Table 2 Age- and gender-specific reference intervals for 8 liver function tests in healthy children aged 2–14 years (n = 1394) Analytes Age group (y) Sex group No. of samples Lower limit Upper limit Confidence interval for lower limit Confidence interval for upper limit ALT (U/L) 2 F + M 196 8 24 7–9 22–26 3 to < 6 F + M 663 7 23 6–7 21–24 7 to < 10 F + M 275 4 19 3–4 16–22 11 to < 14 F 113 5 25 4–6 15–33 M 147 5 35 4–6 31–37 AST (U/L) 2 F + M 196 27 49 25–29 45–53 3 to < 5 F + M 560 22 44 20–24 42–45 6 F + M 103 18 40 16–21 38–42 7 to < 12 F 192 11 35 10–12 31–38 M 202 13 39 10–16 33–42 13 to < 14 F 59 14 26 13–15 18–28 M 82 13 36 13–15 26–40 GGT (U/L) 2 to < 4 F + M 603 8 16 7–8 15–17 5 to < 10 F + M 530 8 21 7–9 19–22 11 to < 14 F 113 8 29 7–9 17–41 M 147 10 43 9–11 35–51 ALP (U/L) 2 to < 3 F + M 452 160 376 153–169 355–390 4 to < 9 F + M 587 143 362 134–153 354–370 10 to < 12 F + M 213 116 426 99–136 354–471 13 to < 14 F 56 48 232 42–58 149–243 M 85 111 486 92–148 338–512 TP (g/L) 2 to < 3 F + M 452 59.5 74.4 59.1–60.1 72.9–75.3 4 to < 6 F + M 407 59.2 76.4 57.2–61.2 75.6–77.3 7 to < 10 F + M 275 62.5 78.2 59.1–64.1 76.2–80.2 11 to < 14 F + M 260 63.6 79.2 61.5–66.1 77.4–80.8 ALB (g/L) 2 to < 10 F + M 1134 40.0 52.3 39.7–40.5 51.9–52.7 11 to < 14 F + M 260 41.3 53.1 39.3–43.5 52.5–53.5 TBIL (µmol/L) 2 to < 3 F + M 451 3.0 13.0 2.8–3.2 11.9–13.7 4 to < 7 F + M 481 3.4 14.8 3.2–3.8 13.9–15.7 8 to < 14 F + M 455 4.5 16.6 4.0–5.0 15.6–17.6 DBIL (µmol/L) 2 to < 3 F + M 451 0.9 3.3 0.8–1.0 3.1–3.5 4 to < 7 F + M 481 1.1 3.8 1.0–1.2 3.5–3.9 8 to < 12 F + M 316 1.6 4.5 1.5–1.8 4.1–4.9 13 to < 14 F + M 139 1.2 5.3 0.8–1.6 4.8–5.9 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female

fulltextpubmed· Body· item PMC5920009

1.1 3.8 1.0–1.2 3.5–3.9 8 to < 12 F + M 316 1.6 4.5 1.5–1.8 4.1–4.9 13 to < 14 F + M 139 1.2 5.3 0.8–1.6 4.8–5.9 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female Within these analytes, TP, TBIL, and DBIL showed steady increases, and AST showed apparent decreases in analytes concentration over time, whereas ALT, GGT, ALP, and ALB demonstrated complex trends of change in these time (Figs. 1, 2). ALT and GGT increased sharply in males from 11 to 14 years. However, ALP markedly declined in females from 13 to 14 years.Fig. 1 Trends in analyte concentrations of serum ALT, AST, GGT, and ALP in healthy males and females aged 2–14 years (n = 1394). Levels of serum ALT (a), AST (b), GGT (c), and ALP (d) in healthy children. Data are presented as mean ± SE. ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, SE standard error Fig. 2 Trends in analyte concentrations of serum TP, ALB, TBIL, and DBIL in healthy males and females aged 2–14 years (n = 1394). Levels of serum TP (a), ALB (b), TBIL (c), and DBIL (d) in healthy children. Data are presented as mean ± SE. TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, SE standard error

fulltextpubmed· Body· item PMC5920009

in analyte concentrations of serum TP, ALB, TBIL, and DBIL in healthy males and females aged 2–14 years (n = 1394). Levels of serum TP (a), ALB (b), TBIL (c), and DBIL (d) in healthy children. Data are presented as mean ± SE. TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, SE standard error As Table 3 shows, all five laboratories passed the validation for each age and gender subgroup of pediatric reference intervals and all the validation data fell within the range of intervals for those 8 liver function analytes. The validation results indicate that the newly reference intervals are applicable in most representative laboratories in Changchun.Table 3 The results of reference interval validation in 5 laboratories Analytes Age group (y) Sex group Reference intervals N a Lab 1 Lab 2 Lab 3 Lab 4 Lab 5

fulltextpubmed· Body· item PMC5920009

As Table 3 shows, all five laboratories passed the validation for each age and gender subgroup of pediatric reference intervals and all the validation data fell within the range of intervals for those 8 liver function analytes. The validation results indicate that the newly reference intervals are applicable in most representative laboratories in Changchun.Table 3 The results of reference interval validation in 5 laboratories Analytes Age group (y) Sex group Reference intervals N a Lab 1 Lab 2 Lab 3 Lab 4 Lab 5 n b Result, %c n b Result, %c n b Result, %c n b Result, %c n b Result, %c ALT (U/L) 2 F + M 8–24 20 2 90 1 95 1 95 1 95 1 95 3 to < 6 F + M 7–23 20 2 90 2 90 2 90 2 90 1 95 7 to < 10 F + M 4–19 20 2 90 2 90 2 90 2 90 0 100 11 to < 14 F 5–25 20 1 95 0 100 2 90 2 90 0 100 M 5–35 20 1 95 0 100 0 100 0 100 1 95 AST (U/L) 2 F + M 27–49 20 2 90 2 90 1 95 2 90 2 90 3 to < 5 F + M 22–44 20 0 100 2 90 0 100 2 90 1 95 6 F + M 18–40 20 0 100 1 95 0 100 0 100 0 100 7 to < 12 F 11–35 20 1 95 2 90 0 100 1 95 1 95 M 13–39 20 0 100 2 90 0 100 2 90 0 100 13 to < 14 F 14–26 20 1 95 2 90 2 90 2 90 0 100 M 13–36 20 1 95 1 95 0 100 2 90 1 95 GGT (U/L) 2 to < 4 F + M 8–16 20 0 100 0 100 0 100 2 90 2 90 5 to < 10 F + M 8–21 20 1 95 0 100 0 100 2 90 1 95 11 to < 14 F 8–29 20 0 100 2 90 2 90 2 90 0 100 M 10–43 20 1 95 0 100 2 90 0 100 2 90 ALP (U/L) 2 to < 3 F + M 160–376 20 2 90 2 90 2 90 2 90 0 100 4 to < 9 F + M 143–362 20 1 95 2 90 0 100 1 95 0 100 10 to < 12 F + M 116–426 20 0 100 2 90 0 100 2 90 2 90 13 to < 14 F 48–232 20 1 95 1 95 2 90 2 90 2 90 M 111–486 20 0 100 2 90 0 100 2 90 2 90 TP (g/L) 2 to < 3 F + M 59.5–74.4 20 1 95 2 90 0 95 2 90 1 95 4 to < 6 F + M 59.2–76.4 20 0 100 1 95 0 100 2 90 0 100 7 to < 10 F + M 62.5–78.2 20 0 100 2 90 0 100 2 90 1 95 11 to < 14 F + M 63.6–79.2 20 0 100 1 95 0 100 2 90 2 90 ALB (g/L) 2 to < 10 F + M 40.0–52.3 20 0 100 2 90 0 100 2 90 0 100 11 to < 14 F + M 41.3–53.1 20 0 100 2 90 0 100 2 90 0 100 TBIL 2 to < 3 F + M 3.00–13.01 20 0 100 1 95 1 95 2 90 0 100 (µmol/L) 4 to < 7 F + M 3.41–14.80 20 0 100 1 95 0 100 1 95 0 100 8 to < 14 F + M 4.50–16.60 20 0 100 2 90 0 100 2 90 1 95 DBIL 2 to < 3 F + M 0.90–3.30 20 0 100 1 95 2 90 2 90 0 100 (µmol/L) 4 to < 7 F + M 1.10–3.80 20 0 100 2 90 1 95 2 90 0 100 8 to < 12 F + M 1.60–4.50 20 2 90 2 90 2 90 2 90 2 90 13 to < 14 F + M 1.20–5.30 20 1 95 2 90 1 95 2 90 0 100 ALT alanine aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female. aNumber for validation samples of this study. bNumber for validation samples outside the reference intervals of this study.

fulltextpubmed· Body· item PMC5920009

aminotransferase, AST aspartate aminotransferase, GGT γ-glutamyltransferase, ALP alkaline phosphatase, TP total protein, ALB albumin, TBIL total bilirubin, DBIL direct bilirubin, M male, F female. aNumber for validation samples of this study. bNumber for validation samples outside the reference intervals of this study. cThe results of percentage of validation samples inside the reference intervals of this study Discussion Age- and gender-specific pediatric reference intervals were established non-parametrically for 8 liver function tests assayed on Hitachi 7600-210 automatic analyzer, sampled from 1394 healthy children in Changchun. This is a significantly larger reference set than used in other studies of this type [10–13].

fulltextpubmed· Body· item PMC5920009

cThe results of percentage of validation samples inside the reference intervals of this study Discussion Age- and gender-specific pediatric reference intervals were established non-parametrically for 8 liver function tests assayed on Hitachi 7600-210 automatic analyzer, sampled from 1394 healthy children in Changchun. This is a significantly larger reference set than used in other studies of this type [10–13]. Defining pediatric reference intervals is one of the most difficult tasks for physicians because of the difficulties in collection of blood samples from a sufficient large number of healthy children. Such difficulties are reflected by the fact that recent studies obtained samples by collecting hospital-based results or using surplus serum that come from children attending selected out-patient clinics, such as dentistry, plastic surgery, orthopedics [6–8]. CALIPER initiative has ever established pediatric reference intervals derived from the analysis of outpatient clinics but deemed to be metabolically stable [14]. However, we can not certain whether nor not these samples were free of affecting the measured analytes parameters. In the present study, we collected direct samples from children who were accepting common physical-examination in community health-care centers, schools and fitted into by questionnaires and the following inclusion criteria. In some periods of life such as neonates (0–1 month old) and the first year of life (1 year old), the continuously developing physiology of growing changes their laboratory values. Unfortunately, data from the short phase after birth was lacking and puberty aged from 13 to 14 years was insufficient in the present study.

fulltextpubmed· Body· item PMC5920009

n some periods of life such as neonates (0–1 month old) and the first year of life (1 year old), the continuously developing physiology of growing changes their laboratory values. Unfortunately, data from the short phase after birth was lacking and puberty aged from 13 to 14 years was insufficient in the present study. In the present study, age-related changes in analyte concentrations were observed more commonly than gender associated differences. These analytes showed multiple separated age-related reference intervals. The verifying reference intervals established in the current study reflected pediatric development and growth changes during childhood. Within the analytes studied, proteins (TP, ALB) and bilirubins (TBIL, DBIL) reported no gender partitioning. Therefore, only age is required. This finding is consistent with previous studies for 2–14 years pediatrics subjects [3, 7, 15].

fulltextpubmed· Body· item PMC5920009

current study reflected pediatric development and growth changes during childhood. Within the analytes studied, proteins (TP, ALB) and bilirubins (TBIL, DBIL) reported no gender partitioning. Therefore, only age is required. This finding is consistent with previous studies for 2–14 years pediatrics subjects [3, 7, 15]. Except for age-related intervals, four enzymes, ALT along with AST, GGT and ALP, required additional gender-stratified reference intervals. ALT and AST do not reveal a distinct gender dependency during the childhood, for ALT in males an obvious increase up from 11 years to juveniles can be seen (Fig. 1). This finding differs from a previous study which described reference intervals for ALT according to gender throughout 2–14 years old but no age-related difference [7]. For AST, a continuous decrease in concentration in children from 2 to 14 years was also observed and showed gender differences (Fig. 2) which was consistent with previous studies [3, 16, 17]. ALP showed gender difference from 13 years old and was different from previous studies [8, 18]. ALP has also been known to reflect height velocity [19]. In this study, the average age at peak height velocity is 11–12 years in females. A marked decrease of ALP in females aged 13–14 years may reflect a reduced height velocity. However, previous studies reported different age class of gender difference [7, 8, 18]. The deviations from study to study and area to area highlight the importance of determining ethnicity specific intervals.

fulltextpubmed· Body· item PMC5920009

years in females. A marked decrease of ALP in females aged 13–14 years may reflect a reduced height velocity. However, previous studies reported different age class of gender difference [7, 8, 18]. The deviations from study to study and area to area highlight the importance of determining ethnicity specific intervals. Although previous studies indicated that the levels of serum TP and ALB differed between males and females in certain age groups [3, 20], our data did not show significant statistic difference in gender groups. Furthermore, considerable age partitioning was also required for the proteins (TP, ALB) as well as bilirubins (TBIL, DBIL) and enzymes (ALT, AST, GGT, and ALP). For each of these analytes, they required a minimum of two age-specific reference intervals. Within these groups of analytes, TP, TBIL, DBIL, AST and GGT showed steady increases or decreases in concentration throughout time, whereas ALT, ALB, ALP showed a complex age-related pattern of change (Figs. 1, 2). This marked changes and fluctuations in children during their growth and development highlight the importance of establishing age-specific pediatric reference intervals.

fulltextpubmed· Body· item PMC5920009

wed steady increases or decreases in concentration throughout time, whereas ALT, ALB, ALP showed a complex age-related pattern of change (Figs. 1, 2). This marked changes and fluctuations in children during their growth and development highlight the importance of establishing age-specific pediatric reference intervals. All five laboratories passed the reference interval validation for each liver function analyte in this study. The results suggest that the newly established pediatric reference intervals are valid for most of the children in Changchun and can be used directly by most of the hospitals with guaranteed accuracy. However, considering the different populations and nationalities from other areas in Jilin province, we have already started to recruit reference individuals from more areas in Jilin province for further validation. We aim to establish pediatric reference intervals for major population who under treatment in Changchun.

fulltextpubmed· Body· item PMC5920009

However, considering the different populations and nationalities from other areas in Jilin province, we have already started to recruit reference individuals from more areas in Jilin province for further validation. We aim to establish pediatric reference intervals for major population who under treatment in Changchun. Although the partitions of reference intervals are required based on firm statistical analysis, it is unclear whether these statistic differences are medical relevant. Thus, the reference interval data need to be updated every few years as the reference population change with environmental and nutrition factors. Besides, the diversity of detection system could lead to differences of test results. In the present study, these intervals are Hitachi 7600 method specific. They might need to be transferred when used in any laboratory that requires pediatric reference intervals if they are transferable to different methods as recommended by CLSI C28-A3 [1]. Completion of these transferences will allow a broader application of reference intervals developed through our study. The new database may also be of rural benefit and likely be used by hospital laboratories in other cities, although intervals should also be validated with local populations and transferred with recommendation by the CLSI [1].

fulltextpubmed· Body· item PMC5920009

ferences will allow a broader application of reference intervals developed through our study. The new database may also be of rural benefit and likely be used by hospital laboratories in other cities, although intervals should also be validated with local populations and transferred with recommendation by the CLSI [1]. In summary, this study provided updated age- and gender-specific pediatric reference intervals for 8 basic liver function tests using a modern analytical chemistry platform and a large cohort study of healthy children. All analytes required age partitioning. Proteins (TP, ALB) and bilirubins (TBIL, DBIL) did not require gender. In contrast, considerable gender partitioning was required for ALT, AST, GGT, and ALP. The marked changes and fluctuations in children during their growth and development make it important to determine age- and gender-pediatric reference intervals and, therefore, enhance the diagnostic safety in clinical laboratory. Acknowledgements The authors are grateful to Su-Yan Tian who have assisted them to make statistical analysis. Author contributions JCX designed the study, and contributed to drafting the manuscript. QZ designed the study, and performed the tests and collected the data. SLZ, LQW, and HXY performed the tests and collected the data. XL analyzed the data, interpreted the results, and contributed to drafting the manuscript. DW, CY, QA analyzed the data and interpreted the results. CXY contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

fulltextpubmed· Body· item PMC5920009

LZ, LQW, and HXY performed the tests and collected the data. XL analyzed the data, interpreted the results, and contributed to drafting the manuscript. DW, CY, QA analyzed the data and interpreted the results. CXY contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript. Funding This study was supported by grants from National Science Foundation of China (grant No. 81501839), Jilin Science and Technology Development Program (grant Nos. 20160101091JC, 20150414039GH), and Norman Bethune Program of Jilin University (grant No. 2012223). Compliance with ethical standards Ethical approval This study was approved by the Institutional Ethics Committee of The First Hospital of Jilin University. Conflict of interest The authors have declared that they have no conflicts of interest.

fulltextpubmed· Body· item PMC6154211

Introduction Transcatheter closure is the preferred treatment for atrial septal defects (ASDs) when the anatomy is suitable because a lower rate of early postprocedural complications is observed for transcatheter closure than that for surgery [1]. Because the development of a safe and less invasive procedure with less radiation exposure is important, particularly for a procedure performed on children, and transesophageal echocardiography (TEE) was generally used patients with clear sound window, transcatheter ASD closure guided by TEE is proposed. Initially, TEE was used to supplement X-ray imaging in catheter guidance and intraoperative evaluation of cardiac surgery. In recent years, TEE has been found to be feasible for guiding transcatheter ASD closure in children. We retrospectively reviewed cases in our hospital to evaluate the feasibility, safety and effectiveness of this approach. Methods This study was approved by the Ethics Committee of Children’s Hospital, Zhejiang University School of Medicine. All patients were preoperatively diagnosed with isolated secundum ASD based on medical history, clinical signs, chest X-rays, electrocardiograms and transthoracic echocardiography (TTE). Careful examination was performed to assess the locations, numbers, sizes and morphology of ASDs; the distances of ASDs from the superior and inferior vena cava, the atrioventricular valve, and the atrial roof; and ASD dimensions. No patient had severe pulmonary hypertension or evidence of an infectious disease or other diseases that would be contraindications for surgery.

fulltextpubmed· Body· item PMC6154211

ns, numbers, sizes and morphology of ASDs; the distances of ASDs from the superior and inferior vena cava, the atrioventricular valve, and the atrial roof; and ASD dimensions. No patient had severe pulmonary hypertension or evidence of an infectious disease or other diseases that would be contraindications for surgery. Procedure After total intravenous and endotracheal anesthesia was induced, we revaluated each ASD via TEE (Philips IE-33) from various viewpoints. In general, we used the right femoral vein as the catheter path, and a 5F arterial sheath was introduced after the vein was punctured. We intravenously administered heparin at a dose of 100 units/kg prior to the procedure. The ASD occluder system from Shanghai Shape Memory Alloy Material Co. Ltd. or Lifetech Technology (Shenzhen) Co., Ltd. was selected.

fulltextpubmed· Body· item PMC6154211

al vein as the catheter path, and a 5F arterial sheath was introduced after the vein was punctured. We intravenously administered heparin at a dose of 100 units/kg prior to the procedure. The ASD occluder system from Shanghai Shape Memory Alloy Material Co. Ltd. or Lifetech Technology (Shenzhen) Co., Ltd. was selected. We use dual imaging/color to visualize the probe in the whole procedure. We selected 90°–110° tomographic sections and inserted a 5F multipurpose (MP) catheter (measuring the distance between the puncture and the left intercostal space of the sternum). We made fine adjustments to show the inferior and superior vena cava and guide the catheter to pass through the inferior vena cava to the left atrium. The wire might sometimes mistakenly enter a liver or kidney vein, particularly during procedures performed by new operators. To avoid this problem, we typically measured the distance between the heart and the incision location and switched from an esophageal probe to an abdominal probe to track the wire. Once the end of this distance had been reached and we could not see the wire in the atrium, we could withdraw the wire immediately to ensure that the liver or kidney remained undamaged. An MP catheter was placed into the left pulmonary vein through the ASD using a TEE transducer angle of 45°–90°, and the catheter was guided into the left atrium or the left pulmonary vein. The catheter was fixed, and the probe was rotated to the left to enable observation of the left atrial appendage and left pulmonary vein and to the right to permit observation of the right pulmonary vein and confirm that the catheter did not reach the top of the left atrial appendage.

fulltextpubmed· Body· item PMC6154211

atrium or the left pulmonary vein. The catheter was fixed, and the probe was rotated to the left to enable observation of the left atrial appendage and left pulmonary vein and to the right to permit observation of the right pulmonary vein and confirm that the catheter did not reach the top of the left atrial appendage. A 0.035″ guide wire was inserted into the delivery sheath, and the occlusion device was fed along the delivery sheath into the left atrium. We observed the top of the sheath, created a pathway to deliver the occlusion device, and retracted the wire and core; the occlusion device was then sent along this pathway to the ASD. We subsequently released the left atrial disc after the withdrawal of the delivery system to close the atrial septum and retracted the outer sheath to release the waist and right atrial disc of the occlusion device such that the atrial septum was between the left and right umbrella folders. We used color flow Doppler to confirm closure of the ASD, unobstructed systemic/pulmonary venous return, and no compromise of atrioventricular valve function. After the successful release of the occlusion device had been verified, the delivery system was removed, and the femoral vein puncture was covered with a pressure bandage.

fulltextpubmed· Body· item PMC6154211

lor flow Doppler to confirm closure of the ASD, unobstructed systemic/pulmonary venous return, and no compromise of atrioventricular valve function. After the successful release of the occlusion device had been verified, the delivery system was removed, and the femoral vein puncture was covered with a pressure bandage. During the procedure, we closely monitored electrocardiograms for conduction block, T wave changes, other arrhythmias, blood pressure changes, and additional unexpected observations; if any abnormalities were detected, the patient would have immediately been referred for surgical closure (Fig. 1).Fig. 1 Percutaneous device closure of atrial septal defect (ASD) under the guidance of transesophageal echocardiograpy (TEE) Follow-up Patients were followed up via TTE to assess cardiac function, occlusion device morphology, residual shunt status, and other indicators. Additionally, the patients’ chest X-rays and electrocardiograms were double-checked in cases involving complications. Results From August 2016 to December 2017, 88 patients with isolated ostium secundum ASD underwent ASD closure under the guidance of TEE. There were 31 male patients and 57 female patients. The patients’ mean age was 60.09 ± 36.42 months (13–182 months), and their mean body weight was 20.16 ± 10.04 kg (9–77 kg).

fulltextpubmed· Body· item PMC6154211

Follow-up Patients were followed up via TTE to assess cardiac function, occlusion device morphology, residual shunt status, and other indicators. Additionally, the patients’ chest X-rays and electrocardiograms were double-checked in cases involving complications. Results From August 2016 to December 2017, 88 patients with isolated ostium secundum ASD underwent ASD closure under the guidance of TEE. There were 31 male patients and 57 female patients. The patients’ mean age was 60.09 ± 36.42 months (13–182 months), and their mean body weight was 20.16 ± 10.04 kg (9–77 kg). Percutaneous transcatheter closure of ASD under the guidance of TEE was performed successfully in all children. The sizes of the secundum ASDs ranged from 3 to 28 mm (11.58 ± 5.31 mm), and the mean distances from the rim to the atrial roof, the superior vena cava and the inferior vena cava were 10.68 ± 3.25 mm (4–19 mm), 13.29 ± 4.45 mm (3.6–25 mm) and 13.11 ± 4.51 mm (6–33 mm), respectively. The mean size of the occlusion device was 16.07 ± 5.29 mm (6–36 mm). The patients were examined via TEE immediately after procedure, and all findings were normal (Table 1). The mean procedural times were 13.33 ± 2.82 minutes (6–16 minutes).Table 1 Individual ASD parameters for successful percutaneous ASD closure under the guidance of TEE

fulltextpubmed· Body· item PMC6154211

e occlusion device was 16.07 ± 5.29 mm (6–36 mm). The patients were examined via TEE immediately after procedure, and all findings were normal (Table 1). The mean procedural times were 13.33 ± 2.82 minutes (6–16 minutes).Table 1 Individual ASD parameters for successful percutaneous ASD closure under the guidance of TEE Variables Values Range Diameter of the ASD (mm) 11.58 ± 5.31 3–28 Distance to the MV (mm) 14.02 ± 4.33 6.5–26 Distance to the atrial roof (mm) 10.68 ± 3.25 4–19 Distance to the SVC (mm) 13.29 ± 4.45 3.6–25 Distance to the IVC (mm) 13.11 ± 4.51 6–33 Size of the occlusion device (mm) 16.07 ± 5.29 6–36 Values are presented as mean ± standard deviation ASD atrial septal defect, TEE transesophageal echocardiography, SVC superior vena cava, IVC inferior vena cava, MV mitral valve No complications, such as displacement of occluder, cardiac arrhythmia, pericardial effusion, hemolysis were found during follow-up reviews conducted on the first postoperative day, The mean hospitalization costs was 4124.0 ± 379.2 USD (3812.4-5130.3 USD).The mean postoperative hospital stay was 3.2 ± 0.5 days (3–5 days). No complications were found during the third month and one-half year after the procedure. Discussion Minimally invasive procedure has become a preferable choice for ASD closure because such procedure does not require thoracotomy, does not leave a scar on the chest and involves less incisions [1–4].

fulltextpubmed· Body· item PMC6154211

No complications, such as displacement of occluder, cardiac arrhythmia, pericardial effusion, hemolysis were found during follow-up reviews conducted on the first postoperative day, The mean hospitalization costs was 4124.0 ± 379.2 USD (3812.4-5130.3 USD).The mean postoperative hospital stay was 3.2 ± 0.5 days (3–5 days). No complications were found during the third month and one-half year after the procedure. Discussion Minimally invasive procedure has become a preferable choice for ASD closure because such procedure does not require thoracotomy, does not leave a scar on the chest and involves less incisions [1–4]. TEE can provide detailed observations of an ASD and its rims and is a feasible, safe, non-invasive and easy procedure. Moreover, relative to the surgery, TEE results in shorter recovery times, shorter hospital stays, and fewer complications. The use of TEE has been shown to be safe and effective for guidance of ASD closures [2]. Transcatheter closure is evolving to become the new and efficient standard of care for children with ASD [5, 6].

fulltextpubmed· Body· item PMC6154211

over, relative to the surgery, TEE results in shorter recovery times, shorter hospital stays, and fewer complications. The use of TEE has been shown to be safe and effective for guidance of ASD closures [2]. Transcatheter closure is evolving to become the new and efficient standard of care for children with ASD [5, 6]. In traditional ASD closure by catheterization, digital subtraction angiography (DSA) is used to estimate the patient’s preoperative condition and to postoperatively indicate whether an operation has been successful due to the clear visualization and immediacy; ultrasound is only used to assist with preoperative assessment [7]. However, DSA-emitted X-rays harm the health of patients and operators [8]. We have found that TEE feasibly provides guidance throughout the entire ASD closure procedure [9]. TEE does not emit radiation; this advantage is especially important for growing children [10–12]. Given that DSA instruments are expensive, resulting in procedures that cost much more than TEE-guided procedure, TEE is a better choice than DSA for ASD closure in children.

fulltextpubmed· Body· item PMC6154211

throughout the entire ASD closure procedure [9]. TEE does not emit radiation; this advantage is especially important for growing children [10–12]. Given that DSA instruments are expensive, resulting in procedures that cost much more than TEE-guided procedure, TEE is a better choice than DSA for ASD closure in children. During ASD closure in children under the guidance of TEE alone, TEE is used to guide wire passage through the vena cava to the right atrium. When the wire enters the right atrium, TEE can reveal the location of the wire and can be helpful when guiding the wire across the ASD and creating a path for the occlusion device. TEE can be utilized to carefully monitor the entire process of the occlusion device being released, particularly with respect to ensuring that the device is correctly placed, determining whether the device is completely released, verifying that no residual shunt remains and indicating the condition of the atrial valve. In our procedures, when the occlusion device was confirmed to be correctly placed, we released the device completely to assess the effect of the device.

fulltextpubmed· Body· item PMC6154211

is correctly placed, determining whether the device is completely released, verifying that no residual shunt remains and indicating the condition of the atrial valve. In our procedures, when the occlusion device was confirmed to be correctly placed, we released the device completely to assess the effect of the device. The entire minimally invasive process is performed completely under the guidance of TEE; as a result, the principal advantage is avoidance of ionizing radiation; meanwhile, no open chest surgery is performed, no scars are left on patients’ chests, and there is a relatively low risk of postoperative infections. Although TTE can also be used to guide the process, TTE cannot provide a picture as clear as that produced by TEE and can be highly inaccurate in overweight, barrel-chested patients [13–15]. Moreover, TTE requires operators with expertise [16]. We successfully occluded 88 patients. One 10-year-old patient with 3 mm ASD was performed the procedure because he suffered from repeated respiratory infections and also had a family history of stroke. After being fully informed about the situation, the parents of the patient asked us to perform the treatment. All patients were treated while under general anesthesia; given that a baby’s esophagus is delicate, we used a probe designed specifically for babies to avoid oropharyngeal and esophageal trauma [17]. All procedures were performed on operating tables to allow for immediate conversion to open chest surgery without the need to anesthetize patients again in case the procedure failed [14].

fulltextpubmed· Body· item PMC6154211

a baby’s esophagus is delicate, we used a probe designed specifically for babies to avoid oropharyngeal and esophageal trauma [17]. All procedures were performed on operating tables to allow for immediate conversion to open chest surgery without the need to anesthetize patients again in case the procedure failed [14]. In conclusion, non-fluoroscopic percutaneous transcatheter ASD closure in children under the guidance of TEE not only avoids the use of DSA but also is easy to learn and utilize. This procedure offers a safe, feasible and effective method for ASD closure. Author contributions JJY and WZX conceived and designed the project, analyzed the data, and drafted the initial manuscript. JHL, JGY and ZWZ collected the data and participated in patient management. JY and XYS interpreted the data and funded the project. All authors approved the final manuscript as submitted. Funding This study was funded by a Grant from the Department of Education of Zhejiang Province (Y201636526). Ethical approval All procedures performed in studies involving human participants were conducted in accordance with the ethical standards of applicable institutional and/or national research committees and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Conflict of interest All authors declare that there are no conflicts of interest associated with this work.

fulltextpubmed· Body· item PMC6208747

Introduction Asthma is the most common chronic disease of childhood. It is characterized by both local inflammation in the airways as well as low grade systemic inflammation. One of the peptides involved in various inflammatory diseases is leptin, a hormone that belongs to the interleukin 6 cytokine family. It is mainly produced by adipose tissue and exerts its neuroendocrine effects in the control of food intake and energy expenditure in hypothalamus. In addition to the hypothalamus, leptin binding has also been reported in hematopoietic cells, liver, kidney, skin, stomach, heart, spleen and lung tissue. In the lung, leptin, upon binding to its receptor, shows a pro-inflammatory effect [1–3]. In response to inflammatory stimuli, increased leptin mRNA and protein levels have been observed and are associated with symptoms intensification and exacerbation [4, 5]. In animal studies, leptin deficiency decreased inflammatory response in autoimmune diseases [6, 7]. Moreover, models using genetically modified mice sensitized with ovalbumin showed that leptin led to pathological increase in airways reactivity and enhanced cytokine production in response to ozone in comparison to control mice [8].

fulltextpubmed· Body· item PMC6208747

dies, leptin deficiency decreased inflammatory response in autoimmune diseases [6, 7]. Moreover, models using genetically modified mice sensitized with ovalbumin showed that leptin led to pathological increase in airways reactivity and enhanced cytokine production in response to ozone in comparison to control mice [8]. Recent in vitro studies also showed that viral infection, the main cause of asthma exacerbations, led to increased secretion of leptin by bronchial epithelial cells resulting in activation of Th17 cells differentiation, and inhibition of Th2 cells differentiation [9]. These findings were confirmed by another in vitro study showing that leptin enhanced airway inflammation via increased intercellular adhesion molecule-1 expression and migration as well as cytokine synthesis in the human airway epithelium [10]. Previous clinical studies showed increased leptin levels in serum of adult patients diagnosed with asthma [11] and in children with atopic asthma as compared to healthy control groups [12, 13]. The reported increased leptin was independent of body mass index (BMI) value, thus suggesting that it may play a role in asthma independent of obesity. It seems that increased leptin level is specific for asthma, in particular, those with severe symptoms. This hypothesis was confirmed by a recent study showing increased leptin levels in severe asthma [14]. These results suggested that leptin may be used as a biomarker of severe asthma endotype characterized by lower lung function, systemic inflammation and more severe respiratory symptoms [14].

fulltextpubmed· Body· item PMC6785595

the white matter of the cerebellum. Arrows (white) point to nucleus (blue) of endothelial cell, and arrows (yellow) point to the Glialcam protein in astrocyte along blood vessels. It seemed that Glialcam showed a decreased red fluorescent in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice brain. Scale bars 20 μm Discussion In this study, macrocephaly, normal or slightly delayed in motor and cognitive development, and classic MRI features were found in five of the six patients evaluated. Therefore, the five patients were clinically diagnosed. The other patient had HC > 1 SD and a rapidly increased macrocephaly history during the infant period, with only subcortical WM involved; this patient was clinically diagnosed as atypical MLC. Four missense variants c.274C>T (p.Arg92Trp), c.275G>C(p.Arg92Pro), c.203A>T (p.Lys68Met) and c.395C>A (p.Thr132Asn) were detected in the six patients. One patient (Pt6) had two compound heterozygous mutations, and the five other patients had one mono-allelic mutation (Pt1–Pt5). Therefore, the six patients were genetically diagnosed. Five patients (Pt1–Pt5) had MLC2B, and one patient (Pt6) had MLC2A.

fulltextpubmed· Body· item PMC6208747

ose with severe symptoms. This hypothesis was confirmed by a recent study showing increased leptin levels in severe asthma [14]. These results suggested that leptin may be used as a biomarker of severe asthma endotype characterized by lower lung function, systemic inflammation and more severe respiratory symptoms [14]. Leptin levels were also associated with the severity of clinical symptoms as reported by Unal et al. [15] who showed increased leptin level in patients with allergic rhinitis patients during symptomatic period, although no association was observed with allergic rhinitis without asthma [13]. Leptin exerts its biological role via Ob-R transmembrane receptor in the hypothalamus. This receptor is also present on the surface of structural cells (epithelium, smooth muscle, fibroblasts) in the lungs. The different isoforms participate in leptin signal transduction, although the exact role of soluble form is not well understood. So far, no study analyzing the role of leptin receptor gene (LEPR) polymorphism on leptin receptor serum level in asthma has been performed. In our previous study, we reported that childhood asthma is associated with polymorphism in leptin gene (LEP), but not with LEPR [16]. Based on the above, we hypothesized that serum leptin level may be influenced by genetic polymorphism in LEP as well as by clinical condition in asthmatic patients. We also aimed to analyze if leptin receptor level or gene polymorphism may influence leptin level and asthma risk.

fulltextpubmed· Body· item PMC6208747

ptin gene (LEP), but not with LEPR [16]. Based on the above, we hypothesized that serum leptin level may be influenced by genetic polymorphism in LEP as well as by clinical condition in asthmatic patients. We also aimed to analyze if leptin receptor level or gene polymorphism may influence leptin level and asthma risk. Methods Patients The study included 25 asthmatic patients of Caucasian origin: 6-18 years old [mean age 9.77 years, standard deviation (SD) 3.73]. Patients were recruited from hospitalized patients, treated for asthma in the Department of Pulmonology, Pediatric Allergy and Clinical Immunology, Poznan University of Medical Sciences. The asthma diagnosis was made according to GINA 2002 recommendation, based on clinical asthma symptoms and lung function testing. Clinical diagnosis of atopy depended on current or past symptoms of atopic dermatitis and/or allergic rhinitis. Atopy was confirmed with total immunoglobulin E (IgE) level higher than the upper normal limits for age and positive skin prick test to at least one aero-allergen (Dermatophagoides pteronyssinus, Dermatophagoides farinae, cat, dog, feathers, Alternaria alternata, Cladosporium herbarum; pollen: grass mix, rye, birch pollen, alder, hazel–Allergopharma, Germany).

fulltextpubmed· Body· item PMC6208747

lin E (IgE) level higher than the upper normal limits for age and positive skin prick test to at least one aero-allergen (Dermatophagoides pteronyssinus, Dermatophagoides farinae, cat, dog, feathers, Alternaria alternata, Cladosporium herbarum; pollen: grass mix, rye, birch pollen, alder, hazel–Allergopharma, Germany). The patients were analyzed twice: during exacerbation of symptoms and in the asymptomatic period. Exacerbation was defined as the presence of asthma symptoms (daytime symptoms, nocturnal symptoms, limitation of daily activities, the need for medical treatment, and reduced lung function) due to allergen exposure or respiratory viral infection. Asymptomatic period was characterized by good control of asthma symptoms and no acute infections for 2 weeks before blood collection. Control group Control group consisted of 10 healthy subjects of Caucasian origin (mean age 12.6 years, SD = 3.02). Control subjects were also recruited from the same geographic region from the group of carefully chosen volunteers without asthma and allergy symptoms. Any allergic diseases or asthma were excluded based on clinical examination, spirometry and exhaled NO measurement in the airways. We also excluded individuals with chronic diseases other than allergy and asthma. All participants as well as their parents had given written informed consent. The project was approved by our local ethics committee accepted. Study was performed in compliance with the Code of Ethics of the World Medical Association (Declaration of Helsinki).

fulltextpubmed· Body· item PMC6208747

Control group Control group consisted of 10 healthy subjects of Caucasian origin (mean age 12.6 years, SD = 3.02). Control subjects were also recruited from the same geographic region from the group of carefully chosen volunteers without asthma and allergy symptoms. Any allergic diseases or asthma were excluded based on clinical examination, spirometry and exhaled NO measurement in the airways. We also excluded individuals with chronic diseases other than allergy and asthma. All participants as well as their parents had given written informed consent. The project was approved by our local ethics committee accepted. Study was performed in compliance with the Code of Ethics of the World Medical Association (Declaration of Helsinki). Genotyping The DNA was extracted from 10 mL of ethylene diamine tetraacetic acid anticoagulated whole blood using the salting out method [17]. We analyzed two LEP polymorphisms: upstream of coding gene region: rs13228377 (A/G) and rs2167270 (-2549T/G), and two LEPR polymorphisms: rs1137100 (Lys109Arg), rs12131454 (Glu223Arg). The polymerase chain reaction-restriction fragment length polymorphism analysis was done as described previously [16]. Enzyme-linked immuno sorbent assay (ELISA) Blood samples were collected using sample tubes without anticoagulant. After 1 hour, the sera were collected by centrifugation, and stored frozen at − 80 °C until further analysis. Concentration of leptin and leptin receptor in undiluted serum samples was measured using ELISA kit (BioVendor, Czech Republic) according to the manufacturer’s protocol.

fulltextpubmed· Body· item PMC6208747

sing sample tubes without anticoagulant. After 1 hour, the sera were collected by centrifugation, and stored frozen at − 80 °C until further analysis. Concentration of leptin and leptin receptor in undiluted serum samples was measured using ELISA kit (BioVendor, Czech Republic) according to the manufacturer’s protocol. Statistical analysis The Pearson’s Chi square (χ2) and Fisher’s exact tests were used to analyze differences in genotypic and allelic distribution between patients and control subjects. Normality of data distribution was tested using Shapiro–Wilk test. Differences between groups were analyzed using ANOVA analysis of variance. Within-group differences were evaluated with paired t test. Stepwise logistic regression analysis with Wald test was performed using disease status (case–control) as a dichotomous-dependent variable and the following predictors included in the model: genotypes of LEP and LEPR polymorphisms and serum leptin and leptin receptor levels. Statistical analyses were performed using Statistica v.12.0 software (Statsoft Polska). Statistically significant level was below 0.05.

fulltextpubmed· Body· item PMC6208747

se–control) as a dichotomous-dependent variable and the following predictors included in the model: genotypes of LEP and LEPR polymorphisms and serum leptin and leptin receptor levels. Statistical analyses were performed using Statistica v.12.0 software (Statsoft Polska). Statistically significant level was below 0.05. Results Asthmatic patients and control subjects included in the study did not differ significantly in gender and BMI, but asthmatic patients were younger than the healthy subjects (Table 1). Lung function results did not differ significantly between control group and asthmatic patients during asymptomatic period, but showed a significant decline during asthma exacerbation. The patients also demonstrated significant differences in total IgE levels as compared to the controls (Table 1).Table 1 Clinical description of the analyzed population Variables Patients group (n = 25) Control group (n = 10) P Male, % 53.80 50.00 0.87 Age (y), mean ± SD 9.95 ± 3.47 12.60 ± 3.02 0.04 BMI, mean ± SD 18.16 ± 3.08 20.17 ± 2.30 0.62 FEV1/FVC pred, mean ± SD 97.95 ± 8.96 98.40 ± 4.65 0.88 FEV1% pred, mean ± SD 100.10 ± 11.75 103.30 ± 13.61 0.49 FVC% pred, mean ± SD 93.50 ± 22.02 98.60 ± 14.80 0.50 FEV1/FVC pred exacerbation, mean ± SD 87.50 ± 14.90 – FEV1% pred exacerbation, mean ± SD 82.25 ± 19.58 – FVC% pred exacerbation, mean ± SD 88.00 ± 14.85 – IgE (IU/mL), mean ± SD 257.5 ± 326.7 7.32 ± 12.66 0.02 BMI body mass index, FEV1 forced expiratory volume in 1 s, FVC forced vital capacity, IgE immunoglobulin E, SD standard deviation

fulltextpubmed· Body· item PMC6208747

rbation, mean ± SD 87.50 ± 14.90 – FEV1% pred exacerbation, mean ± SD 82.25 ± 19.58 – FVC% pred exacerbation, mean ± SD 88.00 ± 14.85 – IgE (IU/mL), mean ± SD 257.5 ± 326.7 7.32 ± 12.66 0.02 BMI body mass index, FEV1 forced expiratory volume in 1 s, FVC forced vital capacity, IgE immunoglobulin E, SD standard deviation Serum leptin and leptin receptor levels in atopic asthma We observed that serum leptin level was higher in asthmatic patients during exacerbation (13.81 ± 10.56 ng/mL) than in the control subjects (6.32 ± 5.20 ng/mL), but this difference showed marginal significance (P = 0.078) (Fig. 1a). Asthmatic patients during asymptomatic period (control visit) also had higher leptin levels (10.46 ± 11.55 ng/mL) than the control group although the difference was not significant (P = 0.367) (Fig. 1b). However, analysis of leptin level between asthmatic patients with different clinical condition (exacerbation vs. stable period) showed significantly increased leptin level during asthma exacerbation (P = 0.025) (Fig. 1c).Fig. 1 Comparison of leptin levels in serum between asthmatic patients during exacerbation and the control group (a); asthmatic patients during asymptomatic period and the control group (b); and asthmatic patients during exacerbation and in the asymptomatic period (c) (ANOVA, box plot: mean ± SE with whiskers: 1.96SE). SE standard error, LEP leptin

fulltextpubmed· Body· item PMC6208747

vels in serum between asthmatic patients during exacerbation and the control group (a); asthmatic patients during asymptomatic period and the control group (b); and asthmatic patients during exacerbation and in the asymptomatic period (c) (ANOVA, box plot: mean ± SE with whiskers: 1.96SE). SE standard error, LEP leptin Serum leptin receptor analysis showed that the mean LEPR level was 15.01 ± 5.68 ng/mL in patients during exacerbation versus 14.5 ± 5.38 ng/mL in control subjects and did not differ significantly (P = 0.191). Similarly, no significant difference was observed between patients in the stable period (16.40 ± 5.64 ng/mL) and healthy subjects (P = 0.719). Analysis of serum leptin receptor level between exacerbation and stable period also showed no significant difference (P = 0.207). The analysis of serum leptin and leptin receptor levels did not correlate significantly with lung function measures, IgE levels and BMI values in asthmatic patients. Leptin and leptin receptor levels and genotypes We found that 5′-UTR LEP polymorphism (rs13228377) correlates with serum leptin levels, with AA genotype related to increased leptin level independent of asthma status, although the difference was marginally significant (P = 0.08). We also found that the risk genotype (AA) was significantly more frequent in asthmatic patients than in the control group (P = 0.010). For the other analyzed LEP polymorphisms, we did not show significant differences in leptin serum levels.

fulltextpubmed· Body· item PMC6208747

f asthma status, although the difference was marginally significant (P = 0.08). We also found that the risk genotype (AA) was significantly more frequent in asthmatic patients than in the control group (P = 0.010). For the other analyzed LEP polymorphisms, we did not show significant differences in leptin serum levels. Two analyzed LEPR polymorphisms (K109R and Q223R) did not affect significantly serum leptin receptor level independent of asthma status (P = 0.693 and P = 0.692, respectively). Moreover, no significant differences between asthmatic patients and controls were observed in genotype distribution for both LEPR polymorphisms (P = 0.072, P = 0.217, respectively). Leptin receptor and LEPR genotype When we analyzed if two nonsynonymous polymorphisms in the LEPR gene may affect leptin binding in serum, we found that no difference was observed between the genotypes and leptin serum level (Table 2).Table 2 Analysis of genotype of nonsynonymous LEPR polymorphism on leptin serum level LEPR genotype Mean LEP (ng/mL) SD P K109R 1 8.91 5.10 0.312 2 11.65 10.96 3 2.13 0.62 Q223R 1 10.24 5.11 0.978 2 11.03 10.63 3 10.28 11.78 LEPR leptin receptor gene, LEP leptin, SD standard deviation

fulltextpubmed· Body· item PMC6208747

Leptin receptor and LEPR genotype When we analyzed if two nonsynonymous polymorphisms in the LEPR gene may affect leptin binding in serum, we found that no difference was observed between the genotypes and leptin serum level (Table 2).Table 2 Analysis of genotype of nonsynonymous LEPR polymorphism on leptin serum level LEPR genotype Mean LEP (ng/mL) SD P K109R 1 8.91 5.10 0.312 2 11.65 10.96 3 2.13 0.62 Q223R 1 10.24 5.11 0.978 2 11.03 10.63 3 10.28 11.78 LEPR leptin receptor gene, LEP leptin, SD standard deviation Logistic regression analysis To analyze if genotypes of LEP and LEPR polymorphisms together with their serum levels could be good predictors of asthma risk, we included them in the stepwise logistic regression analysis. We found that including all variables in the model is not specific for asthma (P = 0.230). Reducing number of variables to serum levels or genotypes separately also was not useful for asthma prediction (P = 0.570 and P = 0.126, respectively). However, taking into account an association of rs13228377 LEP polymorphism with asthma and higher leptin levels in asthma, we included them together in a predictive model. We observed that including these two variables significantly improved the model. The genotype of rs13228377 LEP polymorphism and serum leptin level significantly increased asthma risk (P = 0.008), showing odds ratio 16.7 and good predictive accuracy (overall 83.9%, in asthma 91.3%, in controls 62.5%).

fulltextpubmed· Body· item PMC6208747

predictive model. We observed that including these two variables significantly improved the model. The genotype of rs13228377 LEP polymorphism and serum leptin level significantly increased asthma risk (P = 0.008), showing odds ratio 16.7 and good predictive accuracy (overall 83.9%, in asthma 91.3%, in controls 62.5%). Discussion The main finding of our study is an association of LEP polymorphism and serum leptin level with asthma. Our results confirmed previous association of the same LEP variant with atopic asthma in an independent cohort of pediatric patients. Our previous study performed on LEP and LEPR gene polymorphism showed an association of rs13228377 polymorphism with childhood asthma with AA risk genotype and A risk allele in a cohort of Polish children [16]. The associated leptin polymorphism is localized upstream of the coding gene region, in the 5′-UTR of the LEP. This variant is within the regulatory gene region (CTCF binding site) and nucleotide substitution alters the regulation of gene transcription resulting in increased leptin levels in the carriers of AA risk genotype (according to Ensembl database). This is the first study that showed association of rs13228377 polymorphism with serum leptin level.

fulltextpubmed· Body· item PMC6208747

regulatory gene region (CTCF binding site) and nucleotide substitution alters the regulation of gene transcription resulting in increased leptin levels in the carriers of AA risk genotype (according to Ensembl database). This is the first study that showed association of rs13228377 polymorphism with serum leptin level. The interesting observation from our study is that leptin level is significantly increased during asthma exacerbation suggesting its role in active inflammatory processes. This is in line with the previous studies that showed increased secretion of leptin by epithelial cells infected with respiratory syncytial viral virus in vitro [9] and also in clinical setting that upon allergen challenge, leptin level was significantly higher during pollen season in seasonal allergic rhinitis patients than outside pollen season [18]. It was also shown that asthmatic children presented with increased serum leptin levels on admission, and the level decreased after 4 weeks of anti-inflammatory treatment [12]. Moreover, these authors observed that after treatment, serum leptin level was comparable to that seen in healthy control subjects.

fulltextpubmed· Body· item PMC6208747

season [18]. It was also shown that asthmatic children presented with increased serum leptin levels on admission, and the level decreased after 4 weeks of anti-inflammatory treatment [12]. Moreover, these authors observed that after treatment, serum leptin level was comparable to that seen in healthy control subjects. In the recent genome wide association study (GWAS) performed in a cohort of over 32,000 participants [19], the authors analyzed thousands of chromosomal loci that may be responsible for circulating leptin levels. They found four loci, after adjusting for BMI, that were significantly associated with leptin levels: in/near LEP, SLC32A1, GCKR, CCNL1. More in-depth analysis revealed that common (MAF 49%) rs10487505 variant located 21 kb from LEP gene is in modest linkage disequilibrium (LD) (r2 = 0.4, D’ = 0.8) with the rs2167270 (A19G), the variant that has been extensively studied in candidate gene studies and leptin serum levels [20, 21]. Another study on serum leptin level reported an association of the same variant (rs10487505) with leptin level [22]. Analysis of LD showed that the previously analyzed variant (rs2167270) is in strong LD with the polymorphism analyzed in this study (rs13228377) (D’ = 1.0, r2 = 0.612). This may further support the observed association of rs13228377 with increased leptin level.

fulltextpubmed· Body· item PMC6208747

n of the same variant (rs10487505) with leptin level [22]. Analysis of LD showed that the previously analyzed variant (rs2167270) is in strong LD with the polymorphism analyzed in this study (rs13228377) (D’ = 1.0, r2 = 0.612). This may further support the observed association of rs13228377 with increased leptin level. Leptin receptor plays an essential role in mediating the physiological effects of leptin. In the study by Sun et al. [23], the authors performed GWAS to identify single nucleotide polymorphisms (including two common nonsynonymous LEPR variants) associated with soluble form of the receptor; however, these LEPR variants were not associated with leptin receptor levels, which is in line with the results in our study. Previous reports also showed abnormally high circulating leptin receptor levels in carriers of rare LEPR mutations [24], but not polymorphisms. Moreover, the study by Quinton et al. demonstrated that Gln223Gln genotype was associated with lower leptin binding capacity to the soluble form of the receptor in plasma [25], indicating abnormal receptor function that may contribute to leptin resistance [26].

fulltextpubmed· Body· item PMC6208747

rriers of rare LEPR mutations [24], but not polymorphisms. Moreover, the study by Quinton et al. demonstrated that Gln223Gln genotype was associated with lower leptin binding capacity to the soluble form of the receptor in plasma [25], indicating abnormal receptor function that may contribute to leptin resistance [26]. Taking into account previous reports, we investigated if two LEPR polymorphisms, K109R and Q223R, are associated with asthma risk or serum levels of leptin receptor or leptin. However, we did not find such associations This result is consistent with our previous study [16] and in line with the recent study by Kilpelainen et al. [19] who did not observe an association between LEPR variants and circulating leptin levels. Although two nonsynonymous LEPR variants are localized in the coding sequence of the gene and lead to aminoacid change in the extracellular domain of the receptor, no experimental data exist that could confirm their possible influence on receptor activity or function at the molecular level. To our knowledge, no other association studies of LEPR polymorphisms were performed in asthma so far, so we cannot compare our results. Leptin receptor levels were not previously described in association with childhood asthma, so it is difficult to verify our results.

fulltextpubmed· Body· item PMC6208747

ceptor activity or function at the molecular level. To our knowledge, no other association studies of LEPR polymorphisms were performed in asthma so far, so we cannot compare our results. Leptin receptor levels were not previously described in association with childhood asthma, so it is difficult to verify our results. The main limitation of this study is the small sample size. However, taking into account that this is a pilot study, we would like to emphasize that an association of rs13228377 polymorphism with asthma was previously observed also in an independent pediatric cohort (n = 243) [16]. Association of this variant with leptin serum level and lack of association between leptin receptor and its level in asthma were not published previously. In conclusion, we report here that rs13228377 LEP polymorphism may affect transcription regulation of leptin gene and subsequently its serum level. However, leptin secretion stimulated upon asthma exacerbation suggests that also other than genetic regulatory elements influence its serum level during active airway inflammation process. Due to the limited sample size of this study, further analyses are warranted to verify our findings.

fulltextpubmed· Body· item PMC6208747

subsequently its serum level. However, leptin secretion stimulated upon asthma exacerbation suggests that also other than genetic regulatory elements influence its serum level during active airway inflammation process. Due to the limited sample size of this study, further analyses are warranted to verify our findings. Author contributors DS participated in the study design, performed ELISA analysis and results interpretation, and drafted the paper. PS participated in the study design, collection of clinical data, and revised the manuscript. BN participated in the study design, banking of the biological material, and revised the paper. IWB participated in the study design, collection of clinical data, and revised the manuscript. AB participated in the study design, collection of clinical data, and revised the manuscript. AS participated in the study design, collection of data from the control group, performed genotyping and statistical analysis and revised the manuscript. All authors approved the final version of the manuscript. Funding This study was supported by the Polish National Science Center (2017/01/X/NZ4/00467). The funding source had no involvement in study design the collection, analysis and interpretation of data the writing of the report, the decision to submit the article for publication. Ethical approval Local Ethics Committee at Poznan University of Medical Sciences accepted the project (act no. 412/16). Conflict of interest None.

fulltextpubmed· Body· item PMC6394639

Introduction Attention-deficit hyperactivity disorder (ADHD) is a major public health concern. Systematic reviews indicate that the community prevalence globally is between 2% and 7%, with an average of around 5.5% [1–3]. There are approximately 10 million children between the ages of 6 and 14 with ADHD in China. Despite the large number of children affected, there is a lack of professionals needed to diagnose and treat children in China. General pediatricians receive little–no ADHD training. There are about 300 registered child psychiatrists in China [4], which means there are only two child psychiatrists per million children aged 6–14. Developmental and behavioral pediatrics is a new subspecialty in China. The Academy Section on Developmental and Behavioral Pediatrics in China was only founded in October 2011. Many parents of children suspected of having ADHD, therefore, are not able to find a qualified physician to diagnose and treat their child.

fulltextpubmed· Body· item PMC6394639

4. Developmental and behavioral pediatrics is a new subspecialty in China. The Academy Section on Developmental and Behavioral Pediatrics in China was only founded in October 2011. Many parents of children suspected of having ADHD, therefore, are not able to find a qualified physician to diagnose and treat their child. The internet is a source of information for people concerned about mental health and developmental disabilities. People, including 96% of all parents, tend to seek out information on the incidence, treatment, or increased severity of the disability [5, 6]. Surveys have found that parents of children with ADHD and ADHD adolescents themselves have expressed similar strong preferences for the internet as the ADHD information, 49% and 51%, respectively, or from a doctor, 40% and 27%, respectively [7]. Parents of children with confirmed and suspected ADHD have been found to seek relevant and accessible information about ADHD to assist them in understanding, managing, and supporting their child and make effective treatment decisions. It has reported that as high as 94% of the internet user reported that the information they found had some impact on the health decisions they made [8–11].

fulltextpubmed· Body· item PMC6394639

to seek relevant and accessible information about ADHD to assist them in understanding, managing, and supporting their child and make effective treatment decisions. It has reported that as high as 94% of the internet user reported that the information they found had some impact on the health decisions they made [8–11]. Parents often grapple with decision-making conflicts or uncertainty about a course of action when caring for an ADHD child. For example, parents may be hesitant to use medicine [12]. In reviewing Chinese online ADHD forums, instances of conflicted parental decision-making are readily apparent [13]. Parents who successfully resolve their conflicts are more likely to feel satisfied with their decision and more likely to maintain the treatment resulting from that decision. Conversely, unresolved decisional conflicts may lead to delayed treatment, a lack of confidence in decisions that have been made and poor treatment continuity [14, 15]. Information is available online on Chinese websites regarding childhood ADHD, but it is what motivateses Chinese parents to seek health information online, how successful they are in obtaining information, the extent of decisional conflict the parentals experience, or how able Chinese parents are to obtain information to reduce decisional conflicts, are all unknown. The purpose of the current study is to survey Chinese parents of confirmed, or suspected, ADHD children, to explore: (1) their motivations in using the internet to retrieve ADHD-related information; (2) how extensive decisional conflicts are; (3) the extent to which online information is able to reduce decision-making conflicts regarding aspects of their child’s ADHD; and (4) sociodemographic and other factors associated with decisional conflict.

fulltextpubmed· Body· item PMC6394639

ivations in using the internet to retrieve ADHD-related information; (2) how extensive decisional conflicts are; (3) the extent to which online information is able to reduce decision-making conflicts regarding aspects of their child’s ADHD; and (4) sociodemographic and other factors associated with decisional conflict. Methods Design This study is a web-based, anonymous cross-sectional survey. Participants Any parent of children with confirmed, or suspected, ADHD who had obtained ADHD-related information from the internet and had used that internet-sourced information to consider a treatment decision were eligible to participate. Recruitment Participants were recruited through an advertisement posted during April and May 2017 on one of the Chinese health portals (http://www.39.net), which have parent forums specifically focusing on ADHD and have the highest internet traffic on this topic. The aims of the study, and the eligibility requirements were described in the advertisement, together with the online survey developed for this study. Measurement The survey was anonymous and included a total of 37 Likert scales or multiple-choice questions. Parents were surveyed about their experience and skills in using the internet. Questions about the first 4 of 5 motivations for using the internet to retrieve information regarding ADHD were included. Demographic information, such as child gender, parental age, and education levels, and information about their child’s ADHD status, such as medications and other and treatments was included.

fulltextpubmed· Body· item PMC6394639

ternet. Questions about the first 4 of 5 motivations for using the internet to retrieve information regarding ADHD were included. Demographic information, such as child gender, parental age, and education levels, and information about their child’s ADHD status, such as medications and other and treatments was included. To assess the decision-making process, a 10-item, low-literacy decision conflict scale (DCS), a validated scale developed by researchers at the Ottawa Hospital Research Institute [14], was adopted and made part of the questionnaire. This scale yields a total score and 4 subscale scores which have been found to address decision-making conflicts: informed, values clarity, support, and uncertainty. Subscale scores and total scores were calculated within a range from 0 to 100 [14]. Total score > 37.5 has been shown to indicate significantly conflicted decision-making [16]. The survey was piloted to assess the ease of survey completion and question clarity. Institutional review board approval was issued by Xiangya Hospital, Central South University.

fulltextpubmed· Body· item PMC6394639

To assess the decision-making process, a 10-item, low-literacy decision conflict scale (DCS), a validated scale developed by researchers at the Ottawa Hospital Research Institute [14], was adopted and made part of the questionnaire. This scale yields a total score and 4 subscale scores which have been found to address decision-making conflicts: informed, values clarity, support, and uncertainty. Subscale scores and total scores were calculated within a range from 0 to 100 [14]. Total score > 37.5 has been shown to indicate significantly conflicted decision-making [16]. The survey was piloted to assess the ease of survey completion and question clarity. Institutional review board approval was issued by Xiangya Hospital, Central South University. Analysis Differences among study variables were tested by Student’s t test or ANOVA for continuous variables and Chi square test or Mann–Whitney U test for categories of variables. Factors influencing survey completion were assessed using a stepwise multiple linear regression model. T test or bivariate correlation, and multiple regression analysis were used to determine relationships between scores of decisions conflict scale and demographic factors or parents’ experience of internet use. Significance level was at the rate of P = 0.05. Data analysis was carried out using the SPSS software package (version 16.0, SPSS, Chicago, IL).

fulltextpubmed· Body· item PMC6394639

nd multiple regression analysis were used to determine relationships between scores of decisions conflict scale and demographic factors or parents’ experience of internet use. Significance level was at the rate of P = 0.05. Data analysis was carried out using the SPSS software package (version 16.0, SPSS, Chicago, IL). Results Response rate A total of 2189 eligible participants began the survey. A total of 404 (18.5%) completed it. Of the 2189 participants who began the survey, 596 completed the first 7 questions. A total of 67.8% (404/596) completed all 37 questions. In examining the differences between incomplete responders (n = 192) and complete responders (n = 404), complete responders were more likely to have had their children assessed for ADHD (30.2% vs 15.6%, χ2 = 14.55, P = 0.00), and were 2.34 times [odds ratio (OR) = 2.34, 95% confidence interval (CI) 1.50–3.64] more likely to complete the survey. Demographics and internet skills The demographic characteristics of the parents taking the survey are shown in Table 1. As is often the case with parental surveys regarding online health information about children’s disease [17], the majority of respondents (70.8%) were women. A majority of the parents (58.7%, 237/404) rated their internet skills to be an “intermediate user”, 26.2% (106/404) as an “expert user” and 15.1% (61/404) as a “beginner”. Their rated internet skills had a medium correlation with the highest educational levels (rs = 0.456, P = 0.000).Table 1 Demographic profile of respondents

fulltextpubmed· Body· item PMC6394639

ty of the parents (58.7%, 237/404) rated their internet skills to be an “intermediate user”, 26.2% (106/404) as an “expert user” and 15.1% (61/404) as a “beginner”. Their rated internet skills had a medium correlation with the highest educational levels (rs = 0.456, P = 0.000).Table 1 Demographic profile of respondents Characteristics n (%) Gender Female 286 (70.8) Male 118 (29.2) Age group (y) < 30 91 (22.5) 30–39 238 (58.9) 40–49 67 (16.6) ≥ 50 8 (2.0) Marital status Married 375 (92.8) Widowed 2 (0.5) Divorced 16 (4.0) Separated 5 (1.2) Never married 6 (1.5) Highest level of education completed Less than high school 61 (15.1) High school 125 (30.9) Technical college 110 (27.2) Bachelors degree 87 (21.5) Postgraduate degree 21 (5.3) Employment status Employed 319 (79.0) Not employed 77 (19.0) Retired 8 (2.0) Disabled, not able to work 0 (0) ADHD diagnosis and treatment details of respondents’ children Only 30.2% of the children (122/404) had been evaluated as having ADHD by professionals. However, 82.0% (100/122) had been diagnosed. Of the 100 children diagnosed with ADHD, 17.0% had been diagnosed 6–10 years previously; 52.0% 1–6 years previously; and, 31.0% less than a year previously. Thirty parents were unsure of the type of ADHD their children had. Among the children with a confirmed ADHD type, 44.3% (31/70) were inattentive, 20% (14/70) were hyperactive–impulsive, and 35.7% (25/70) were combined.

fulltextpubmed· Body· item PMC6394639

diagnosed 6–10 years previously; 52.0% 1–6 years previously; and, 31.0% less than a year previously. Thirty parents were unsure of the type of ADHD their children had. Among the children with a confirmed ADHD type, 44.3% (31/70) were inattentive, 20% (14/70) were hyperactive–impulsive, and 35.7% (25/70) were combined. Forty-four percent of the children with confirmed ADHD (44/100) had taken medications such as Ritalin, Concerta, or Strattera, the only three medications allowed for use in China to treat ADHD. Thirty-two were still taking medications during the survey period. There were significantly more children with confirmed ADHD who had used alternative treatments than those with unconfirmed ADHD (42.0% vs 19.4%, χ2 = 20.484, P = 0.000). A majority of the parents of children with either confirmed, or unconfirmed, ADHD had used parenting strategies (70.0% vs 69.7%, χ2 = 0.002, P = 1.000). Obtaining information about ADHD Among the parents who had sought information about ADHD online, 5.9% (24/404) indicated the internet as the only information source. In addition to the internet, 28.0% (113/404) also sought information from books, 27.0% (109/404) from professionals, 21.8% (88/404) from family or friends, 17.3% (70/404) from teachers, and 17.1% (69/404) from magazines or newspapers. Only 11.6% sought information from TV or radio.

fulltextpubmed· Body· item PMC6394639

ernet as the only information source. In addition to the internet, 28.0% (113/404) also sought information from books, 27.0% (109/404) from professionals, 21.8% (88/404) from family or friends, 17.3% (70/404) from teachers, and 17.1% (69/404) from magazines or newspapers. Only 11.6% sought information from TV or radio. We investigated parental motives in retrieving online ADHD-related information and focused on four drives, knowledge, uncertainty, social, and self-actualization. These have been described as drives for seeking health information on the internet [8] (Table 2). The first two most common parental motives parents were “Want to get better care for their children” (self-actualization) and “Check for information about specific symptoms of ADHD” (uncertainty). About one-third (34.2%, 138/404) indicated all four drives, 29.0% (117/404) indicated three, 35.4% (143/404) indicated two, 1.0% (4/404) indicated one, and 0.5% (2/440) indicted zero.Table 2 Parents’ drives for seeking ADHD related information on the internet

fulltextpubmed· Body· item PMC6394639

information about specific symptoms of ADHD” (uncertainty). About one-third (34.2%, 138/404) indicated all four drives, 29.0% (117/404) indicated three, 35.4% (143/404) indicated two, 1.0% (4/404) indicated one, and 0.5% (2/440) indicted zero.Table 2 Parents’ drives for seeking ADHD related information on the internet Variables n (%) Knowledge drive (searching for new knowledge or verifying existing knowledge) 280 (69.3) Want to find out about new treatments for ADHD 193 (47.8) Want to find the latest research about ADHD 105 (26.0) Want to learn more about ADHD 92 (22.8) Want to learn about other treatments beyond those that my doctor told me about 91 (22.5) Want to be sure the advice that my doctor gave me was correct 81 (20.0) Uncertainty drive (to reduce feelings of uncertainty and anxiety) 334 (80.2) Check for information about specific symptoms of ADHD 285 (70.5) Want to check for information about specific concerns 111 (27.5) Social drive (to share information) 228 (56.4) Want to talk to other parents of children with ADHD 189 (46.8) Want to get information to explain their children’s ADHD to friends, relatives, teachers and colleagues 118 (29.2) Self-actualization drive (to increase feeling of self-esteem, and to achieve the best possible health status) 361 (89.4) Want to take better care for their children 321 (81.9) Want to play a larger role in their children’s care related ADHD 213 (52.7) Want to be more confident in talking to their children’s doctors about ADHD 70 (17.3)

fulltextpubmed· Body· item PMC6394639

n drive (to increase feeling of self-esteem, and to achieve the best possible health status) 361 (89.4) Want to take better care for their children 321 (81.9) Want to play a larger role in their children’s care related ADHD 213 (52.7) Want to be more confident in talking to their children’s doctors about ADHD 70 (17.3) When asked why they preferred the internet as the information source instead of other sources, 83.7% (338/404) indicated because it was convenient, 56.4% (228/404) because they could get information that would not be easy to get elsewhere, 53.0% (214/404) because it was free, 48.0% (194/404) was to find resources and products that might be helpful, 41.8% (169/404) was to read the most up-to-date information, 28.2% (114/404) to chat with professionals or ask questions online, 28.2% (114/404) because it was anonymous, and 25.2% (102/404) to get support from, or chat with, others online. The number of times parents reported using the internet for specific topics varied widely (Table 3). Nearly all (95.3%) reported going online at least once to search for information on ADHD symptoms. More than three-fourths sought information on the causes of ADHD (83.7%) or for behavior management and parenting strategies (75.7%). Only half sought information on medications (50.5%) and complementary and alternative treatments for ADHD (51.2%). Among the parents of children who had taken mediations, 84.5% (60/71) had sought information on the medications, and they searched more often that parents of children who had not taken medication (Z = -6.72, P = 0.000).Table 3 Online searching times and perceived information quality on each ADHD topic

fulltextpubmed· Body· item PMC6394639

for ADHD (51.2%). Among the parents of children who had taken mediations, 84.5% (60/71) had sought information on the medications, and they searched more often that parents of children who had not taken medication (Z = -6.72, P = 0.000).Table 3 Online searching times and perceived information quality on each ADHD topic Variables Frequency of searching Perceived quality Never 1–5 times 6–10 times > 10 times Good Fair Poor ADHD symptoms 19 (4.7) 254 (62.9) 68 (16.8) 63 (15.6) 175 (47.1) 192 (51.6) 5 (1.3) Causes of ADHD 66 (16.3) 237 (58.7) 47 (11.6) 54 (13.4) 145 (44.0) 171 (52.0) 13 (4.0) Diagnosing ADHD 113 (28.0) 214 (53.0) 34 (8.4) 43 (10.6) 102 (36.4) 159 (56.8) 19 (6.8) Associated problems 134 (33.2) 187 (46.3) 43 (10.6) 40 (9.9) 94 (35.5) 161 (60.8) 10 (3.8) Latest research 210 (52.0) 140 (34.7) 28 (6.9) 26 (6.4) 55 (27.6) 120 (60.3) 24 (12.1) Long term effects of ADHD 129 (31.9) 188 (46.5) 38 (9.4) 49 (12.1) 93 (38.3) 133 (54.7) 17 (7.0) Medications 200 (49.5) 148 (36.6) 23 (5.7) 29 (7.2) 62 (31.7) 112 (57.1) 22 (11.2) Complementary and alternative treatment 197 (48.8) 133 (32.9) 33 (8.2) 36 (8.9) 76 (36.4) 119 (56.9) 14 (6.7) Behavior management and parenting strategies 98 (24.3) 205 (50.7) 45 (11.1) 55 (13.6) 121 (40.4) 147 (49.2) 31 (10.4) Educational interventions 131 (32.4) 187 (46.3) 35 (8.7) 48 (11.9) 88 (35.5) 133 (53.4) 28 (11.2) Data are represented as n (%). ADHD attention deficit hyperactivity disorder

fulltextpubmed· Body· item PMC6394639

(36.4) 119 (56.9) 14 (6.7) Behavior management and parenting strategies 98 (24.3) 205 (50.7) 45 (11.1) 55 (13.6) 121 (40.4) 147 (49.2) 31 (10.4) Educational interventions 131 (32.4) 187 (46.3) 35 (8.7) 48 (11.9) 88 (35.5) 133 (53.4) 28 (11.2) Data are represented as n (%). ADHD attention deficit hyperactivity disorder Information assessment and information quality A vast majority (91.3%, 369/404) said they had assessed the reliability of ADHD-related information retrieved from the internet, but only 29.7% (120/404) always or often assessed it. Almost all of the assessment tools for online health information recommended that the recipients check the authority and currency of information [18–22]. But only 13.6% (55/404) would check who the author was and only 20.8% (84/404) would see how current the information was. Half (49.8%, 201/404) stated they assessed the information quality on how professional the appearance of the website was. More than half of the parents rated the quality of overall information as fair (55.7%, 225/404); 42.3% (171/404) rated it as good; and, 2.0% (8/404) as poor. When rating the quality of information for each topic (Table 3), about half rated each topic as fair. There was a slightly difference between each topic. Quality of information on “symptoms of ADHD” was evaluated best, while that on “latest research about ADHD” worst.

fulltextpubmed· Body· item PMC6394639

1/404) rated it as good; and, 2.0% (8/404) as poor. When rating the quality of information for each topic (Table 3), about half rated each topic as fair. There was a slightly difference between each topic. Quality of information on “symptoms of ADHD” was evaluated best, while that on “latest research about ADHD” worst. Most of the parents (60.9%, 246/404) thought they had, or might have, found wrong or misleading information. About one-third found wrong or misleading information in the topics on ADHD diagnosis (35.0%, 86/246) and ADHD medications (30.1%, 74/246). Using the internet to make decisions related to ADHD About half of parents admitted that the internet helped them to learn about available treatment options. Only about one-third knew the benefits or risks of each treatment option (Table 4). When it came to values clarity, only 30.9% were clear about which benefits mattered most to them. Only 26.7% were clear about which risks mattered most to them. Less than one-fourth felt certain enough to choose.Table 4 The decisional conflicts scale

fulltextpubmed· Body· item PMC6394639

-third knew the benefits or risks of each treatment option (Table 4). When it came to values clarity, only 30.9% were clear about which benefits mattered most to them. Only 26.7% were clear about which risks mattered most to them. Less than one-fourth felt certain enough to choose.Table 4 The decisional conflicts scale Did the use of the internet Yes (0) Unsure (2) No (4) Informed subscale, n (%) Help you know which treatment options are available to you? 193 (47.8) 174 (43.1) 37 (9.2) Help you know the benefits of each treatment option? 134 (33.2) 212 (52.5) 58 (14.4) Help you know the risks and side effects of each treatment option? 128 (31.7) 209 (51.7) 67 (16.6) Values clarity subscale, n (%) Help you be clear about which benefits matter most to you? 125 (30.9) 231 (57.2) 48 (11.9) Help you be clear about which risks and side effects matter most to you? 108 (26.7) 234 (57.9) 62 (15.3) Support subscale, n (%) Help you get enough support from others to make a choice? 97 (24.0) 163 (40.3) 144 (35.6) Help you make a decision without pressure from others? 158 (39.1) 141 (34.9) 105 (26.0) Help you get enough advice to make a choice? 104 (25.7) 181 (44.8) 119 (29.5) Uncertainty subscale, n (%) Help you be clear about the best choice for you? 121 (30.0) 212 (52.5) 71 (17.6) Help you feel sure about what to choose? 92 (22.8) 233 (57.7) 79 (19.6)

fulltextpubmed· Body· item PMC6394639

ithout pressure from others? 158 (39.1) 141 (34.9) 105 (26.0) Help you get enough advice to make a choice? 104 (25.7) 181 (44.8) 119 (29.5) Uncertainty subscale, n (%) Help you be clear about the best choice for you? 121 (30.0) 212 (52.5) 71 (17.6) Help you feel sure about what to choose? 92 (22.8) 233 (57.7) 79 (19.6) The mean total score were as high as 44.2 ± 23.0, and 67.3% (272/404) of those parents with highly conflicted decision-making (> 37.5). The mean score of informed subscale was 37.9 ± 27.6. The values clarity subscale was 42.4 ± 28.3. The support subscale score was 50.4 ± 29.6. The uncertainty subscale was 46.1 ± 30.7. The scores of the other three subscale had correlations with score of uncertainty subscale, from high correlation to low were supported in subscale (rs = 0.579, P = 0.000), values clarify subscale (rs = 0.435, P = 0.000), and informed subscale (rs = 0.386, P = 0.000). There was a medium correlation between the score of informed subscale and score of values clarity subscale(rs = 0.542, P = 0.000).

fulltextpubmed· Body· item PMC6394639

The mean total score were as high as 44.2 ± 23.0, and 67.3% (272/404) of those parents with highly conflicted decision-making (> 37.5). The mean score of informed subscale was 37.9 ± 27.6. The values clarity subscale was 42.4 ± 28.3. The support subscale score was 50.4 ± 29.6. The uncertainty subscale was 46.1 ± 30.7. The scores of the other three subscale had correlations with score of uncertainty subscale, from high correlation to low were supported in subscale (rs = 0.579, P = 0.000), values clarify subscale (rs = 0.435, P = 0.000), and informed subscale (rs = 0.386, P = 0.000). There was a medium correlation between the score of informed subscale and score of values clarity subscale(rs = 0.542, P = 0.000). Factors associating with decision conflicts Univariate analyses showed that skill and experience with using of internet and the motives for seeking health information associated with more conflicted decision-making (Table 5). The higher the parents rated their internet skills, the more often they searched ADHD-related information. The more often parents assessed the reliability of information the higher they rated the quality of information. The more often parents could locate needed information the easier they thought it was to find what they were looking for and the less conflict they had in reaching decisions. All of the drives for seeking health information online could influence decision conflicts. Parents who had knowledge drive or social drive had lower decision conflicts; however, parents who had uncertainty drive had higher decision conflicts. For demographics factors, only education level was involved in decision conflicts. Parents who had a higher education level had lower decision conflicts. Multiple regression analysis showed that experience with using of internet had correlation with total score of DCS. The more often parents assessed the reliability of information, the better parents rated the quality of information; the more often parents could locate needed information, the lower score they had. Motives for seeking health information were linked to scores of informed subscale and support subscale. Parents with the knowledge drive thought they were better informed than parents without knowledge drive. Parents without uncertainty driver thought they were better supported for decision-making than those with uncertainty drive (Supplementary Table 1).Table 5 Bivariate analysis of influence of parents’ demographics, child’s ADHD status and motives and experiences of internet using on parents’ decisional conflicts scores

fulltextpubmed· Body· item PMC6394639

Parents without uncertainty driver thought they were better supported for decision-making than those with uncertainty drive (Supplementary Table 1).Table 5 Bivariate analysis of influence of parents’ demographics, child’s ADHD status and motives and experiences of internet using on parents’ decisional conflicts scores Variables Bivariate analysis Informed subscale score Values clarity subscale score Support subscale score Uncertainty subscale score Total DCS score Demographics Parents’ gendera t = 2.15 t = 0.93 t = 0.41 t = 1.93 t = 1.20 P = 0.032 P = 0.353 P = 0.683 P = 0.054 P = 0.234 Parents’ ageb rs = − 0.04 rs = − 0.01 rs = 0.03 rs = − 0.01 rs = − 0.02 P = 0.383 P = 0.818 P = 0.548 P = 0.875 P = 0.675 Education levelb rs = − 0.10 r s = − 0.12 rs = − 0.07 rs = − 0.04 r s = − 0.11 P = 0.053 P = 0.014 P = 0.158 P = 0.477 P = 0.034 Employment statusc F = 1.42 F = 1.21 F = 1.28 F = 0.54 F = 0.92 P = 0.225 P = 0.304 P = 0.278 P = 0.704 P = 0.453 Marriage statusc F = 1.71 F = 0.43 F = 1.69 F = 2.21 F = 2.02 P = 0.147 P = 0.788 P = 0.152 P = 0.068 P = 0.090 Child’s ADHD status ADHD diagnosisa t = 2.15 t = 1.59 t = 1.71 t = 1.54 t = 2.36 P = 0.013 P = 0.113 P = 0.089 P = 0.124 P = 0.019 Medication takinga t = 1.86 t = 1.66 t = − 0.33 t = 0.42 t = 1.06 P = 0.063 P = 0.096 P = 0.745 P = 0.677 P = 0.288 Using complementary and alternative medicinea t = 2.50 t = 1.66 t = 1.31 t = 0.49 t = 1.95 P = 0.013 P = 0.099 P = 0.190 P = 0.624 P = 0.052 Skill and experience with using the internet Internet skillb rs = 0.10 rs = 0.14 rs = 0.12 rs = 0.14 rs = 0.14 P = 0.039 P = 0.006 P = 0.017 P = 0.004 P = 0.004

fulltextpubmed· Body· item PMC6394639

Medication takinga t = 1.86 t = 1.66 t = − 0.33 t = 0.42 t = 1.06 P = 0.063 P = 0.096 P = 0.745 P = 0.677 P = 0.288 Using complementary and alternative medicinea t = 2.50 t = 1.66 t = 1.31 t = 0.49 t = 1.95 P = 0.013 P = 0.099 P = 0.190 P = 0.624 P = 0.052 Skill and experience with using the internet Internet skillb rs = 0.10 rs = 0.14 rs = 0.12 rs = 0.14 rs = 0.14 P = 0.039 P = 0.006 P = 0.017 P = 0.004 P = 0.004 Get information from professionalsa t = 1.08 t = 1.07 t = 1.16 t = 0.55 t = 1.25 P = 0.281 P = 0.284 P = 0.245 P = 0.585 P = 0.212 Get information from booksa t = 1.08 t = 2.23 t = − 0.28 t = − 0.78 t = 0.62 P = 0.283 P = 0.027 P = 0.780 P = 0.438 P = 0.538 Searching timesb rs = − 0.17 rs = − 0.21 rs = − 0.19 rs = − 0.16 rs = − 0.22 P = 0.001 P = 0.000 P = 0.000 P = 0.001 P = 0.000 Information reliability assessmentb rs = 0.19 rs = 0.20 rs = 0.25 rs = 0.24 rs = 0.30 P = 0.001 P = 0.000 P = 0.000 P = 0.000 P = 0.000 Perceived information qualityb rs = 0.32 rs = 0.18 rs = 0.24 rs = 0.23 rs = 0.31 P = 0.000 P = 0.000 P = 0.000 P = 0.000 P = 0.000 Locate needed informationb rs = 0.25 rs = 0.14 rs = 0.06 rs = 0.11 rs = 0.16 P = 0.000 P = 0.007 P = 0.198 P = 0.022 P = 0.001 Ease of finding informationb rs = 0.06 rs = 0.06 rs = 0.06 rs = 0.14 rs = 0.19 P = 0.246 P = 0.243 P = 0.206 P = 0.004 P = 0.000 Motives for seeking health information Knowledge drivea t = 3.84 t = 3.16 t = 1.48 t = 1.61 t = 3.16 P = 0.000 P = 0.002 P = 0.141 P = 0.108 P = 0.002 Uncertainty drivea t = − 0.98 t = − 0.181 t = − 2.46 t = − 2.30 t = − 1.96 P = 0.328 P = 0.856 P = 0.014 P = 0.022 P = 0.050 Social drivea t = 3.10 t = 3.01 t = 2.28 t = 0.852 t = 2.97 P = 0.002 P = 0.003

fulltextpubmed· Body· item PMC6394639

Motives for seeking health information Knowledge drivea t = 3.84 t = 3.16 t = 1.48 t = 1.61 t = 3.16 P = 0.000 P = 0.002 P = 0.141 P = 0.108 P = 0.002 Uncertainty drivea t = − 0.98 t = − 0.181 t = − 2.46 t = − 2.30 t = − 1.96 P = 0.328 P = 0.856 P = 0.014 P = 0.022 P = 0.050 Social drivea t = 3.10 t = 3.01 t = 2.28 t = 0.852 t = 2.97 P = 0.002 P = 0.003 P = 0.023 P = 0.395 P = 0.003 Self-actualization drivea t = 0.60 t = 0.156 t = − 1.82 t = − 0.17 t = −0.49 P = 0.547 P = 0.876 P = 0.070 P = 0.865 P = 0.624 Bold values indicate significant difference. ADHD attention deficit hyperactivity disorder, DCS decision conflict scale. aStudent’s t test, bSpearman rank correlation, cMann–Whitney U test Discussion Online surveys are not difficult to conduct, and are a cost-effective way to reach large numbers of respondents. In this study, an online survey is the most convenient way to reach parents who searched for ADHD-related information online for their children. Although, the response rates of online survey usually are low, the findings are still supposed to have validity and some kind of generalizability [23–26]. We reviewed the responses to some questions between the completed and incomplete questionnaires to find concordances and differences. Concordance of responses reflected the generalizability of our findings. Parents of children who had an ADHD assessment, and parents who searched more online were the most likely to complete the survey.

fulltextpubmed· Body· item PMC6394639

responses to some questions between the completed and incomplete questionnaires to find concordances and differences. Concordance of responses reflected the generalizability of our findings. Parents of children who had an ADHD assessment, and parents who searched more online were the most likely to complete the survey. Although there are males using the internet more than females in China (55.9% vs 44.1%) [7], more mothers (70.8%) searched for online ADHD-related information than did fathers. This is consistent with survey results of parents on online health information of childhood diseases in UK [17] or US [27] and a survey conducted by a Chinese ADHD online forum. Mothers were 78.9% (341/432) of users, while only 21.1% (91/432) were fathers [28]. Mothers are the dramatically more likely to search for health information than fathers.

fulltextpubmed· Body· item PMC6394639

y results of parents on online health information of childhood diseases in UK [17] or US [27] and a survey conducted by a Chinese ADHD online forum. Mothers were 78.9% (341/432) of users, while only 21.1% (91/432) were fathers [28]. Mothers are the dramatically more likely to search for health information than fathers. Among parents who suspected their children had ADHD and searched ADHD-related information online, only 30.2% had their child evaluated by professionals for ADHD. This may be partly attributable to the lack of professionals and the many difficulties surrounding clinical visits in China. ADHD treatment guidelines in China recommended medication and psychosocial treatment and warn that alternative treatments have not proved effective in treating ADHD [4]; alternative treatments are prevalent in China. A search in “China national knowledge infrastructure” (http://www.cnki.net), the world’s largest database of research content from China, retrieved 131 original articles on ADHD treatments, published between January 2006 and September 2011. Sixty-two percent (81/131) of them were on alternative treatments, such as biofeedback, herbal regimens, sensory integration therapy and others. Forty-eight percent (64/131) were on medication and only 3.1% (4/131) were on psychosocial treatments such as parenting training and behavior modification. Other than a reluctance for professional psychosocial treatment, parents showed their passion about it. Over three-quarters of parents had searched information on behavior management and parenting strategies online and nearly 70% indicated that they had used parenting strategies, such as realizing the child has unique differences and may need to be parented in a different way than usual, recognized the potential for physical and/or psychological harm to the child because of being with family members who lack understanding about ADHD, and limiting the child’s association with them; or working closely with schools.

fulltextpubmed· Body· item PMC6394639

he child has unique differences and may need to be parented in a different way than usual, recognized the potential for physical and/or psychological harm to the child because of being with family members who lack understanding about ADHD, and limiting the child’s association with them; or working closely with schools. Parents who searched ADHD-related information online did not usually retrieve information from other sources. More than half did not obtain information from professionals or books, the two additional sources they thought were useful. Although they believe in information supplied by professionals, less than one-third obtained ADHD related information from professionals. Seeing the huge amount of information disseminated on the internet, many people needed their physician to manage the information and help them reach a decision [29]. However, the majority of parents in our survey did search for information in isolation without referring to a professional. In China, most teachers lack adequate knowledge of ADHD, and they were more likely to view ADHD as either parental failure in discipline or parenting or the child’s effort than did American teachers [30], which may be why parents, in this survey, did not rate teachers as a helpful source of ADHD information.

fulltextpubmed· Body· item PMC6394639

fessional. In China, most teachers lack adequate knowledge of ADHD, and they were more likely to view ADHD as either parental failure in discipline or parenting or the child’s effort than did American teachers [30], which may be why parents, in this survey, did not rate teachers as a helpful source of ADHD information. To gain insight into people’s motives for seeking health information on the internet, Boot and Meijman systematically reviewed literature from the fields of psychology, mass communication, library and information science, and medical science, and identified five drives. They are the drive: regarding retrieving knowledge; tempering uncertainty; obtaining social contact or support; for self-actualization; and, entertainment [8]. Our survey investigated the first four drives and found that 98.5% of respondents had two or more drives. This finding confirmed our hypothesis that these drives are “interconnected and may also be present simultaneously”. The most common drive was “self-actualization”; people search for health information to obtain the best possible health status, or in our case “to take better care for their children”. Uncertainty and fear are important factors in health communication. An important part of a general practitioner’s role is to reassure anxious patients. Now, the internet had become a significant source in addition to practitioners for parents to search for health information and to reduce uncertainty and anxiety about their child’s condition. In our survey, 80.2% of parents had indicated uncertainty.

fulltextpubmed· Body· item PMC6394639

rt of a general practitioner’s role is to reassure anxious patients. Now, the internet had become a significant source in addition to practitioners for parents to search for health information and to reduce uncertainty and anxiety about their child’s condition. In our survey, 80.2% of parents had indicated uncertainty. The internet offers many opportunities, to exchange knowledge and obtain social support [31]. The internet can offer an opportunity for parents to connect with one another in common circumstances. This is not less easy outside the virtual world, because parental circumstances are not common or visible in their own communities. Nearly half of the parents surveyed wanted “to talk to other parents of children with ADHD and hear about their experience” online, but only one-quarter indicated that getting “support from or chat with others online” was an advantage of the internet. Lack of qualified online ADHD forums in China might contribute to this. It is difficult for Chinese parents to find alliances online. Our findings suggest that convenience is a key factor driving internet use. The internet is an effective information-seeking tool. When concerns arise, a quick search will often yield plenty of information sources without the hassle of arranging a clinic visit or buying a book on the topic. The anonymity of the internet did not appeal to a majority of parents in our survey, which may be that ADHD children are thought to be naughty but smart in China, and most people are not embarrassed to have an ADHD child [30].

fulltextpubmed· Body· item PMC6394639

rmation sources without the hassle of arranging a clinic visit or buying a book on the topic. The anonymity of the internet did not appeal to a majority of parents in our survey, which may be that ADHD children are thought to be naughty but smart in China, and most people are not embarrassed to have an ADHD child [30]. As parents share the decision-making process with physicians regarding the medical care their children receive, their knowledge and opinions on ADHD play a significant roles. There is an increasing need for parents of ADHD children to receive high-quality information upon which to base their decisions. Ninety-eight percent (98%) of the parents surveyed believed that the information they found was good or fair. However, this confidence may be misplaced. When assessing the quality of online ADHD-related information appearing on Chinese websites, using standard texts such as “Guidelines for the Diagnosis and Management of Attention-Deficit/Hyperactivity Disorder in Children” [4], 56% of the websites were rated as poor [32]. How did parents decide whether to trust the information they found online? Our survey indicated that they are likely to adopt different trust criteria from experts, and are more readily influenced by the appeal of the web design rather than the authority and currency of the website. Although most parents rated their internet skills as “intermediate” or “expert”, many did not have appropriate knowledge to assess the reliability of the information they retrieved from the internet. The World Wide Web is uncontrolled and unmonitored publishing. Website consumers rely more on esthetics than content. Malicious sites with “official looking” pages will mislead consumers into believing they are authoritative. Physicians are increasingly faced with the task of helping parents sift through the diverse range and quality of online health information. Their task is made more difficult when online health information appears to “scientifically valid” but is in fact not evidence-based, makes erroneous references to scientific evidence, or is laden with emotional testimonials. So parent must be made aware of potential complications-dangers from the use of web-based medical sources. Governmental websites (ending in.nhs.uk or.gov.uk) give factually correct advice and should be promoted as the first port of call for parents. The information provided by educational institution websites can be also reliable.

fulltextpubmed· Body· item PMC6394639

st be made aware of potential complications-dangers from the use of web-based medical sources. Governmental websites (ending in.nhs.uk or.gov.uk) give factually correct advice and should be promoted as the first port of call for parents. The information provided by educational institution websites can be also reliable. Parents play an active role in decision-making in managing ADHD. They decide whether to see a doctor, which treatments are performed, whether to take prescribed medications, whether to return to the clinic or discontinue treatment, and other actions so on. To make effective decisions, parents need relevant information and clarity about their values [12]. As they get information on available treatment options, and the benefits and risks of each treatment option, and clarify which benefits and risks matter most to them, they are more able to state clearly what they believe is their best choice. The majority of those polled using the internet reported that the information they found influenced the health decisions they made [9–11], 77.7% of the parents in our survey still had significant difficulties during decision-making. Parents who searched more, assessed reliability of information more, and rated information according to its quality better, may have a lower decision conflict.

fulltextpubmed· Body· item PMC6394639

ation they found influenced the health decisions they made [9–11], 77.7% of the parents in our survey still had significant difficulties during decision-making. Parents who searched more, assessed reliability of information more, and rated information according to its quality better, may have a lower decision conflict. Further research is required to more clearly delineate how misconceptions and inaccurate knowledge surrounding ADHD interventions affect utilization and outcomes. Simultaneously, patient training on how to utilize the network and how to identify the reliability of network information is needed. Directing patients to an approved website should improve their education and experience. In China, high-quality websites are not good enough, and more work is needed. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary material 1 (DOCX 19 kb) Author contributions XHY conceived and coordinated the study, designed, performed and analyzed the experiments, and wrote the paper. LZ and JH carried out the data collection, data analysis, and revised the paper. All authors reviewed the results and approved the final version of the manuscript. Funding No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article. Ethical approval This study was approved by the Institutional Review Board of Xiangya Hospital, Central South University. Conflict of interest The authors declare that there is no conflict of interests.

fulltextpubmed· Body· item PMC6394648

Introduction Crohn’s disease (CD) is a chronic relapsing inflammatory condition of the gastrointestinal tract. Causes of CD still remain unclear, but it is thought to result from an interaction of individuals’ genetics factors, epigenetic factors, microbial exposure, immune response and environment factors [1–4]. Approximately, 25% of patients are diagnosed with CD before the age of 18 years [5], and the incidence of pediatric CD is increasing in both developed and developing nations [6, 7]. The goals of treatment in pediatric CD are to induce and maintain remission, relieve symptoms and optimize growth, while minimizing side effects [8]. After an accidental discovery in the 1970s that exclusive enteral nutrition (EEN) could induce remission of CD, EEN has provided an innovative way to induce remission and optimize nutrition following diagnosis [9]. In 2014, the European Society of Pediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN) and the European Crohn’s and Colitis Organization (ECCO) issued revised consensus guidelines, recommending that EEN be considered as the first-line induction therapy for children with CD [10]. For induction of remission, patients were treated with EEN via the oral route or nasogastric tube feeding for approximately 6–8 weeks. Additionally, only chewing gum and water were allowed [11–13]. The dietary sources of protein included elemental, semi-elemental and polymeric diets, but various levels of proteins or lipids seem to not have much impact on efficacy [14–16].

fulltextpubmed· Body· item PMC6394648

EEN via the oral route or nasogastric tube feeding for approximately 6–8 weeks. Additionally, only chewing gum and water were allowed [11–13]. The dietary sources of protein included elemental, semi-elemental and polymeric diets, but various levels of proteins or lipids seem to not have much impact on efficacy [14–16]. Corticosteroids have been considered a major therapeutic option to induce remission in patients with active CD, achieving a clinical remission in 60–91% of treated patients [1]. However, side effects of corticosteroids, such as Cushing appearance, bone demineralization and severe growth retardation, can be harmful to children’s natural physical development [17]. In addition, evidence-based medicine supports that EEN therapy has fewer adverse events and lower side effect rates than corticosteroids [18]. EEN therapy was also suggested to be more effective in children than adults [19].

fulltextpubmed· Body· item PMC6394648

and severe growth retardation, can be harmful to children’s natural physical development [17]. In addition, evidence-based medicine supports that EEN therapy has fewer adverse events and lower side effect rates than corticosteroids [18]. EEN therapy was also suggested to be more effective in children than adults [19]. Two meta-analyses [18, 20] concluded that EEN, as a primary therapeutic approach for CD, showed no significant difference from corticosteroids in inducing clinical remission. In contrast, two other meta-analyses [21, 22] concluded that patients’ remission rates with corticosteroids were statistically superior to that with EEN. Although many studies have compared short-term remission rates between patients treated with corticosteroids and EEN, few studies have focused on the relapse rate in long-term follow-up, especially in children. Endoscopic sustained mucosal healing in Crohn’s disease was reported to be associated with longer remission time, less inflammatory activity and decreased hospitalization rates [23, 24]; corticosteroids were thought to be associated with poor mucosal healing [25], while EEN was effective in inducing mucosal remission [26]. Few meta-analyses have been performed comparing the differences in efficacy of these two therapies on mucosal healing, and we still do not know whether EEN or corticosteroids will prolong the time that pediatric patients with CD remain in remission.

fulltextpubmed· Body· item PMC6394648

ling [25], while EEN was effective in inducing mucosal remission [26]. Few meta-analyses have been performed comparing the differences in efficacy of these two therapies on mucosal healing, and we still do not know whether EEN or corticosteroids will prolong the time that pediatric patients with CD remain in remission. EEN versus placebo-controlled experiments cannot be carried out in pediatric patients with CD because of difficulty in passing ethical review, and any “placebo” which was nutritionally complete to sustain nutrition during treatment would be regarded as EEN. As a result, most studies have chosen corticosteroid therapy as the control group. In this meta-analysis, we compared the remission rates between two therapy groups at 8 weeks and relapse rates at 1 year. We also included more high-quality studies and further evaluated the effects of two therapeutic strategies on mucosal healing, nutritional status and growth patterns.

fulltextpubmed· Body· item PMC6394648

d therapy as the control group. In this meta-analysis, we compared the remission rates between two therapy groups at 8 weeks and relapse rates at 1 year. We also included more high-quality studies and further evaluated the effects of two therapeutic strategies on mucosal healing, nutritional status and growth patterns. Methods Data sources and search strategy We conducted literature retrieval on PubMed, EMBASE and MEDLINE, Web of Science from January 1990 to April 2017. The search terms “diet therapy” and “exclusive enteral nutrition” were combined using “OR”, the search terms “inflammatory bowel diseases” and “Crohn’s disease” were combined using “OR”, and the search terms “pediatric” and “child” were combined using “OR”. These three groups were then combined using “AND”. For example, searching in PubMed: ((((pediatric[MeSH]) OR child[MeSH])) AND ((exclusive enteral nutrition[MeSH]) OR diet therapy[MeSH])) AND ((Crohn disease[MeSH]) OR inflammatory bowel diseases[MeSH]). Filters: publication date from 1990/01/01 to 2017/04/01. Language restrictions were not imposed. We also searched the literature in Wanfang data, VIP and China National Knowledge Internet with Chinese words for the same keywords and the same time span.

fulltextpubmed· Body· item PMC6394648

) AND ((Crohn disease[MeSH]) OR inflammatory bowel diseases[MeSH]). Filters: publication date from 1990/01/01 to 2017/04/01. Language restrictions were not imposed. We also searched the literature in Wanfang data, VIP and China National Knowledge Internet with Chinese words for the same keywords and the same time span. Selection criteria Two investigators (YY and CK) independently screened the titles, abstracts and full texts using the search strategy mentioned above. We included studies that: (1) were RCTs or observational; (2) enrolled pediatric patients (under the age of 18 years) with CD; and (3) compared systemic corticosteroid drugs (prednisone, prednisolone) with EEN (polymeric formula, semi-elemental formula or elemental formula). Patients in the EEN arm were not to receive any other medication, and patients receiving corticosteroids were to be treated only with corticosteroids, or the same treatments were to be taken in both comparator arms in similar ways. Studies were excluded in any case when articles (1) did not give a precise definition of remission, (2) provided insufficient data for the outcomes of interest or (3) did not contain at least one clearly defined corticosteroids comparator arm. If a literature result was reported several times, we included the study that corresponded to the longest duration or had the largest sample size.

fulltextpubmed· Body· item PMC6394648

cise definition of remission, (2) provided insufficient data for the outcomes of interest or (3) did not contain at least one clearly defined corticosteroids comparator arm. If a literature result was reported several times, we included the study that corresponded to the longest duration or had the largest sample size. Outcome measures The primary outcome measures were induced remission rate (percentage of subjects achieving remission after 6–8 weeks of treatment) and relapse rate (percentage of subjects relapsing at 1-year end point of follow-up). The secondary outcomes were collected at baseline and after the induced treatment, e.g., inflammation index including the Pediatric Crohn’s Disease Activity Index (PCDAI) [27], C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR); growth parameters such as weight and length; mucosal healing [endoscopic lesions were assessed according to a validated score standard (Crohn’s Disease Endoscopic Index of Severity, CDEIS) [28] and histological lesions were assessed according to a scoring system previously validated [29]. The data on height for age and body mass index (BMI) were collected both at baseline and at the 1-year end point. Endoscopic mucosal healing or histological mucosal healing was separately defined as a decrease in endoscopic or histological scores by 50% or more when compared with baseline values.

fulltextpubmed· Body· item PMC6394648

iously validated [29]. The data on height for age and body mass index (BMI) were collected both at baseline and at the 1-year end point. Endoscopic mucosal healing or histological mucosal healing was separately defined as a decrease in endoscopic or histological scores by 50% or more when compared with baseline values. Quality assessment We abstracted the following data from each study: first author, year of publication, origin, interventions and control groups (drug and dosage), participants’ characteristics (number of each group, age) and underlying condition. We used the Newcastle–Ottawa scale to assess the quality of observational studies. This assessment had three sections (selection, comparability and exposure, respectively) and altogether eight items. Studies with a score less than 5 in the present study were excluded from the final analysis [30]. We also evaluated the bias in randomized controlled trials using the Jadad scale, which included the evaluation of randomization, blinding of outcome assessment and description of withdrawals and dropouts. Studies with a Jadad score more than 3 were regarded as high quality and would be included in the final analysis [31].

fulltextpubmed· Body· item PMC6394648

lso evaluated the bias in randomized controlled trials using the Jadad scale, which included the evaluation of randomization, blinding of outcome assessment and description of withdrawals and dropouts. Studies with a Jadad score more than 3 were regarded as high quality and would be included in the final analysis [31]. We analyzed the results of the RCTs, prospective cohort studies and retrospective cohort studies separately to determine whether the results from the non-RCTs affected our calculation of obvious heterogeneity or produced a different outcome from the more robust RCTs. Because there was a mild heterogeneous effect across strata when we compared each study type, respectively, with our main result, we concluded that it was appropriate to combine study types as hypothesis generating rather than confirmatory analysis. Statistical analysis All the meta-analyses were conducted using Review Manager 5.3. The odds ratio (OR) [32] with 95% confidence intervals (CI) [33] was applied to analyze dichotomous variables, and mean difference (MD) [34] with a 95% CI was used to analyze continuous ones. If continuous data were presented in mean and standard deviation (SD) [35] of base and final, we would use statistical algorithms to calculate the difference value’s mean and SD.

fulltextpubmed· Body· item PMC6394648

vals (CI) [33] was applied to analyze dichotomous variables, and mean difference (MD) [34] with a 95% CI was used to analyze continuous ones. If continuous data were presented in mean and standard deviation (SD) [35] of base and final, we would use statistical algorithms to calculate the difference value’s mean and SD. The Chi-square test was used to evaluate the heterogeneity with significance set at the P < 0.05 level, and the I2 statistic value was interpreted as three separate levels: 25% (low heterogeneity), 50% (moderate heterogeneity) and 75% (high heterogeneity) [36]. The random-effect model was conducted when the heterogeneity between studies was too high; otherwise, the fixed-effect model was used [37]. Results Literature research and characteristic of studies A total of 1329 publications retrieved from the database were scanned for relevance. After reviewing, we included 69 articles that potentially met inclusion criteria. After these full texts were studied, the bibliographies were checked. Overall, 4 RCTs [38–41] and 14 observational studies [42–55] that reached our inclusion criteria constituted the base of our analysis. Three of the observational studies were abstracts that provided necessary data for inclusion in the meta-analysis (Fig. 1, flow chart). The characteristics of the included studies are shown in Table 1.Fig. 1 Flow diagram of trials for inclusion in the systematic review. n number of records Table 1 Characteristics of included studies

fulltextpubmed· Body· item PMC6394648

Results Literature research and characteristic of studies A total of 1329 publications retrieved from the database were scanned for relevance. After reviewing, we included 69 articles that potentially met inclusion criteria. After these full texts were studied, the bibliographies were checked. Overall, 4 RCTs [38–41] and 14 observational studies [42–55] that reached our inclusion criteria constituted the base of our analysis. Three of the observational studies were abstracts that provided necessary data for inclusion in the meta-analysis (Fig. 1, flow chart). The characteristics of the included studies are shown in Table 1.Fig. 1 Flow diagram of trials for inclusion in the systematic review. n number of records Table 1 Characteristics of included studies References Origin Study groups, dose, number of patients Age at diagnosis (y) Patients Treatment time (wk) Clinical remission Quality score Randomized controlled trail Terrin et al. [38] Italy EEN: extensively hydrolyzed formula 50–60 kcal/kg/d (n = 10). CS: prednisolone 1.6 mg/kg/d and mesalazine (n = 10) 12.4 (7–17) Children with active CD 8 PCDAI < 10 5 Thomas et al. [39] England EEN: elemental formula (n = 12) CS: prednisolone 2 mg/kg/d (maximum 60 mg/d) and sulphasalazine 25 mg/kg/d (n = 12) 12.9 (5.7–17.2) Children with active CD 4 Activity was graded According to the Lloyd–Still activity index 3 Ruuska et al. [40] Finland EEN: whole-protein based on weight (n = 10) CS: prednisolone 1.5 mg/kg/d up to a maximum of 60 mg (n = 9) 8.5–18.6 Children with new onset or relapsing CD 8 PCDAI < 10 3 Borrelli et al. [41] Italy EEN: polymeric formula 120% to 130% of the recommended daily requirement (n = 19) CS: methylprednisolone 1.6 mg/kg/d (up to maximum 60 mg) for 4 wk, then tapered by 5–10 mg/kg, each week over 6 wk (n = 18) 4–17 Diagnosis of CD within 12 wk 10 PCDAI < 10 3 Retrospective analysis of records Canani et al. [42] Italy EEN: polymeric formula (n = 12); semi-elemental diet (n = 13); elemental diet (n = 12). 50–70 kcal/kg CS: methylprednisolone (1–2 mg/kg/d, maximal dose 40 mg/d) for 4 wk with subsequent gradual tapering over at least 4 wk (n = 10) Polymeric: 11.5 (9–17) Semi-elemental: 11.8 (8–15) Elemental: 12.1 (7–16) CS: 12.4 (8–17) Children with newly diagnosed CD 8 PCDAI < 10 8 Papadopoulou et al. [43] Greece EEN: elemental diet. The daily intake of the elemental diet ranged between 60 and 135 mL/kg/d, calculated to provide 140% of the recommended daily allowance of energy (n = 30) CS: prednisolone, 2 mg/kg/d up to a maximal dose of 60 mg/d, the dose was halved every 2–4 wk until a dose of 5–10 mg was achieved (n = 28) EEN: 12.6 ± 3.1 CS: 12 ± 3.1 Children with diagnosed CD 8 Both the absence of clinical symptoms referable to Crohn’s disease (i.e., diarrhea, abdominal pain, fever) and achievement of a disease activity score > 80 8 Lambert et al. [44] Australia EEN: polymeric formula (n = 31).

fulltextpubmed· Body· item PMC6394648

l a dose of 5–10 mg was achieved (n = 28) EEN: 12.6 ± 3.1 CS: 12 ± 3.1 Children with diagnosed CD 8 Both the absence of clinical symptoms referable to Crohn’s disease (i.e., diarrhea, abdominal pain, fever) and achievement of a disease activity score > 80 8 Lambert et al. [44] Australia EEN: polymeric formula (n = 31). After completion of EEN, normal diet was reintroduced gradually and children were encouraged to continue supplementary volumes of enteral formula (500–1000 mL daily) CS: corticosteroids (n = 26). EEN: 9.9 ± 4 CS: 9.97 ± 4.7 Children with newly diagnosed CD 6–8 PCDAI < 15 9 Soo et al. [45] Canada EEN: polymeric formula (n = 33) or semi-elemental formula (n = 3) for 6 wk and then partially over the next 2 wk depending on patient compliance CS: prednisone, 1 mg/kg/d to a maximum dose of 50 mg/d (n = 69) EEN: 12.9 (7.4–16.2) CS: 11.2 (2.4–16.8) Children with newly diagnosed CD 6–8 PCDAI < 10 9 Levine et al. [46] Israel EEN: polymeric formula (n = 43) CS: prednisone, 1–2 mg/kg up to 60 mg equivalent of prednisone (n = 114) EEN: 12.3 ± 3.9 CS: 13.3 ± 3.1 Children with newly diagnosed CD 6–8 PCDAI < 10 8 Wang et al. [47] China EEN: polymer formula, according to the normal age of the required amount of 120–130% (n = 25) CS: oral methylprednisolone at an initial dose of 1.6 mg/kg/d (maximal dose ≤ 60 mg/d). After 4 wk of treatment, the dose was reduced (n = 23) EEN: 9.3 ± 2.6 CS: 10.2 ± 3.1 Children with diagnosed CD 12 CDAI < 150 points or lower than the baseline value of at least 100 points and CRP normal 9 Hojsak et al. [48] Croatia EEN: polymeric formula, taken exclusively for 6–8 wk either through nasogastric tube or orally (n = 57) CS: corticosteroids (n = 17). 13.4 (1–17.9) Children with newly diagnosed CD 6–8 PCDAI < 10 8 Grover et al. [49] Australia EEN: polymeric formula, Nutrison (1 kcal/mL, Nutricia, UK, 4 g protein, 3.9 g fat/100 mL) through nasogastric tube (NGT) or resource protein (1.25 kcal/mL, Nestle, 9.4 g protein, 3.5 g fat/100 mL) orally based on children preference and dietetic consultation (n = 43) CS: corticosteroids: 10 mg/d prednisolone (n = 46) EEN: 13 (11.35–14) CS: 11.5 (9.5–13) Children with newly diagnosed CD 6 PCDAI < 10 9 Luo et al. [50] China EEN: polymeric formula, the average caloric intake in EEN group was 117.9 ± 4.2 kcal (n = 10) CS: the average dosage for prednisone was 1.1 ± 0.4 mg/kg (n = 15).

fulltextpubmed· Body· item PMC6394648

CS: corticosteroids: 10 mg/d prednisolone (n = 46) EEN: 13 (11.35–14) CS: 11.5 (9.5–13) Children with newly diagnosed CD 6 PCDAI < 10 9 Luo et al. [50] China EEN: polymeric formula, the average caloric intake in EEN group was 117.9 ± 4.2 kcal (n = 10) CS: the average dosage for prednisone was 1.1 ± 0.4 mg/kg (n = 15). The average dosage for hydrocortisone was 8.7 ± 2.3 mg/kg (n = 3) EEN: 11.1 (5–15) CS: 11.6 (1–16) Children with active CD (PCDAI > 10) 8 PCDAI < 10 8 Hradsky et al. [51] Czech Republic EEN: polymeric formula (n = 29) CS: prednisone 1–2 mg/kg/d (up to 40 mg/d, exceptionally 60 mg/d) approximately 2 mont (n = 36) EEN: 13.91 (12.3–15.02) CS: 14.85 (11.25–15.57) Children with newly diagnosed CD 6–10 NG 7 Goncalves et al. [52] (abstract) Portuguese EEN: polymeric formula for 8 wk (1500–2000 mL/d) (n = 11) CS: the steroid dose was 1 mg/kg/d (n = 19) There was no difference in age Children with newly diagnosed CD 8 NG 7 Gavin et al. [53] (abstract) UK EEN: exclusive enteral nutrition (n = 43) CS: steroids (n = 19) 13 (2–16) Children with newly diagnosed CD NG Clinical remission was determined using a physician global assessment and blood biochemistry 6 Scarpato et al. [54] (abstract) Italy EEN: receiving exclusive enteral nutrition for 8 wk, followed by a gradual introduction of foods during the subsequent 4 wk (n = 33). CS: treated with oral corticosteroids with tapering off by week 11 (n = 11). EEN: 10.4 ± 3.5 CS: 11.7 ± 4.6 Children with newly diagnosed CD 8 NG 7 Prospective analysis of records Kierkus et al. [55] Poland EEN: each infused 1400–2200 mL. This provided approximately 50 kcal/kg/d (n = 20). CS: corticosteroids (n = 24) EEN: 13.4 ± 5.18 CS: 13.8 ± 4.34 Children with moderate to severe CD (PCDAI > 30) 6 PCDAI < 10 9 EEN exclusive enteral nutrition group, CS corticosteroid group, PCDAI Pediatric Crohn’s Disease Activity Index, CD Crohn’s disease, n number, NG not given

fulltextpubmed· Body· item PMC6394648

ed approximately 50 kcal/kg/d (n = 20). CS: corticosteroids (n = 24) EEN: 13.4 ± 5.18 CS: 13.8 ± 4.34 Children with moderate to severe CD (PCDAI > 30) 6 PCDAI < 10 9 EEN exclusive enteral nutrition group, CS corticosteroid group, PCDAI Pediatric Crohn’s Disease Activity Index, CD Crohn’s disease, n number, NG not given Quality assessment The details of quality assessment based on the NOS are shown in Supplementary Table 1. The Newcastle–Ottawa scale revealed that study qualities varied from 7 to 9. The qualities of the included studies were good and fair. The quality of the four RCTs we included showed a moderate level. All articles displayed similar baselines and they were then grouped randomly. Patients included in the RCTs had complete follow-up information. The number of withdrawals and the reasons for withdrawal were described in the articles. However, only one RCT adopted the single-blind method, with three articles for three points and one article for five points.

fulltextpubmed· Body· item PMC6394648

nes and they were then grouped randomly. Patients included in the RCTs had complete follow-up information. The number of withdrawals and the reasons for withdrawal were described in the articles. However, only one RCT adopted the single-blind method, with three articles for three points and one article for five points. Effects of interventions Induced remission rate of exclusive enteral nutrition vs. corticosteroids Three RCTs [38, 40, 41] and ten observational studies [42, 43, 46–48, 50, 52–55] provided data on the induced remission rate after 6–8 weeks of treatment. Soo et al. [45] calculated the remission rate after 3 months treatment, so data from their paper were excluded. Overall, we analyzed 13 papers including 349 pediatric patients treated with exclusive elemental diet and 311 pediatric patients treated with corticosteroids. The heterogeneity test showed I2 = 5%, suggesting that there was a mild heterogeneity between the studies, so we performed the fixed-effect model in our study. We pooled all the results of these trials and found no evidence for a significant difference in the percentage of children achieving remission between those treated with EEN and those with corticosteroids (OR = 1.35; 95% CI 0.90, 2.10; P = 0.14; Fig. 2). Meta-analysis of only RCTs showed that EEN was more effective than corticosteroids (OR = 2.62; 95% CI 0.86, 7.94; P = 0.09, Supplementary Table 2).Fig. 2 Forest plot for the comparison of induced remission rates between EEN versus corticosteroids for pediatric Crohn’s disease. No significant difference in induced remission rates was found between the EEN and corticosteroid groups (OR = 1.35; 95% CI 0.90, 2.10; P = 0.14). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom

fulltextpubmed· Body· item PMC6394648

emission rates between EEN versus corticosteroids for pediatric Crohn’s disease. No significant difference in induced remission rates was found between the EEN and corticosteroid groups (OR = 1.35; 95% CI 0.90, 2.10; P = 0.14). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom Influence of exclusive enteral nutrition vs. corticosteroids on 1-year relapse rate Patients in five observational studies [42, 45, 48, 49, 52] were induced into remission with EEN or corticosteroids, and all of them used thiopurine and/or mesalamine as maintenance therapy. One study [44] that used maintenance enteral nutrition as maintenance therapy was excluded from the meta-analysis. There was only one RCT article, which was excluded as well. Furthermore, we included and analyzed five retrospective cohort studies (158 cases in the EEN group, 154 cases in the corticosteroids group). The meta-analysis of the five retrospective cohort studies also showed that no significant difference existed in the proportions of 1-year relapse rates between the EEN and corticosteroids groups (OR = 0.57; 95% CI 0.25, 1.29; P = 0.18, Fig. 3).Fig. 3 Forest plot for the comparison of 1-year relapse rates between EEN versus corticosteroids for pediatric Crohn’s disease. No significant difference in 1-year relapse rates was found between the EEN and corticosteroids groups (OR = 0.57; 95% CI 0.25, 1.29; P = 0.18). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom

fulltextpubmed· Body· item PMC6394648

ar relapse rates between EEN versus corticosteroids for pediatric Crohn’s disease. No significant difference in 1-year relapse rates was found between the EEN and corticosteroids groups (OR = 0.57; 95% CI 0.25, 1.29; P = 0.18). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom Mucosal healing In total, 3 of 18 articles [41, 42, 47] provided information on mucosal healing of patients at the end of induction. The method of Canani et al. [42] defining mucosal healing was different from other articles, so data from the research were excluded. Overall, patients who received EEN were more likely to achieve both endoscopic mucosal healing (OR = 5.24, 95% CI 2.06, 13.37; P = 0.0005, Fig. 4) and histological mucosal healing (OR = 4.78, 95% CI 1.89, 12.08; P = 0.0009, Fig. 4) than those who received corticosteroids.Fig. 4 Forest plot for the comparison of mucosal healing between EEN versus corticosteroids for pediatric Crohn’s disease. A significant difference both in endoscopic and histological mucosal healing was found between the EEN and corticosteroid groups (OR = 5.24 0, 95% CI 2.06, 13.37; P = 0.0005 and OR = 4.78 0, 95% CI 1.89, 12.08; P = 0.0009, respectively). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom

fulltextpubmed· Body· item PMC6394648

ant difference both in endoscopic and histological mucosal healing was found between the EEN and corticosteroid groups (OR = 5.24 0, 95% CI 2.06, 13.37; P = 0.0005 and OR = 4.78 0, 95% CI 1.89, 12.08; P = 0.0009, respectively). EEN exclusive enteral nutrition, OR odds ratio, CI confidence interval, df degree of freedom Effects of exclusive enteral nutrition vs. corticosteroids on inflammation The data were abstracted from studies that measured PCDAI, CRP and ESR at baseline and at the end of induction in patients receiving EEN and corticosteroids. Then, we used statistical algorithms to calculate the difference value’s mean and SD. There was a distinct decline of PCDAI in patients who received EEN compared with those who received corticosteroids (MD = − 3.67; 95% CI − 4.91, − 2.43; P < 0.0001, Fig. 5). However, we found no significant difference in terms of CRP and ESR between patients who received corticosteroids or EEN (MD = 1.07; 95% CI 0.18, 1.96; P = 0.02, on CRP, and MD = 0.60; 95% CI − 1.82, 3.03; P = 0.63, on ESR, Supplementary Figs. 1–2).Fig. 5 Forest plot for the comparison of PCDAI between EEN versus corticosteroids for pediatric Crohn’s disease. A significant difference in PCDAI was found between the EEN and corticosteroid groups with a standard mean difference of − 3.67 (95% CI − 4.91, − 2.43; P < 0.00001). PCDAI Pediatric Crohn’s Disease Activity Index, EEN exclusive enteral nutrition, CI confidence interval, df degree of freedom

fulltextpubmed· Body· item PMC6394648

r pediatric Crohn’s disease. A significant difference in PCDAI was found between the EEN and corticosteroid groups with a standard mean difference of − 3.67 (95% CI − 4.91, − 2.43; P < 0.00001). PCDAI Pediatric Crohn’s Disease Activity Index, EEN exclusive enteral nutrition, CI confidence interval, df degree of freedom Effects of exclusive enteral nutrition vs. corticosteroids on growth After induced therapy, patients who received EEN seemed to gain more weight than those who received corticosteroids (MD = 1.92; 95% CI = 0.02, 3.83; P = 0.05, Supplementary Fig. 3), but height showed no significant difference (MD = 0.24; 95% CI = − 1.98, 2.45; P = 0.83, Supplementary Fig. 4). We also found no significant difference at the 1-year end point in either height for age (MD = 0.45; 95% CI − 0.11, 1.02; P = 0.11, Supplementary Fig. 5) or BMI (MD = 0.10; 95% CI − 0.34, 0.54; P = 0.66, Supplementary Fig. 6).

fulltextpubmed· Body· item PMC6394648

no significant difference (MD = 0.24; 95% CI = − 1.98, 2.45; P = 0.83, Supplementary Fig. 4). We also found no significant difference at the 1-year end point in either height for age (MD = 0.45; 95% CI − 0.11, 1.02; P = 0.11, Supplementary Fig. 5) or BMI (MD = 0.10; 95% CI − 0.34, 0.54; P = 0.66, Supplementary Fig. 6). Discussion Crohn’s disease is a chronic, progressive disease characterized by repeated relapses after remissions in most cases. The chronic intestinal inflammation that occurs in CD can result in intestinal complications such as strictures, fistulas, and abscesses during the whole period [56, 57]. Medical treatment of CD includes two major parts: induction and maintenance therapy. These phases of treatment involve achieving control of inflammation in a relatively short time and then sustaining that control to prevent patients from relapse. A number of investigators provided much evidence to illustrate the mechanism behind EEN. The primary components underlying the actions of EEN were as follows: inhibiting the expression of inflammatory factors, such as tumor necrosis factor-α, interleukin (IL)-6 and IL-1β [58–60], increasing the release of vascular endothelial growth factor and transforming growth factor-β (TGF-β) to improve intestinal endometrial repairment [61, 62], providing essential amino acids which can promote intestinal mucosal barrier formation [63, 64] and activating mucosal immunity, resulting in the maintenance of intestinal homeostasis [65].

fulltextpubmed· Body· item PMC6394648

vascular endothelial growth factor and transforming growth factor-β (TGF-β) to improve intestinal endometrial repairment [61, 62], providing essential amino acids which can promote intestinal mucosal barrier formation [63, 64] and activating mucosal immunity, resulting in the maintenance of intestinal homeostasis [65]. Treatments for induced remission in CD patients include corticosteroids, EEN and biologic agents. Recently, people in many countries, such as the Japanese, Europeans, British, and North Americans, have highlighted the remission induction efficacy of EEN on pediatric CD [66–69]. There were two meta-analyses [15, 16] hinting that CS was superior to EEN in achieving control of inflammation in acute CD. These two meta-analyses were published in 1995 and 1996, and the retrieval times were between the 1980s and 1990s. The studies included in those two meta-analyses usually used EEN as remission induction therapy for fewer than 4 weeks, whereas the induction time of the studies we included mostly lasted for 6–8 weeks, with only one study lasting 4 weeks. In addition, those two meta-analyses included patients of all ages, and our meta-analyses focused on pediatric trials. Two other pediatric meta-analyses [17, 18] also determined that EEN and corticosteroids were equally effective, similar to our study’s conclusions, suggesting that the benefits of EEN may differ between children and adults.

fulltextpubmed· Body· item PMC6394648

meta-analyses included patients of all ages, and our meta-analyses focused on pediatric trials. Two other pediatric meta-analyses [17, 18] also determined that EEN and corticosteroids were equally effective, similar to our study’s conclusions, suggesting that the benefits of EEN may differ between children and adults. No significant difference was found in 1-year relapse rates between EEN and corticosteroids. In our subgroup meta-analysis of the three articles [15–17], choosing thiopurine as single maintenance therapy had a similar result (EEN vs. CS: OR = 0.93, 95% CI 0.36, 2.43; P = 0.13). The use of thiopurine or mesalamine will impact the results, but it is also unethical to observe relapse rates without any maintenance therapy in child patients.

fulltextpubmed· Body· item PMC6394648

is of the three articles [15–17], choosing thiopurine as single maintenance therapy had a similar result (EEN vs. CS: OR = 0.93, 95% CI 0.36, 2.43; P = 0.13). The use of thiopurine or mesalamine will impact the results, but it is also unethical to observe relapse rates without any maintenance therapy in child patients. Recently, many researchers have regarded mucosal healing as a promising therapeutic target, and mucosal healing may substantially modify the course of CD. Mucosal remission was reported to be possibly associated with a sustained remission rate [26, 70]. Treatment with steroids was thought to have no positive impacts on mucosal healing [71]. In contrast, some studies reported approximately 19–75% of children treated with EEN achieved mucosal healing, but these results were unreliable since the definition of mucosal healing among the different studies varied [13, 72–74]. In our meta-analyses, there were two articles that used the CDEIS index to evaluate endoscopic mucosal healing, and the EEN group showed better outcomes than the CS group. A similar outcome was found for histological mucosal healing. A prospective longitudinal cohort study revealed that only complete mucosal healing (SES-CD = 0) post-EEN induction correlated with a lower sustained remission rate, and the sustained remission rate of near-complete mucosal healing patients (SES 1–3) was similar to that of patients with more active endoscopic disease [70]. Therefore, there is an urgent need to enlarge sample sizes, achieve cooperation between multiple centers and adopt uniform criteria to prospectively validate whether EEN is more effective in mucosal healing than CS and whether mucosal healing induced by EEN is conducive to sustained remission.

fulltextpubmed· Body· item PMC6394648

endoscopic disease [70]. Therefore, there is an urgent need to enlarge sample sizes, achieve cooperation between multiple centers and adopt uniform criteria to prospectively validate whether EEN is more effective in mucosal healing than CS and whether mucosal healing induced by EEN is conducive to sustained remission. We also found that, after achieving induced remission, patients who received EEN treatment seemed to gain more weight than those who received corticosteroids. This result might be associated with nutritional support from EEN. In addition, we found that inflammation markers, such as CRP and ESR, showed no significant difference. However, patients who received EEN were 3.7 times more likely to have a decline of PCDAI score than those who received corticosteroids. The PCDAI is an index of severity of pediatric CD including physical examination, growth parameters and commonly performed laboratory tests [27]. The weight gain in the EEN group may be one factor contributing to PCDAI score decline. Despite the well-described adverse effects that corticosteroids can have on development, growth, and pubertal maturation, particularly if there has been a clinical course of frequent relapses resulting in inadequate nutrition and associated with repeated courses of steroid treatment [75], using corticosteroids as inducing treatment shows similar effects with EEN on the change of height for age and BMI at 1 year. This result may suggest that applying corticosteroids as short-term induction therapy does not have such an adverse impact on long-term growth and development in pediatric patients as expected. However, other growth and development indicators, such as bone age, bone density and gonad development, need to be further evaluated. Most importantly, doctors must still be very prudent in choosing appropriate and effective inducing therapy for CD pediatric patients to reduce repeated and long-term use of corticosteroids.

fulltextpubmed· Body· item PMC6394648

ver, other growth and development indicators, such as bone age, bone density and gonad development, need to be further evaluated. Most importantly, doctors must still be very prudent in choosing appropriate and effective inducing therapy for CD pediatric patients to reduce repeated and long-term use of corticosteroids. Our meta-analysis has several limitations. The observational studies were not designed randomly, and the influence of subjectivity among doctors or parents on the experimental results could not be ruled out; RCT experiments with multicenter, large-scale, strict double-blind and randomly allocated trials should be conducted in the future. In conclusion, our study suggests the induction remission rate of EEN is similar to that of corticosteroids and that EEN and corticosteroid therapy had no significantly different effects on 1-year relapse rate. However, EEN is superior to corticosteroids in terms of positive effects on short-term mucosal healing and reduction of PCDAI. For these reasons, we recommend EEN as an effective and viable first-line treatment for induction of CD remission. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary material 1 (TIFF 110 kb) Supplementary material 2 (TIFF 102 kb) Supplementary material 3 (TIFF 84 kb) Supplementary material 4 (TIFF 86 kb) Supplementary material 5 (TIFF 96 kb) Supplementary material 6 (TIFF 83 kb) Supplementary material 7 (DOCX 24 kb)

fulltextpubmed· Body· item PMC6394648

Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary material 1 (TIFF 110 kb) Supplementary material 2 (TIFF 102 kb) Supplementary material 3 (TIFF 84 kb) Supplementary material 4 (TIFF 86 kb) Supplementary material 5 (TIFF 96 kb) Supplementary material 6 (TIFF 83 kb) Supplementary material 7 (DOCX 24 kb) Author contributions YY conceptualized and designed the study, designed the data collection instruments, collected data, carried out the initial analyses, drafted the initial manuscript, and reviewed and revised the manuscript. KCC designed the data collection instruments, collected data, carried out the initial analyses, and reviewed and revised the manuscript. JC conceptualized and designed the study, coordinated and supervised data collection, and critically reviewed the manuscript for important intellectual content. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work. Funding No external funding for this manuscript. Ethical approval None. Conflict of interest No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6597592

Introduction Recurrent respiratory tract infection (RRTI) is one of the most common reasons for the pediatric visits and hospitalization. According to an epidemiological survey, the incidence rate of RRTI is about 20% in China, with an increasing tendency [1]. As previously reported, RRTI in children could increase the incidence of chronic respiratory disease in adulthood, and thereby cause permanent lung lesions [2]. Current findings have suggested that the different degrees of immunodeficiency or immature immune function, and specific or non-specific immune dysfunction in children with RRTI were major causes of RRTI [3]. Notably, the application of immunomodulatory agents is expected to improve the long-term prognosis of RRTI children.

fulltextpubmed· Body· item PMC6597592

nt findings have suggested that the different degrees of immunodeficiency or immature immune function, and specific or non-specific immune dysfunction in children with RRTI were major causes of RRTI [3]. Notably, the application of immunomodulatory agents is expected to improve the long-term prognosis of RRTI children. Intestinal flora have a powerful regulatory effect on the human immune system. Human immune system could be regulated directly or indirectly by intestinal bacteria through increasing the number of extra-intestinal T cells, producing short-chain fatty acids, enhancing oral tolerance, or controlling inflammation [4]. Multiple studies have demonstrated that long-term use of probiotics could significantly reduce the risk of respiratory infections, and meanwhile could benefit for the fever, cough and administration duration of antibacterial agents in children [5–9]. Among these probiotics, Lactobacillus or Bifidobacterium is the most commonly used [10]. As known, the clinical effectiveness of various probiotics was different due to their regulatory effects on the human immune function [11]. Bifidobaeterium tetravaccine tablets (Live) is a probiotic preparation containing four kinds of strains (Bifidobacterium infantis, Lactobacillus acidophilus, Enterococcus faecalis and Bacillus cereus). Among them, the first three bacteria are the main intestinal probiotics. Besides, the Bacillus cereus can colonize in the intestine and consume oxygen to create an anaerobic environment for Bifidobacteria, thus promoting the growth and reproduction of anaerobic bacteria such as Bifidobacteria.

fulltextpubmed· Body· item PMC6597592

lis and Bacillus cereus). Among them, the first three bacteria are the main intestinal probiotics. Besides, the Bacillus cereus can colonize in the intestine and consume oxygen to create an anaerobic environment for Bifidobacteria, thus promoting the growth and reproduction of anaerobic bacteria such as Bifidobacteria. Based on the above reported studies, we aimed to investigate the clinical effects of Bifidobaeterium tetravaccine tablets (Live) on RRTI, and expected to provide a highly effective way for the prevention and treatment of RRTI. Methods Ethical statement Ethical approval for the study has been obtained from the Ethics Committee of Rizhao People’s Hospital (code number: rzrmyy2015llpj002). In addition, written informed consent was obtained from parents or legal guardians of all children prior to any study-related procedure in the study.

fulltextpubmed· Body· item PMC6597592

Based on the above reported studies, we aimed to investigate the clinical effects of Bifidobaeterium tetravaccine tablets (Live) on RRTI, and expected to provide a highly effective way for the prevention and treatment of RRTI. Methods Ethical statement Ethical approval for the study has been obtained from the Ethics Committee of Rizhao People’s Hospital (code number: rzrmyy2015llpj002). In addition, written informed consent was obtained from parents or legal guardians of all children prior to any study-related procedure in the study. RRTI patients A total of 120 RRTI children admitted to the People’s Hospital of Rizhao between July 2015 and December 2015 were recruited into this study. Patients were eligible for enrollment in the RRTI group if they were 11 years of age or younger and had a clinical diagnosis of RRTI. The diagnosis of RRTI was performed according to the criteria issued by the Pediatric Society, Chinese Medical Association in 2007 [12]. Additionally, the children with RRTI were eligible for enrollment if they had no history of other diseases and no history of using antibiotics and probiotics. Exclusion criteria were as follows: (1) patients who were diagnosed with RRTI caused by organic or congenital lesions, or primary immunodeficiency; (2) patients with mental illness; (3) during the follow-up, patients who were not received Bifidobaeterium tetravaccine tablets (Live) in accordance with the prescribed method for a period greater than 20% of the follow-up duration or were given other immunosuppressive drugs or withdrew from the study.

fulltextpubmed· Body· item PMC6597592

mmunodeficiency; (2) patients with mental illness; (3) during the follow-up, patients who were not received Bifidobaeterium tetravaccine tablets (Live) in accordance with the prescribed method for a period greater than 20% of the follow-up duration or were given other immunosuppressive drugs or withdrew from the study. All children with RRTI included in this study were equally assigned by a random number table into 4 groups: (1) remission group included 30 children without history of respiratory infection for more than 1 week; (2) Active group included 30 children who had fever, cough, stuffy nose, runny nose and other symptoms of RTI or those who had these symptoms disappear within 3 days; (3) Intervention group included 30 children with RRTI who had fever, cough, stuffy nose, runny nose and other symptoms of respiratory tract infection disappear for more than 4 days. They were given oral Bifidobaeterium tetravaccine tablets (Live) for 2 months after this episode; (4) Control group included 30 children who had fever, cough, stuffy nose, runny nose and other symptoms of respiratory tract infection. They were given conventional symptomatic treatment. Stool specimens in the four groups were collected to analyze the intestinal flora at the corresponding time points. For the active group and the remission group, stool specimens were collected within 1–2 days after enrollment, while for the intervention group and the control group, were collected within 1 week after oral administration of Bifidobaeterium tetravaccine tablets (Live) or conventional symptomatic treatment, respectively.

fulltextpubmed· Body· item PMC6597592

or the active group and the remission group, stool specimens were collected within 1–2 days after enrollment, while for the intervention group and the control group, were collected within 1 week after oral administration of Bifidobaeterium tetravaccine tablets (Live) or conventional symptomatic treatment, respectively. Healthy control Totally 30 children underwent a physical examination in the Department of Children Healthcare, People’s Hospital of Rizhao were enrolled as the healthy control (15 boys and 15 girls). Inclusion criteria were as follows: (1) children younger than 11 years old; (2) healthy subjects with no history of genetic disease, heart, liver, kidney and blood diseases; (3) subjects who had no history of upper RTI, acute and chronic gastrointestinal disease more than 1 week before specimens collection; (4) subjects who had no history of using antibiotics and probiotics, and had normal stool indicators by routine examination. Development of RRTI questionnaire Questionnaires were distributed to the control and intervention groups. The questionnaire was compiled by a trained and full-time doctor (reviewed the patient’s previous medical records and treatment) and the guardians of children. The items mainly included: incidence, etiology, incentives, frequency of hospitalizations, frequency and timing of administration of antibiotics and shortest interval of acute upper RTI, acute bronchitis or pneumonia within 12 months from the time of survey, as well as the presence or absence of underlying diseases, etc.

fulltextpubmed· Body· item PMC6597592

e items mainly included: incidence, etiology, incentives, frequency of hospitalizations, frequency and timing of administration of antibiotics and shortest interval of acute upper RTI, acute bronchitis or pneumonia within 12 months from the time of survey, as well as the presence or absence of underlying diseases, etc. Stool specimens collection Two samples (≈ 3 cm3) were collected into two collection tubes containing colony stabilizer, respectively. The child defecated on an opened aseptic paper-plastic bag (prepared by the People’s Hospital of Rizhao), then an appropriate amount of stool was transferred into the tube using a disposable sterile tongue depressor. Next, the tube was immediately placed in an ice bucket and stored at − 80 °C within 6 hours. Genome DNA extraction and quantitative PCR Genome DNA was extracted from the stool samples using stool DNA rapid extraction Kit (Aidlab Biotechnologies Co., Ltd. Beijing, China) according to the manufacturer’s protocol. Primers were designed according to 16SrRNA sequences of Bifidobacteria, Lactobacillus, Escherichia coli, respectively; and then were verified in BLAST database. The upstream and downstream primer sequences were as follows: Bifidobacteria 5′-CTC CTG GAA ACG GGT GG-3′, 5′-CTC CTG GAA ACG GGT GG-3′ (550 bp); Lactobacillus 5′-CTG ATG TGA AAG CCC TCG-3′, 5′-GAG CCT CAG CGT CAG TTG-3′ (166 bp); Escherichia coli 5′-CTG ATG TGA AAG CCC TCG-3′, 5′-CGG GTA ACG TCA ATG AGC AAA-3′(95 bp). Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

fulltextpubmed· Body· item PMC6597592

Bifidobacteria 5′-CTC CTG GAA ACG GGT GG-3′, 5′-CTC CTG GAA ACG GGT GG-3′ (550 bp); Lactobacillus 5′-CTG ATG TGA AAG CCC TCG-3′, 5′-GAG CCT CAG CGT CAG TTG-3′ (166 bp); Escherichia coli 5′-CTG ATG TGA AAG CCC TCG-3′, 5′-CGG GTA ACG TCA ATG AGC AAA-3′(95 bp). Primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The PCR reaction was amplified using a Stratagene M × 3000P PCR machine (Agilent Technologies, Inc.). The stool DNA samples were subjected to conventional PCR using each of the bacterial primers, and the amplified products were subjected to PAGE electrophoresis, followed by comparing with the standard molecular weight mark to verify them. The fluorescent quantified PCR was performed to obtain the three bacteria number of all the DNA samples. Consequently, the solubility curves of fluorescence quantitative PCR of the three bacteria were developed to verify the PCR amplification products. The standard strains and colonies of the tree bacteria were serially diluted (102–1010 cfu/mL), followed by fluorescence quantitative PCR to detect the sensitivity of the fluorescent quantitative PCR.

fulltextpubmed· Body· item PMC6597592

curves of fluorescence quantitative PCR of the three bacteria were developed to verify the PCR amplification products. The standard strains and colonies of the tree bacteria were serially diluted (102–1010 cfu/mL), followed by fluorescence quantitative PCR to detect the sensitivity of the fluorescent quantitative PCR. Treatment Bifidobaeterium tetravaccine tablets (Live) was administered orally for 2 months. For children < 1 year, 2 tablets were given each time (twice daily), while for those ≥ 1 year, 3 tablets were used each time (twice daily). During follow-up, children with RTI were given conventional treatment, and based on this, anti-infective treatment were rationally selected according to the disease condition and the age of children. Meanwhile, no other immunomodulatory agents and probiotic preparations were allowed during the follow-up. Rational use of antimicrobial methods, such as strict application criteria, reasonable choice of the timing given (antibiotics and Bifidobaeterium tetravaccine tablets (Live) interval of more than 2 hours), and shorten the course of treatment, were given to both of the intervention group and control group. Besides, there was no difference in the choice, time, type and course of antibiotic application between the two groups.

fulltextpubmed· Body· item PMC6597592

given (antibiotics and Bifidobaeterium tetravaccine tablets (Live) interval of more than 2 hours), and shorten the course of treatment, were given to both of the intervention group and control group. Besides, there was no difference in the choice, time, type and course of antibiotic application between the two groups. Clinical evaluation According to the previous report, clinical efficacy was divided into four categories including [2]: (1) Cure: patients did not have recurrence of respiratory tract infection or occasional upper respiratory tract infection that was cured without any treatment within 1 year; (2) Marked effect: within 1 year, patients had < 3 times of episodes of respiratory tract infection, with effectively improved conditions that only required oral drugs; (3) Effectiveness: within 1 year, patients had < 5 times episodes of respiratory tract infection, with alleviated symptoms; (4) Ineffectiveness: within 1 year, the frequency of episodes of respiratory tract infection did not change or were increased.

fulltextpubmed· Body· item PMC6597592

, with effectively improved conditions that only required oral drugs; (3) Effectiveness: within 1 year, patients had < 5 times episodes of respiratory tract infection, with alleviated symptoms; (4) Ineffectiveness: within 1 year, the frequency of episodes of respiratory tract infection did not change or were increased. Statistical analysis Statistical analyses were performed using SPSS19.0 software (IBM, New York, USA). Mean ± standard deviation (SD) was used to represent the continuous variables. Qualitative data were described by number or percentage. Quantitative PCR data were performed using logarithm process (1og copies/g) and were expressed as mean ± SD. For multiple sets of data, one-way analysis of variance was performed, multiple comparisons of strains among different groups were conducted using t test, and percentage data were compared using χ2 test. All statistical tests were two-sided tests, and P < 0.05 was considered statistically significant.

fulltextpubmed· Body· item PMC6597592

sed as mean ± SD. For multiple sets of data, one-way analysis of variance was performed, multiple comparisons of strains among different groups were conducted using t test, and percentage data were compared using χ2 test. All statistical tests were two-sided tests, and P < 0.05 was considered statistically significant. Results Initial patient characteristics The baseline characteristics of patients in the five groups were analyzed. The gender (male/female), age (month), body weight (kg) and body surface area (m2) of children in five groups were, respectively, as follows: 16/14, 43.17 ± 25.51, 15.6 ± 4.8, 0.65 ± 0.05 in the remission group; 17/13, 47.70 ± 29.38, 16.4 ± 5.4, 0.68 ± 0.10 in the active group; 14/16, 46.60 ± 30.20, 16.2 ± 5.5, 0.67 ± 0.05 in the intervention group; 14/16, 44.80 ± 24.09, 16.0 ± 4.5, 0.66 ± 0.28 in the control group; and 15/15, 50.80 ± 27.19, 17.0 ± 4.9, 0.69 ± 0.02 in the healthy group. No significant difference in patients’ characteristics (age, gender, body weight, and body surface area) was found among the five groups (P > 0.05).

fulltextpubmed· Body· item PMC6597592

0.05 in the intervention group; 14/16, 44.80 ± 24.09, 16.0 ± 4.5, 0.66 ± 0.28 in the control group; and 15/15, 50.80 ± 27.19, 17.0 ± 4.9, 0.69 ± 0.02 in the healthy group. No significant difference in patients’ characteristics (age, gender, body weight, and body surface area) was found among the five groups (P > 0.05). Validation, standard curves and solubility curves of PCR products-amplified fragments of Bifidobacteria, Lactobacilli and Escherichia coli PAGE electrophoresis of amplified fragments of Bifidobacteria, Lactobacilli and Escherichia coli revealed that the PCR amplification products consisted of a single band and had a length consistent with the expected length of the DNA fragment; these data confirmed that each primer had a good specificity. Fluorescence quantitative PCR of the serial dilutions of the three bacterial strains still showed characteristic growth curves at 100 cfu/mL, which indicated a good detection sensitivity (Fig. 1). The solubility curves from all three bacteria had a single peak, no nonspecific amplification, primer dimer and other interference phenomena were observed (Fig. 2).Fig. 1 Standard curves of fluorescence quantitative PCR of Bifidobacteria, Lactobacilli and Escherichia coli Fig. 2 Solubility curves of fluorescence quantitative PCR of Bifidobacteria, Lactobacilli and Escherichia coli

fulltextpubmed· Body· item PMC6597592

Validation, standard curves and solubility curves of PCR products-amplified fragments of Bifidobacteria, Lactobacilli and Escherichia coli PAGE electrophoresis of amplified fragments of Bifidobacteria, Lactobacilli and Escherichia coli revealed that the PCR amplification products consisted of a single band and had a length consistent with the expected length of the DNA fragment; these data confirmed that each primer had a good specificity. Fluorescence quantitative PCR of the serial dilutions of the three bacterial strains still showed characteristic growth curves at 100 cfu/mL, which indicated a good detection sensitivity (Fig. 1). The solubility curves from all three bacteria had a single peak, no nonspecific amplification, primer dimer and other interference phenomena were observed (Fig. 2).Fig. 1 Standard curves of fluorescence quantitative PCR of Bifidobacteria, Lactobacilli and Escherichia coli Fig. 2 Solubility curves of fluorescence quantitative PCR of Bifidobacteria, Lactobacilli and Escherichia coli Comparison of fluorescence quantitative PCR results of intestinal flora among different groups As shown in Table 1, the number of intestinal Bifidobacteria and Lactobacilli in the remission group, active group and control group was significantly decreased compared with the healthy group (P < 0.05). In addition, the number of intestinal Bifidobacteria and Lactobacilli in intervention group was significantly higher compared to control group, active group and remission group (P < 0.05), and was slightly higher compared to healthy group (P > 0.05). Meanwhile, the number of intestinal Bifidobacteria and Lactobacilli in the active group was slightly smaller compared to the remission group with statistically insignificant difference (P > 0.05), while the number of Escherichia coli was increased compared to the remission group, intervention group and healthy group (P < 0.05).Table 1 Comparison of fluorescence quantitative PCR results of intestinal flora among different groups (mean ± SD, log copies/g)

fulltextpubmed· Body· item PMC6597592

oup with statistically insignificant difference (P > 0.05), while the number of Escherichia coli was increased compared to the remission group, intervention group and healthy group (P < 0.05).Table 1 Comparison of fluorescence quantitative PCR results of intestinal flora among different groups (mean ± SD, log copies/g) Groups Number of cases Bifidobacteria Lactobacilli Escherichia coli Healthy 30 8.89 ± 0.49 8.52 ± 1.42 7.42 ± 1.11 Remission 30 7.99 ± 1.16* 7.76 ± 0.45* 7.56 ± 1.30 Active 30 7.87 ± 1.39* 7.51 ± 0.55* 8.11 ± 1.24*† Control 30 7.91 ± 1.23* 7.70 ± 0.54* 7.78 ± 1.39 Intervention 30 8.93 ± 1.08†‡§ 8.71 ± 1.06†‡§ 7.44 ± 1.22‡ F value 7.1191 10.9949 1.5841 P value <0.0001 <0.0001 0.1816 Compared with the healthy group *P < 0.05, compared with the remission group †P < 0.05, compared with the active group ‡P < 0.05, compared with the control group §P < 0.05

fulltextpubmed· Body· item PMC6597592

23* 7.70 ± 0.54* 7.78 ± 1.39 Intervention 30 8.93 ± 1.08†‡§ 8.71 ± 1.06†‡§ 7.44 ± 1.22‡ F value 7.1191 10.9949 1.5841 P value <0.0001 <0.0001 0.1816 Compared with the healthy group *P < 0.05, compared with the remission group †P < 0.05, compared with the active group ‡P < 0.05, compared with the control group §P < 0.05 Follow-up results of RRTI control and intervention groups As shown in Table 2, the annual average of acute upper RTIs, acute (branch) bronchitis, pneumonia and the total number of antibiotics use per subject in the intervention group were significantly lower than those in the control group (P < 0.05). Besides, the average use of antibiotics, the duration of cough and the duration of fever per episode of RTI were significantly reduced compared to the control group (P < 0.05). Total of 16 subjects (22 times) in the control group required hospitalization, which was significant higher than that in the intervention group (4 subjects, 5 times) (P < 0.05). The total effectiveness rate of intervention group (n = 27, 90%) was significant higher than that of control group (n = 10, 33.3%).Table 2 Follow-up results of respiratory tract infection in RRTI control and intervention groups

fulltextpubmed· Body· item PMC6597592

was significant higher than that in the intervention group (4 subjects, 5 times) (P < 0.05). The total effectiveness rate of intervention group (n = 27, 90%) was significant higher than that of control group (n = 10, 33.3%).Table 2 Follow-up results of respiratory tract infection in RRTI control and intervention groups Items Control group (n = 30) Intervention group (n = 30) t value P value Average number of acute upper respiratory tract infections (times/y) 4.03 ± 4.95 1.93 ± 2.12 2.1360 0.0185 Average number of acute bronchitis or bronchitis (times/y) 0.83 ± 0.71 0.37 ± 0.75 2.4396 0.0089 Average number of pneumonia (times/y) 1.47 ± 2.12 0.40 ± 1.41 2.3018 0.0125 Average number of use of antibiotics (times/y) 2.17 ± 3.54 0.63 ± 1.47 2.2006 0.0159 Duration of use of antibiotics for each onset (d) 6.12 ± 2.87 4.13 ± 2.54 2.8440 0.0031 Duration of fever for each onset (d) 3.57 ± 1.93 2.03 ± 1.45 3.4942 0.0005 Duration of cough for each onset (d) 6.53 ± 3.39 4.02 ± 1.85 3.5598 0.0004 Adverse reactions There were no cases of adverse events and drug-related adverse reactions during the administration of Bifidobaeterium tetravaccine tablets (Live) and during the follow-up period.

fulltextpubmed· Body· item PMC6597592

Items Control group (n = 30) Intervention group (n = 30) t value P value Average number of acute upper respiratory tract infections (times/y) 4.03 ± 4.95 1.93 ± 2.12 2.1360 0.0185 Average number of acute bronchitis or bronchitis (times/y) 0.83 ± 0.71 0.37 ± 0.75 2.4396 0.0089 Average number of pneumonia (times/y) 1.47 ± 2.12 0.40 ± 1.41 2.3018 0.0125 Average number of use of antibiotics (times/y) 2.17 ± 3.54 0.63 ± 1.47 2.2006 0.0159 Duration of use of antibiotics for each onset (d) 6.12 ± 2.87 4.13 ± 2.54 2.8440 0.0031 Duration of fever for each onset (d) 3.57 ± 1.93 2.03 ± 1.45 3.4942 0.0005 Duration of cough for each onset (d) 6.53 ± 3.39 4.02 ± 1.85 3.5598 0.0004 Adverse reactions There were no cases of adverse events and drug-related adverse reactions during the administration of Bifidobaeterium tetravaccine tablets (Live) and during the follow-up period. Discussion In the present study, we found that RRTI children suffered from intestinal flora imbalance, which was manifested as a significant reduction in the number of Bifidobacteria and Lactobacilli and an increase in the number of Escherichia coli. At the same time, this study revealed that the number of Bifidobacteria and Lactobacilli in active stage of RRTI was lower than that in remission stage, while the number of Escherichia coli was significantly increased. Further, this suggested that the imbalance in intestinal flora is more prominent in the active stage than in the remission stage of RRTI, so we could speculate that the imbalance of intestinal flora is related to the episode of RRTI. After receiving Bifidobaeterium tetravaccine tablets (Live) treatment, the number of Bifidobacteria and Lactobacilli in children with RRTI was restored to the level of healthy controls, and was significantly higher compared to RRTI control group, suggesting that Bifidobaeterium tetravaccine tablets (Live) can effectively increase the number of Bifidobacteria and Lactobacilli in children with RRTI, and thereby to maintain the balance of intestinal micro-ecology.

fulltextpubmed· Body· item PMC6597592

stored to the level of healthy controls, and was significantly higher compared to RRTI control group, suggesting that Bifidobaeterium tetravaccine tablets (Live) can effectively increase the number of Bifidobacteria and Lactobacilli in children with RRTI, and thereby to maintain the balance of intestinal micro-ecology. Probiotics have been shown to have various immunomodulatory effects in the host [13–15]. Existing studies have revealed that early innate immunity of lung tissues against foreign infections is derived from the systemic regulation of intestinal flora via NOD-like receptors (NLRs), while the intestinal probiotics can also regulate IgA production by regulating pulmonary dendritic cells [16]. Intestinal probiotics enhance the host’s resistance to Pneumococcal pneumonia and S. aureus pneumonia [17, 18], as well as promote the antiviral effect in the lungs. Animal experiments have demonstrated that mice lacking probiotics have significant deficiencies in clearance of K. pneumoniae from the lungs [19]. In addition, intestinal probiotics can enhance the body’s antiviral immune response by stimulating inflammasome and inducing innate immune molecules [20], and they are involved in the regulation of pulmonary TH17-mediated antifungal immunity [21].

fulltextpubmed· Body· item PMC6597592

nificant deficiencies in clearance of K. pneumoniae from the lungs [19]. In addition, intestinal probiotics can enhance the body’s antiviral immune response by stimulating inflammasome and inducing innate immune molecules [20], and they are involved in the regulation of pulmonary TH17-mediated antifungal immunity [21]. In this study, the follow-up demonstrated that the frequency of respiratory tract infections, duration of cough, duration of fever, duration and frequency of antibiotics use were significantly decreased in the RRTI intervention group compared with the control group. So far, numerous studies suggested that probiotic consumption can decrease the incidence of respiratory tract infections in children [22–25]. A latest systematic review including 23 RCTs and 6269 cases has shown that the frequency of respiratory tract infections was significantly reduced, the duration of respiratory tract infections was shortened in the probiotic intervention group [11]. So far, few studies have investigated changes of the intestinal flora in RRTI children. Peng et al. [26] have investigated the intestinal flora in 30 children with recurrent pneumonia and have found that the number of Bifidobacteria decreases and the number of Escherichia coli increases in children with recurrent pneumonia compared with healthy children, thus stimulating the imbalance of intestinal flora in children with recurrent pneumonia. In theory, Peng’s data suggested that probiotics should be given to promote intestinal flora balance during pneumonia treatment. Unfortunately, no other relevant studies have been conducted.

fulltextpubmed· Body· item PMC6597592

neumonia compared with healthy children, thus stimulating the imbalance of intestinal flora in children with recurrent pneumonia. In theory, Peng’s data suggested that probiotics should be given to promote intestinal flora balance during pneumonia treatment. Unfortunately, no other relevant studies have been conducted. At present, there have been no reports on serious toxicities and side effects caused by probiotics due to its safety, and meanwhile infection and transmission resistance induced by probiotics have not been reported in China [27]. Similarly, in our study, no obvious adverse reactions were observed in all cases receiving oral Bifidobaeterium tetravaccine tablets (Live). In summary, RRTI remains a major challenge for global public healthy, causing high morbidity and mortality among children [10]. Currently, probiotics have provided a new way for the prevention and treatment of children with RRTI. Nevertheless, since the curative effect of probiotics is limited to the influence of different strains, dose and treatment course, and the same strain may also have different effects on the children of different ages, its actual effectiveness should be verified using multi-center, large-scale and prospective clinical studies. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributors Li KL wrote the first draft of this paper. All authors contributed to the intellectual content and approved the final version. Li ZP is the guarantor.

fulltextpubmed· Body· item PMC6597592

In summary, RRTI remains a major challenge for global public healthy, causing high morbidity and mortality among children [10]. Currently, probiotics have provided a new way for the prevention and treatment of children with RRTI. Nevertheless, since the curative effect of probiotics is limited to the influence of different strains, dose and treatment course, and the same strain may also have different effects on the children of different ages, its actual effectiveness should be verified using multi-center, large-scale and prospective clinical studies. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributors Li KL wrote the first draft of this paper. All authors contributed to the intellectual content and approved the final version. Li ZP is the guarantor. Funding This study was supported by the Qingdao Outstanding Health Professional Development Fund (Qingdao FPCSE 2017-4). Compliance with ethical standards Conflict of interest The author(s) declares that they have no conflict of interest. Ethical approval This study was approved by the Ethics Committee of Rizhao People’s Hospital (code number: rzrmyy2015llpj002).

fulltextpubmed· Body· item PMC6597599

Dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on the X chromosome 1 (DAX1) deficiency is a rare disorder presents X-Linked adrenal hypoplasia congenital, impaired sexual development and infertility. Mutational gene of DAX1 was identified as NROB1 [1] which expresses in adrenal gland and hypothalamic–pituitary–gonad axis, restrains progenitor stem cells from differentiating into steroidogenic cells prematurely. Therefore, DAX1 deficiency usually manifests primary adrenal insufficiency and hypogonadotropic hypogonadism. However, we observed a patient whose testosterone elevated in early infancy. With uneventful pregnancy and birth history, the patient got intractable jaundice. There is a maternal uncle died young suddenly in the family history. Biochemical findings showed persistent hyponatremia (120.9–133 mmol/L), hyperkalemia (6.4–9.1 mmol/L) and hyperbilirubinemia. His blood sugar, 17-hydroxyprogesterone, creatine kinase, very-long-chain fatty acid and gas chromatography mass spectrometry were normal. First hormone analysis showed adrenal insufficiency and elevated testosterone (Table 1). Ultrasound showed adrenal region got hypoechoic nodule that recognized as small adrenal gland. Genetic test found a pathogenic mutation of c.1169-1G>T in NROB1 from his mother.Table 1 Hormones levels and medication dosages

fulltextpubmed· Body· item PMC6597599

normal. First hormone analysis showed adrenal insufficiency and elevated testosterone (Table 1). Ultrasound showed adrenal region got hypoechoic nodule that recognized as small adrenal gland. Genetic test found a pathogenic mutation of c.1169-1G>T in NROB1 from his mother.Table 1 Hormones levels and medication dosages Age Weight (kg) ACTH (pg/mL) Cortisol (nmol/L) Aldosterone (pg/mL) Renin (pg/mL) LH (mIU/mL) FSH (mIU/mL) Testosterone (nmol/L) Androstendione (ng/mL) Hydrocortisone (mg/d) Fludrocortisone Episodes 1 d 3 14 d 2.78 1.24 22 d 172 5.94 243 3.85 3 0.05 mg bid 47 d 11.7 5.72 57 d 119 6.28 68 d 4.6 320.3 179.68 1.32 6.96 5.93 12.5–20 Lower respiratory 77 d 5 3.29 > 1750 38.76 1.69 6.57 5.41 15 infection 3 mon 1613 2.72 8 4.5 mon 3.71 1220 0.98 6 mon 7.7 4.99 576 <0 .09 5 0.05 mg bid 9 mon 34.78 497.6 < 0.09 5 1 y 2 mon 11.2 176.5 627.6 < 0.09 5 0.05 mg bid 1 y 7 mon 764 453 < 0.09 2 y 1 mon 845.8 146.5 < 0.09 3 y 169.7 531.1 < 0.09 3 y 3 mon 20 443.7 159.9 <0 .087 6.25–10 0.05-0.025 mg bid 4 y 127.3 480.2 62.01 88.3 < 0.088 10 0.033 mg bid 4 y 5 mon 23 196.1 1.12 31.29 32.05 < 0.09 12.5 0.033 mg bid 5 y 1 mon 29.2 > 2000 0.71 68.44 120.98 < 0.1 0.9 < 0.087 < 0.3 12.5 0.075 mg qd Reference value: adrenocorticotropic hormone (ACTH): 7.2–63.3 pg/mL, cortisol: 171–536 nmol/L, aldosterone: 40–310 pg/mL, renin: 4–38 pg/mL, luteinizing hormone (LH): 0.2–1.4 mIU/mL, follicle-stimulating hormone (FSH): 0.2–3.8 mIU/mL

fulltextpubmed· Body· item PMC6597599

g bid 5 y 1 mon 29.2 > 2000 0.71 68.44 120.98 < 0.1 0.9 < 0.087 < 0.3 12.5 0.075 mg qd Reference value: adrenocorticotropic hormone (ACTH): 7.2–63.3 pg/mL, cortisol: 171–536 nmol/L, aldosterone: 40–310 pg/mL, renin: 4–38 pg/mL, luteinizing hormone (LH): 0.2–1.4 mIU/mL, follicle-stimulating hormone (FSH): 0.2–3.8 mIU/mL After treatment with hydrocortisone, fludrocortisone and sodium salt replacement, his electrolyte gradually adjusted to normal in a month, and testosterone reduced to normal in 4 months (Table 1). Growth and development were under our observation as well. Delayed bone age and smaller testes were consistent with his disease. Primary adrenal insufficiency combined with high testosterone tends to be diagnosed as congenital adrenal hyperplasia. From this case, we summarize DAX1 deficiency’s differential points as normal 17-hydroxyprogesterone, delayed bone age and confirmation of mutation in NROB1.Adrenal ultrasound also has certain value for distinguishing it from congenital adrenal hyperplasia.

fulltextpubmed· Body· item PMC6597599

terone tends to be diagnosed as congenital adrenal hyperplasia. From this case, we summarize DAX1 deficiency’s differential points as normal 17-hydroxyprogesterone, delayed bone age and confirmation of mutation in NROB1.Adrenal ultrasound also has certain value for distinguishing it from congenital adrenal hyperplasia. Although most patients manifest sexual development failure, many reports broaden its clinical spectrum. Spontaneous or even precocious puberty happen but basically suspend in Tanner stage 2 to 3 [2, 3]. In this case, we observed elevated sexual hormones initially. Minipuberty was found in one case as well caused by a mutation of c.518del23 [4]. Another case was found with elevated testosterone since 9 months old with Trp291Arg in NROB1 [5]. As testicular histological examination has been reported as intact in affected neonate [6], and testosterone can also be stimulated by human chorionic gonadotropin during early time [2], testicular structure and function can be normal but progressively impaired as increasing age. Excluding ectopic secretory tissue, testes can be reasonable origin for testosterone in early life. Overall, although patients with DAX1 deficiency commonly present hypogonadism, individual case may have temporal elevated testosterone which confuses its diagnosis. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

fulltextpubmed· Body· item PMC6597599

Although most patients manifest sexual development failure, many reports broaden its clinical spectrum. Spontaneous or even precocious puberty happen but basically suspend in Tanner stage 2 to 3 [2, 3]. In this case, we observed elevated sexual hormones initially. Minipuberty was found in one case as well caused by a mutation of c.518del23 [4]. Another case was found with elevated testosterone since 9 months old with Trp291Arg in NROB1 [5]. As testicular histological examination has been reported as intact in affected neonate [6], and testosterone can also be stimulated by human chorionic gonadotropin during early time [2], testicular structure and function can be normal but progressively impaired as increasing age. Excluding ectopic secretory tissue, testes can be reasonable origin for testosterone in early life. Overall, although patients with DAX1 deficiency commonly present hypogonadism, individual case may have temporal elevated testosterone which confuses its diagnosis. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions JG: collected and analyzed data, and drafted the manuscript. TL: designed the study, organized the clinical follow-up study and reviewed the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Ethical Committee of Qingdao Women and Children’s Hospital.

fulltextpubmed· Body· item PMC6597599

Author contributions JG: collected and analyzed data, and drafted the manuscript. TL: designed the study, organized the clinical follow-up study and reviewed the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Ethical Committee of Qingdao Women and Children’s Hospital. Conflict of interest No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6785595

Introduction Megalencephalic leukoencephalopathy with subcortical cysts (MLC, OMIM 604004) is an infantile-onset autosomal recessive or dominant neurodegenerative disease characterized by cerebral white matter (WM) edema and cyst formation [1, 2]. The classic phenotype of MLC is macrocephaly within the first year of life, moderate to severe motor development delay, normal or mild mental development delay, motor deterioration with ataxia, seizures, spasticity in subsequent years, and extrapyramidal outcomes [1, 2]. Magnetic resonance imaging (MRI) displays bilateral symmetric diffuse abnormal signals in WM with edema, with or without subcortical cysts in the anterior-temporal and fronto-parietal lobes; the internal capsule, cerebellum, and brainstem are occasionally involved [1, 3]. The lifespan ranges from toddler age to seventies [4–8]. MLC1 (OMIM 605908) was the first gene found to be mutated in MLC in 2001 [9]. Mutations in MLC1 lead to classic MLC, which is diagnosed as MLC1 (OMIM 604004) and account for 75% of patients with MLC. The clinical and genetic characteristics and natural history of MLC1 have been completely studied [10–15]. The second gene GLIALCAM was found mutated in 2011 [4]. The phenotype associated with GLIALCAM is named as MLC2. MLC2 can be further divided into two types: MLC2A with autosomal recessive and MLC2B with autosomal dominant inheritance, and MLC2 patients accounted for a total of 20% of MLC patients. MLC2A and MLC2B present with different clinical symptoms and prognosis [4]. So far, only 89 patients with MLC and GLIALCAM mutations have been reported in five papers [4, 8, 11, 12, 16]. The brain tissues of patients with MLC are rare for MLC1 mutations and unobtainable for GLIALCAM mutations. Therefore, MLC mouse models are important for studying the brain pathophysiology of this disorder.

fulltextpubmed· Body· item PMC6785595

]. So far, only 89 patients with MLC and GLIALCAM mutations have been reported in five papers [4, 8, 11, 12, 16]. The brain tissues of patients with MLC are rare for MLC1 mutations and unobtainable for GLIALCAM mutations. Therefore, MLC mouse models are important for studying the brain pathophysiology of this disorder. In the present study, we aimed to reveal the clinical characteristics, including those in long-term follow-up studies, genetic features, and phenotype–genotype relationship in MLC patients with GLIALCAM mutations and generate Glialcam mouse models with autosomal recessive and autosomal dominant inheritance to clarify the disease course and understand the brain pathological features of mouse models with different modes of inheritance. Methods Clinical analysis Patients were enrolled from the Pediatric Neurology Department, Peking University First Hospital from 2007 to 2017 in accordance with the following criteria: (1) diagnosed with MLC clinically; (2) no pathogenetic mutation in MLC1 was detected by sanger sequencing. Clinical information, such as visiting age, sex, onset age, presenting symptoms, and MRI results, was collected. The study was approved by the Ethics Committee of Peking University First Hospital, and written informed consents was obtained from the patients’ legal guardians.

fulltextpubmed· Body· item PMC6785595

n in MLC1 was detected by sanger sequencing. Clinical information, such as visiting age, sex, onset age, presenting symptoms, and MRI results, was collected. The study was approved by the Ethics Committee of Peking University First Hospital, and written informed consents was obtained from the patients’ legal guardians. Follow-up study data, including head circumference (HC), motor and mental development or retrogress, cranial MRI, head trauma histories, and other related symptoms, were collected by telephone follow-up survey. Motor function was assessed using the Chinese version of Gross Motor Function Classification System (GMFCS) for children with cerebral palsy [12]. The classification from GI to GV was represented as slightly to severe limited motor ability based on the patients’ age and motor function. Cognitive function was evaluated by word expression. The classification from C0 to C3 represented different levels of cognitive capacity from high to low according to their scores. Genetic analysis Peripheral venous blood samples were collected from six patients and their family members. DNA extraction, amplification, and sequencing of GLIALCAM were performed as previously reported [11, 12]. The sequence variants were screened and analyzed using a flexible function converged online tool for detailed annotation Variant Effect Predictor (VEP, https://asia.ensembl.org/Homo_sapiens/Tools/VEP) [17]. Finally, a comprehensive prediction was analyzed in accordance with the 2013 ACMG standards and guidelines [18]. Animals

fulltextpubmed· Body· item PMC6785595

Genetic analysis Peripheral venous blood samples were collected from six patients and their family members. DNA extraction, amplification, and sequencing of GLIALCAM were performed as previously reported [11, 12]. The sequence variants were screened and analyzed using a flexible function converged online tool for detailed annotation Variant Effect Predictor (VEP, https://asia.ensembl.org/Homo_sapiens/Tools/VEP) [17]. Finally, a comprehensive prediction was analyzed in accordance with the 2013 ACMG standards and guidelines [18]. Animals Mutations were derived from Chinese MLC patients with GLIALCAM mutations c.274C>T, p.Arg92Trp, c.203A>T(p.Lys68Met), and c.395C>A (p.Thr132Asn). Adult GlialcamArg92Trp/+, GlialcamLys68Met/+, and GlialcamThr132Asn/+ point mutation mice were obtained from the Beijing Vitalstar Biotechnology Co., Ltd. using a CRISPR/Cas9-based knock-in strategy in C57Bl/6N mice (Fig. S2A). Then, we crossbred heterozygous mutant mice between GlialcamLys68Met/+ and GlialcamThr132Asn/+ mice to obtain the compound heterozygous mouse GlialcamLys68Met/Thr132Asn. The study was approved by the Animals Ethical Committee of Peking University First Hospital, and animal housekeeping and experiments were in compliance with the guidelines of the committee. All mice were housed in an animal care facility (SPF) with a 12-h light–dark schedule and with freely available food and water. The DNA of the tail was extracted using the KAPA Express Extract kit, and genotype identification of these mice was performed by PCR and Sanger sequencing using the following primers: forward primer 5ʹ-AGGGCTTGAAG TTGGAAATGGGCTA-3ʹ; reverse primer 5′-AATTACCACTCAGCCTTTGCGTTGC-3ʹ. Table S1 records the sex and generations of mice used for the experiment.

fulltextpubmed· Body· item PMC6785595

using the KAPA Express Extract kit, and genotype identification of these mice was performed by PCR and Sanger sequencing using the following primers: forward primer 5ʹ-AGGGCTTGAAG TTGGAAATGGGCTA-3ʹ; reverse primer 5′-AATTACCACTCAGCCTTTGCGTTGC-3ʹ. Table S1 records the sex and generations of mice used for the experiment. HE staining and vacuole quantification Mice were anesthetized by 0.5% pentobarbital sodium at the dosage of 50 mg/kg, perfused by 0.9% saline and 4% paraformaldehyde. Brains were then perfusion-fixed with 4% paraformaldehyde and embedded in paraffin. Tissue slices were stained with hematoxylin and eosin (HE). Slice series from brain sagittal sections stained with HE were obtained through scanning by NanoZoomer RS 2.0.0 (HAMAMATSU, Japan) at 40× objective. Three slices of each animal brain were obtained, and three different animals of each genotype at four different time points were analyzed. Blind quantification of the vacuoles in the cerebellar and anterior commissural WM was performed to the genotype using ImageJ. Fluorescence immunohistochemistry Fluorescence immunohistochemistry staining of Glialcam and Gfap were used to check the expression and localization of Glialcam among different group. For each genotype, three brain sections each of three different mice were analyzed by the Olympus confocal microscope and FV3000 system (Tokyo, Japan). Statistical analyses WM vacuolization was analyzed using one-way ANOVA using SPSS version 19 (Armonk, USA) and GraphPad Prism 5 (San Diego, Canada). A P value < 0.05 was considered as statistically significant.

fulltextpubmed· Body· item PMC6785595

Fluorescence immunohistochemistry Fluorescence immunohistochemistry staining of Glialcam and Gfap were used to check the expression and localization of Glialcam among different group. For each genotype, three brain sections each of three different mice were analyzed by the Olympus confocal microscope and FV3000 system (Tokyo, Japan). Statistical analyses WM vacuolization was analyzed using one-way ANOVA using SPSS version 19 (Armonk, USA) and GraphPad Prism 5 (San Diego, Canada). A P value < 0.05 was considered as statistically significant. Results Clinical and genetic findings of patients with MLC and GLIALCAM mutations Clinical and follow-up findings Six patients (Pt1–Pt6) enrolled in this study were clinically diagnosed with MLC (Table 1). One patient (Pt6) has been reported twice and three patients (Pt1–Pt3) have been reported once in two follow-up studies [11, 12]. The two patients (Pt5 and Pt6) were new-coming, and another three follow-up studies were performed for all six patients. The clinical characteristics of four patients were macrocephaly, earlier normal motor development, and classic MRI. Three patients were diagnosed as MLC2B and one as MLC2A. The patient with MLC2A showed motor retrogress, while one patient with MLC2B had an improvement in the MRI. For all six patients, the onset age ranged from birth to 7 months, with a median of 4 months. Macrocephaly was noted in five patients (Pt1–Pt4 and Pt6) with HC above the 97th percentile. Pt5 presented with HC > 1 SD history. In all six patients, the development of earlier motor and a rapid HC growth milestones, such as head control, rolling over, and sitting alone, were all normal (Table 2). However, the patients spent more time from walking unstably to walking stably. Motor developmental delay was observed in Pt4 and Pt6. Cognitive development was normal in all patients, except in Pt4, at the first visit (Table 3). Autism and language development delay were found in Pt4. Epilepsy occurred in Pt5. Transient macrocephaly was found in the mothers of Pt1 and Pt4 before 1 year old. Hypotonia was found in Pt2 and Pt3. Motor retrogress after head trauma was found in Pt6. Bilateral diffuse cerebral abnormal signals in swollen WM with or without cysts were found in the MRIs of all patients, expect Pt5, at the first visit. In Pt5, only subcortical WM was involved in the MRI. Posterior limb of the internal capsule was involved in Pt1 and Pt3.Table 1 The Clinical characteristic of 6 patients with MLC at first visit

fulltextpubmed· Body· item PMC6785595

l abnormal signals in swollen WM with or without cysts were found in the MRIs of all patients, expect Pt5, at the first visit. In Pt5, only subcortical WM was involved in the MRI. Posterior limb of the internal capsule was involved in Pt1 and Pt3.Table 1 The Clinical characteristic of 6 patients with MLC at first visit Pt Gender Agevisit Ageonset SymptomOnset HC (cm) EPS FH Seizures Cranial MRI /CT Age Cerebral WMA Cerebral WMS PLIC ALIC Cysts 1 M 1 y 5 mon 0 mon Mc 53 (> 2 SD) −  +  − 7 mon + + + − + 7 y 9 mon − − − − − 2 M 9 mon 5 mon Mc 50 (> 2 SD)  +  − − 8 mon + + + − + 3 M 10 mon 4 mon Mc 50 (> 2 SD)  +  − − 8 mon + + − − + 4 M 1 y 2 mon 7 mon Mc 52 (> 2 SD) −  +  − 8.5 mon + + − − + 5 M 2 y 10 mon 2 y 10 mon Seizures 51 (> 1 SD) − −  +  2 y 4 mon + + − − − 6 F 5 y 4 mon Mc 55 (> 2 SD) − − − 2 y + + / / + F female, M male, Agevisit at first visit age, Ageonset onset age, SymptomOnset onset symptom, HC head circumference(cm), EPS extrapyramidal signs, FH family history, WMA white matter abnormality, WMS white matter swelling, PLIC posterior limb of internal capsule, ALIC anterior limb of internal capsule, / not done, + positive, − negative Table 2 The motor milestones, GMFCS and expression evaluation results of 6 patients at first visit and five times follow-up

fulltextpubmed· Body· item PMC6785595

Pt Gender Agevisit Ageonset SymptomOnset HC (cm) EPS FH Seizures Cranial MRI /CT Age Cerebral WMA Cerebral WMS PLIC ALIC Cysts 1 M 1 y 5 mon 0 mon Mc 53 (> 2 SD) −  +  − 7 mon + + + − + 7 y 9 mon − − − − − 2 M 9 mon 5 mon Mc 50 (> 2 SD)  +  − − 8 mon + + + − + 3 M 10 mon 4 mon Mc 50 (> 2 SD)  +  − − 8 mon + + − − + 4 M 1 y 2 mon 7 mon Mc 52 (> 2 SD) −  +  − 8.5 mon + + − − + 5 M 2 y 10 mon 2 y 10 mon Seizures 51 (> 1 SD) − −  +  2 y 4 mon + + − − − 6 F 5 y 4 mon Mc 55 (> 2 SD) − − − 2 y + + / / + F female, M male, Agevisit at first visit age, Ageonset onset age, SymptomOnset onset symptom, HC head circumference(cm), EPS extrapyramidal signs, FH family history, WMA white matter abnormality, WMS white matter swelling, PLIC posterior limb of internal capsule, ALIC anterior limb of internal capsule, / not done, + positive, − negative Table 2 The motor milestones, GMFCS and expression evaluation results of 6 patients at first visit and five times follow-up Pt Sex HCt RO IS IW WS WE At first visit 1st follow-up 2nd follow-up 3rd follow-up 4th follow-up 5th follow-up Age G C Age G C Age G C Age G C Age G C Age G C 1 M 7 mon 8 mon 8 mon 1 y 1 mon 2 y 13 mon 1 y 5 mon I 0 4 y I 0 5 y 5 mon I 0 7 y 6 mon N 0 9 y 3 mon N 0 10 y 9 mon N 0 2 M 3 mon 3 mon 7 mon NA NA NA 9 mon I 0 NA NA NA NA NA 3 M 4 mon 5 mon 7 mon 1 y 9 mon 2 y 1 y 6 mon 10 mon I 0 1 y I 0 2 y 3 mon I 0 4 y 3 mon N 0 6 y 1 mon N 1 NA 4 M 5 mon 7 mon 9 mon 2 y 8 mon 3 y 6 mon NA 1 y 2 mon I 1 NA NA NA 2 y 3 mon I 2 3 y 8 mon I 3 5 M 3 mon 6 mon 7 mon 1 y 4 mon 1 y 6 mon 1 y 2 y 10 mon I 0 NA NA NA 3 y 4 mon I 1 4 y 9 mon N 1 6 F 4 mon 6 mon 8 mon 2 y 3 y 1 y 2 mon 5 y II 0 9 y II 0 10 y 6 mon II 0 12 y 6 mon II 1 14 y 4 mon III 1 15 y 10 mon III 1 F female, M male, HCt head control, RO roll over, IS independent sitting, IW independent walking, WS walk stably, WE word expression, G gross motor function classification system, C cognitive ability of word expression system, N normal, NA not available

fulltextpubmed· Body· item PMC6785595

10 y 6 mon II 0 12 y 6 mon II 1 14 y 4 mon III 1 15 y 10 mon III 1 F female, M male, HCt head control, RO roll over, IS independent sitting, IW independent walking, WS walk stably, WE word expression, G gross motor function classification system, C cognitive ability of word expression system, N normal, NA not available Table 3 Mental developmental milestones and school performance of 6 patients Pt Sex Age* S RP WE SP 1 M 10 y 9 mon 1 mon 11 mon 1 y 1 mon Above the average all the time, now at Grade 6, not good at reading comprehension 2 M 9 mon NA 6 mon NA NA 3 M 6 y 1 mon 3 mon 5 mon 1 y 6 mon Average at kindergarten 4 M 3 y 8 mon NA 12 mon NA Not go to school 5 M 4 y 9 mon 3 mon 7 mon 1 y Not go to school 6 F 15 y 10 mon 5 mon 5 mon 1 y 2 mon Above the average at the kindergarten, Grade 1 and 2, below average at Grade 3, dropped out at Grade 6 in primary school because of motor deterioration, not good at mathematics F female, M male, Age* age at last follow-up, S smile, RP recognize people, WE word expression, SP school performance, NA not available

fulltextpubmed· Body· item PMC6785595

y 2 mon Above the average at the kindergarten, Grade 1 and 2, below average at Grade 3, dropped out at Grade 6 in primary school because of motor deterioration, not good at mathematics F female, M male, Age* age at last follow-up, S smile, RP recognize people, WE word expression, SP school performance, NA not available In the follow-up study, one patient (Pt2) was missing and the remaining five patients attended for 5 (Pt1), 4 (Pt3), 2 (Pt4), 2 (Pt5), and 5 (Pt6) times of follow-up study. HC above the 97th percentile of normal children was found in Pt1, Pt3, Pt4, and Pt6, and a normal HC was found in Pt5 at the first visit (Fig. S1). The HC showed a rapid growth and then slowed down after 2 years in Pt5. GMFCS classification improved in Pt1, Pt3, and Pt5 from GI to normal, stabilized in Pt5 at GI, and declined in Pt6 from GII to GIII (Table 2). The cognitive classification declined in four patients, except Pt1 (Table 2); Pt3 and Pt5–Pt6 declined from normal to C1, whereas Pt4 declined from C1 to C3. School performance was above average for those who attended school, and Pt6 dropped out of school at 11 years because of motor disability. Additionally, language absence and autism only appeared in Pt4. Focal epilepsy occurred four times in 2 months and was controlled by sodium valproate in Pt5. Pt6 had two unconsciousness episodes after head trauma with motor deterioration. The MRI was typical in four patients (Pt1–Pt3 and Pt6), with bilateral diffuse abnormal signals in swollen cerebral WM with or without subcortical cysts, and atypical with only subcortical WM involved in Pt5; the involvement of the posterior limbs of the internal capsule (PLIC) was discovered in the MRI in Pt1 and Pt3, no anterior limbs of internal capsule (ALIC) were found. Thorough MRI improvement was detected in Pt1 (Fig. 1).Fig. 1 MRI of Pt1 and Pt5. T2WI, T2 weighted-image. a–i MRI of Pt1. a–c MRI of Pt1 at 7 m; a Bilateral diffuse abnormal signals in subcortical and central white matter with abnormal signals (arrows) in the partial posterior limb of the internal capsule in axial T2WI; b temporal cysts were detected in axial T2WI (arrows); c temporal cysts in sagittal T2WI (arrows); d–f MRI of Pt1 at 7 years 9 months. Normal white matter signals without temporal cysts; g–i MRI of Pt1’s mother at 35 years 1 month, normal signals in white matter without temporal subcortical cysts; j–o MRI of Pt5.

fulltextpubmed· Body· item PMC6785595

T2WI; b temporal cysts were detected in axial T2WI (arrows); c temporal cysts in sagittal T2WI (arrows); d–f MRI of Pt1 at 7 years 9 months. Normal white matter signals without temporal cysts; g–i MRI of Pt1’s mother at 35 years 1 month, normal signals in white matter without temporal subcortical cysts; j–o MRI of Pt5. j–l MRI of Pt5 at 2 years 4 months; j bilateral abnormal signals in subcortical white matter (arrows) with normal central white matter and without cysts in axial T2WI; k, l abnormal signals in subcortical white matter in axial and sagittal T1WI; m–o MRI of Pt5 at 2 years 6 months. No improvement was seen in cerebral white matter Genetic findings Four promising variants in GLIALCAM were detected in six patients were all genetically diagnosed (Table 4). One patient (Pt6) presented with compound heterozygous variants c.203A>T (p.Lys68Met) and c.395C>A (p.Thr132Asn) in GLIALCAM, while the five remaining patients (Pt1–Pt5) harbored only one variant in GLIALCAM. Of the five patients with mono-allelic variant in GLIALCAM, four patients (Pt1–Pt3, and Pt5) shared the same variant c.274C>T(p.Arg92Trp), which has been reported in patients with MLC before [4], while Pt4 had a novel variant c.275G>C(p.Arg92Pro) (Fig. S3), which has not been reported before. Except the variant in Pt3 arising de novo, variants in Pt1, Pt2, Pt4, and Pt5 were all inherited from their mothers. The mothers of Pt1 and Pt4 had a history of transient macrocephaly.Table 4 GlialCAM variants with pathogenicity analysis

fulltextpubmed· Body· item PMC6785595

novel variant c.275G>C(p.Arg92Pro) (Fig. S3), which has not been reported before. Except the variant in Pt3 arising de novo, variants in Pt1, Pt2, Pt4, and Pt5 were all inherited from their mothers. The mothers of Pt1 and Pt4 had a history of transient macrocephaly.Table 4 GlialCAM variants with pathogenicity analysis Pt Variants Protein Novel/reported Origin GERP Polyphen2 Mutation taster SIFT CADD M-CAP Condel ACMG 1 c.274C>T p.Arg92Trp Reported M* 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 2 c.274C>T p.Arg92Trp Reported M 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 3 c.274C>T p.Arg92Trp Reported De novo 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 4 c.275G>C p.Arg92Pro Novel M* 5.84 PD(0.89865) DC(1) D(0) 34 D(0.89357) D(0.945) Likely Pathogenic 5 c.274C>T p.Arg92Trp Reported M 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 6 c.203A>T p.Lys68Met Reported M 5.84 PD(1) DC(0.999994) D(0) 28.3 D(0.87393) D(0.945) Likely Pathogenic c.395C>A p. Thr132Asn Reported P 5.97 PD(0.995) DC(0.999993) D(0) 25.5 D(0.77129) D(0.902) Uncertain Significance P paternal, M maternal, M* mother with macrocephaly history, PD probably deleterious, DC disease causing, D deleterious All identified variants in GLIALCAM were four missense variants. All changed sites were analyzed to be highly conservative by GERP. All of the four variants were unrecorded in gnomAD database and predicted to be deleterious by Polyphen2, SIFT, Mutation Taster, and Model.

fulltextpubmed· Body· item PMC6785595

Pt Variants Protein Novel/reported Origin GERP Polyphen2 Mutation taster SIFT CADD M-CAP Condel ACMG 1 c.274C>T p.Arg92Trp Reported M* 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 2 c.274C>T p.Arg92Trp Reported M 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 3 c.274C>T p.Arg92Trp Reported De novo 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 4 c.275G>C p.Arg92Pro Novel M* 5.84 PD(0.89865) DC(1) D(0) 34 D(0.89357) D(0.945) Likely Pathogenic 5 c.274C>T p.Arg92Trp Reported M 5.84 PD(0.99) DC(0.999954) D(0) 29.2 D(0.88394) D(0.886) Pathogenic 6 c.203A>T p.Lys68Met Reported M 5.84 PD(1) DC(0.999994) D(0) 28.3 D(0.87393) D(0.945) Likely Pathogenic c.395C>A p. Thr132Asn Reported P 5.97 PD(0.995) DC(0.999993) D(0) 25.5 D(0.77129) D(0.902) Uncertain Significance P paternal, M maternal, M* mother with macrocephaly history, PD probably deleterious, DC disease causing, D deleterious All identified variants in GLIALCAM were four missense variants. All changed sites were analyzed to be highly conservative by GERP. All of the four variants were unrecorded in gnomAD database and predicted to be deleterious by Polyphen2, SIFT, Mutation Taster, and Model. According to the ACMG guideline [18], the variants c.274C>T (p.Arg92Trp), c.275G>C(p.Arg92Pro), c.203A>T (p.Lys68Met), and c.395C>A (p.Thr132Asn) were classified as “pathogenic,” “likely pathogenic,” “likely pathogenic,” and “uncertain significance,” respectively.

fulltextpubmed· Body· item PMC6785595

All identified variants in GLIALCAM were four missense variants. All changed sites were analyzed to be highly conservative by GERP. All of the four variants were unrecorded in gnomAD database and predicted to be deleterious by Polyphen2, SIFT, Mutation Taster, and Model. According to the ACMG guideline [18], the variants c.274C>T (p.Arg92Trp), c.275G>C(p.Arg92Pro), c.203A>T (p.Lys68Met), and c.395C>A (p.Thr132Asn) were classified as “pathogenic,” “likely pathogenic,” “likely pathogenic,” and “uncertain significance,” respectively. Brain histopathological findings Validation of the GLIALCAM point mutation in mouse models Genotype verification was performed by PCR and Sanger sequencing at postnatal 7 days for every mouse born from the crossbred of GlialcamArg92Trp/+ with C57Bl/6N wild-type mice or GlialcamLys68Met/+ and GlialcamThr132Asn /+ mice (Fig. S2B).

fulltextpubmed· Body· item PMC6785595

opathological findings Validation of the GLIALCAM point mutation in mouse models Genotype verification was performed by PCR and Sanger sequencing at postnatal 7 days for every mouse born from the crossbred of GlialcamArg92Trp/+ with C57Bl/6N wild-type mice or GlialcamLys68Met/+ and GlialcamThr132Asn /+ mice (Fig. S2B). Pathological results Vacuoles were detected in the WM of GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice through brain histopathology. The vacuolization of anterior commissural WM started within 1 month of age in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn models and showed a decreased tendency in subsequent months (Fig. 2a). GlialcamLys68Met/Thr132Asn mice presented a heavier degree of vacuolization than GlialcamArg92Trp/+ mice at 9 months in anterior commissure. No vacuoles were detected in the anterior commissural WM of wild-type mice. The vacuoles in GlialcamArg92Trp/+ murine cerebellum were detected at 3 months, prominent at 6 months, and increased at 9 months, while the vacuoles in GlialcamLys68Met/Thr132Asn were first detected at 6 months, increased at 9 months (Fig. 2b), and became more prominent than GlialcamArg92Trp/+ mice at 9 months. Quantification analysis showed these results (Fig. 2c, d). Glialcam expression and localization of astrocytes along blood vessel in the cerebellum at 9 months were shown (Fig. 3), indicating decreased Glialcam fluorescent in the brains of GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice comparing with wild-type mice; and no obvious mislocalization of Glialcam and Gfap were found.Fig. 2 White matter vacuolization in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice in the anterior commissural and cerebellar WM. a, b HE staining of mice aged 1 month, 3 months, 6 months, and 9 months shows vacuolization in white matter. In the anterior commissure, vacuolization starts from 1 month in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice, and GlialcamLys68Met/Thr132Asn has more vacuoles than GlialcamArg92Trp/+ mice at 9 months. In cerebellum white matter, vacuolization in GlialcamArg92Trp/+ mice started from 3 months; in GlialcamLys68Met/Thr132Asn mice, vacuolization started from 6 months, and the degree of vacuolization was more prominent than that in GlialcamArg92Trp/+ mice at 9 months. Scale bars 50 µm.

fulltextpubmed· Body· item PMC6785595

GlialcamArg92Trp/+ mice at 9 months. In cerebellum white matter, vacuolization in GlialcamArg92Trp/+ mice started from 3 months; in GlialcamLys68Met/Thr132Asn mice, vacuolization started from 6 months, and the degree of vacuolization was more prominent than that in GlialcamArg92Trp/+ mice at 9 months. Scale bars 50 µm. c, d Quantification confirms anterior commissural vacuolization in GlialcamArg92Trp/+, GlialcamLys68Met/Thr132Asn has more prominent vacuoles than the wild type with a decreased tendency, and GlialcamLys68Met/Thr132Asn has more vacuolization than GlialcamArg92Trp/+ mice at 9 months. c, d show significantly more prominent white matter cerebellar vacuolization of GlialcamLys68Met/Thr132Asn mice than GlialcamArg92Trp/+ mice at 9 months with an increased tendency. P < 0.05, †P < 0.01 and ‡P < 0.001. Graph bars represent the standard error of the mean Fig. 3 Glialcam expression decreased in astrocyte along blood vessels in cerebellum at 9 months. Fluorescence immunohistochemistry staining of Glialcam (green) and the astrocytic cytoskeletal protein Gfap (red) in the white matter of the cerebellum. Arrows (white) point to nucleus (blue) of endothelial cell, and arrows (yellow) point to the Glialcam protein in astrocyte along blood vessels. It seemed that Glialcam showed a decreased red fluorescent in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice brain. Scale bars 20 μm

fulltextpubmed· Body· item PMC6785595

68Met) and c.395C>A (p.Thr132Asn) were detected in the six patients. One patient (Pt6) had two compound heterozygous mutations, and the five other patients had one mono-allelic mutation (Pt1–Pt5). Therefore, the six patients were genetically diagnosed. Five patients (Pt1–Pt5) had MLC2B, and one patient (Pt6) had MLC2A. Previous studies reported that macrocephaly is the most common presenting symptom in the patients with MLC [1, 4, 8]; in the present study, it appeared in five of the six patients. In the long term, HC growth varied among the patients. Rapid growth after 2 years was found in Pt3 and Pt5 and was first discovered in patients with GLIALCAM mutations. The HC of four patients with MLC2B (Pt1–Pt4) were always above 97th of the control at the fifth follow-up study, but macrocephaly was normalized in one of the patient with MLC2B in the follow-up studies. Pt5 presented with normal HC all the time and with a rapid HC growth in the infant period, which was reported previously [4, 8, 12, 17]. The motor development of five patients with MLC2B developed stably or faster, indicating an improvement; meanwhile, that of patient with MLC2A declined because of motor retrogress. Early motor development is normal before walking [4]. The changes in the GMFCS of the patients indicate that motor development was kept stable or improved in patients with MLC2B and deteriorated in the patient with MLC2A. Early cognitive milestones were almost normal, but autism and the absence of language appeared in one patient with MLC2B (Pt4), which was reported previously [8]. In the follow-up study, the cognitive development was almost slightly delayed by word expression, and the school performance was almost normal. Almost all patients with MLC2A and MLC2B were detected with classic MRI, but atypical MRI involving subcortical WM only was found in one patient with MLC2B (Pt5). One patient with MLC2B showed improved MRI; this phenomenon was also reported in literature [8]. A double line throughout involvement was the most common abnormal signal of the internal capsule in patients with MLC1 and MLC2A [1, 8]. The present study is the first to report the involvement of the posterior limb of the internal capsule in the patients (Pt1 and Pt3). Regarding other neurological dysfunction, autistic behavior was frequently found in patients with MLC2B and rare in patients with MLC1; thus far, autistic behavior has not been reported in patients with MLC2A [4, 8, 16].

fulltextpubmed· Body· item PMC6785595

report the involvement of the posterior limb of the internal capsule in the patients (Pt1 and Pt3). Regarding other neurological dysfunction, autistic behavior was frequently found in patients with MLC2B and rare in patients with MLC1; thus far, autistic behavior has not been reported in patients with MLC2A [4, 8, 16]. This finding could be used to distinguish MLC2B in patients with MLC1 and MLC2A clinically. Therefore, combining the clinical and genetic results revealed that the compound heterozygous mutations of GLIALCAM caused deteriorated progress, while dominant mutations lead to improved phenotype with macrocephaly and delayed development with or without macrocephaly. Atypical presentations including the involvement of subcortical white matter on MRI, a normalized head circumference on follow-up, or the absence of language and autism appear in patients with MLC2B.

fulltextpubmed· Body· item PMC6785595

le dominant mutations lead to improved phenotype with macrocephaly and delayed development with or without macrocephaly. Atypical presentations including the involvement of subcortical white matter on MRI, a normalized head circumference on follow-up, or the absence of language and autism appear in patients with MLC2B. Thus far, 19 mutations have been reported in GLIALCAM, including 6 mutations associated with MLC2B and 13 mutations associated with MLC2A. One novel mutation c.275G>C (p.Arg92Pro) was found in the present study, expanding the spectrum of GLIALCAM mutations. Interestingly, another substitution at the same nucleotide site [c.275G>A (p.Arg92Gln)] was detected in a patient with MLC2A [4]. The different inheritance patterns and clinical presentation of p.Arg92Pro and p.Arg92Gln, possibly resulting from the replacement by different amino acid residues from basic hydrophilic (Arg) to neutral hydrophobic (Pro) and neutral hydrophilic (Gln), might alter the secondary structure and affect the function of the protein. However, the mechanism needs to be explored further. The mutation c.274C>T (p.Arg92Trp) accounted for four of the five patients with MLC2B. A previous study also detected this mutation, which accounted for 28.5% of the reported patients with MLC2B [4]. Thus, c.274C>T (p.Arg92Trp) was supposed to be a hot-spot mutation.

fulltextpubmed· Body· item PMC6785595

However, the mechanism needs to be explored further. The mutation c.274C>T (p.Arg92Trp) accounted for four of the five patients with MLC2B. A previous study also detected this mutation, which accounted for 28.5% of the reported patients with MLC2B [4]. Thus, c.274C>T (p.Arg92Trp) was supposed to be a hot-spot mutation. Glialcam-null mice and GlialcamGly89Ser/+ mouse models were generated previously [19–21]. GLIALCAM mutations with autosomal dominant inheritance result in an improved phenotype, while GLIALCAM mutations with autosomal recessive inheritance lead to motor deterioration and mental decline in patients with MLC. Glialcam mutation mouse models can be used to investigate brain histopathological differences and prognosis of different inheritances of MLC. Here, we generated the first GlialcamLys68Met/Thr132Asn mouse model with an autosomal recessive inherited manner and a new GlialcamArg92Trp/+mouse model with an autosomal dominant inherited manner. No MRI abnormality was observed during the entire period in GlialcamArg92Trp/+ and wild-type mice (data not shown). The HE staining on the brain tissue slices was conducted to observe the pathological changes. Vacuoles were detected in the anterior commissural WM in GlialcamArg92Trp/+ and GlialcamLys68Met/Thr132Asn mice at 1 month, indicating that the pathological change started from the infant period, consistent with findings in human patients. Thereafter, the vacuoles showed a decreased tendency at subsequent time points, a similar phenomenon observed in the corpus callosum of Glialcam-null mice [21]. No vacuoles were found in wild-type mice. In the cerebellar WM, GlialcamArg92Trp/+mice showed pathological changes earlier than GlialcamLys68Met/Thr132Asn, both with increased tendency but more severe pathological changes appeared in GlialcamLys68Met/Thr132Asn than GlialcamArg92Trp/+ at middle age. Thus, the WM vacuoles appeared in both mouse models within the infant period and increased in the cerebellum during the disease course. GlialcamLys68Met/Thr132Asn mice showed more severe vacuolization in the anterior commissure and cerebellum than GlialcamArg92Trp/+and wild-type mice at middle ages, indicating the more severe involvement of brain tissues in the former. No improvement occurred in GlialcamArg92Trp/+mice at the end of the observation, which are different from the results in some patients with GLIALCAMArg92Trp/+ mutation.

fulltextpubmed· Body· item PMC6785595

missure and cerebellum than GlialcamArg92Trp/+and wild-type mice at middle ages, indicating the more severe involvement of brain tissues in the former. No improvement occurred in GlialcamArg92Trp/+mice at the end of the observation, which are different from the results in some patients with GLIALCAMArg92Trp/+ mutation. The difference in the vacuolization timeline in white matter between patients and mice may be due to their different development times or anatomic structures. The maximum age observed is 9 months, and whether the remitting of cerebellar WM vacuolization appears or not remains to be seen. Therefore, the pathology in mice with bi-allelic mutations in Glialcam was more severe than that with mono-allelic mutation over time, consistent with the prognosis of human patients. GlialcamArg92Trp/+ mice did not show remitting in contrast to some patients with MLC2B and the same mutation. The expression of Glialcam in astrocytes along blood vessels of cerebellar white matter at 9 months were decreased, indicating that the decreased expression of Glialcam may contribute to the vacuolization, but Western Blot are needed to verify this in the future. There was no obvious difference of localization between Glialcam and Gfap in three group.

fulltextpubmed· Body· item PMC6785595

rocytes along blood vessels of cerebellar white matter at 9 months were decreased, indicating that the decreased expression of Glialcam may contribute to the vacuolization, but Western Blot are needed to verify this in the future. There was no obvious difference of localization between Glialcam and Gfap in three group. The clinical and genetic characteristics of patients with MLC and GLIALCAM mutations were revealed. One novel mutation was identified, expanding the spectrum of GLIALCAM mutations. The first Glialcam mouse models with autosomal recessive inheritance and a new Glialcam mouse model with autosomal dominant inheritance were generated. The two mouse models with different inheritance patterns showed different degrees of brain pathological features, which were consistent with patients’ phenotype and further confirmed the pathogenicity of the corresponding mutations. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary file1 (DOCX 1829 kb) Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

fulltextpubmed· Body· item PMC6785595

The clinical and genetic characteristics of patients with MLC and GLIALCAM mutations were revealed. One novel mutation was identified, expanding the spectrum of GLIALCAM mutations. The first Glialcam mouse models with autosomal recessive inheritance and a new Glialcam mouse model with autosomal dominant inheritance were generated. The two mouse models with different inheritance patterns showed different degrees of brain pathological features, which were consistent with patients’ phenotype and further confirmed the pathogenicity of the corresponding mutations. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary file1 (DOCX 1829 kb) Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements We thank all the patients and their families for their cooperation and contribution. This work was supported by the National Natural Science Foundation of China (Grant Number: 81741053, 81501123); by the Beijing Natural Science Foundation (Grant Number: 7151010, 7172217); by the Beijing Municipal Science & Technology Commission (Grant Number: Z161100000216133, Z161100004916169); by the Beijing Institute for Brain Disorders Foundation (Grant Number: BIBDPXM2014_014226_000016) and the Beijing Municipal Natural Science Key Project (Grant Number 15G10050); by Beijing key laboratory of molecular diagnosis and study on pediatric genetic diseases (Grant Number BZ0317); by the National Key Research and Development Program of China (Grant Number: 2016YFC1306201, 2016YFC0901505); by the Fundamental Research Funds for the Central Universities (Grant Number: BMU2017JI002).

fulltextpubmed· Body· item PMC6785595

050); by Beijing key laboratory of molecular diagnosis and study on pediatric genetic diseases (Grant Number BZ0317); by the National Key Research and Development Program of China (Grant Number: 2016YFC1306201, 2016YFC0901505); by the Fundamental Research Funds for the Central Universities (Grant Number: BMU2017JI002). Author contributions JMW and YWJ study design and revision of the manuscript; ZS animal experiments, data analysis and draft of the manuscript; HFY animal experiments and data analysis; B-BC, MMG, KG:genetic analysis; HX, YLY, HX, QG, ML, YW follow-up patient’s information and revision of the manuscript; JXX analysis for MRI. All authors read and approved the final manuscript. Funding This work was funded by the National Natural Science Foundation of China (Grant Number: 81741053, 81501123); by the Beijing Natural Science Foundation (Grant Number: 7151010, 7172217); by the Beijing Municipal Science & Technology Commission (Grant Number: Z161100000216133, Z161100004916169); by the Beijing Institute for Brain Disorders Foundation (Grant Number: BIBDPXM2014_014226_000016) and the Beijing Municipal Natural Science Key Project (Grant Number 15G10050); by Beijing key laboratory of molecular diagnosis and study on pediatric genetic diseases(Grant Number BZ0317); by the National Key Research and Development Program of China (Grant Number: 2016YFC1306201, 2016YFC0901505); by the Fundamental Research Funds for the Central Universities (Grant Number: BMU2017JI002).

fulltextpubmed· Body· item PMC6785595

0050); by Beijing key laboratory of molecular diagnosis and study on pediatric genetic diseases(Grant Number BZ0317); by the National Key Research and Development Program of China (Grant Number: 2016YFC1306201, 2016YFC0901505); by the Fundamental Research Funds for the Central Universities (Grant Number: BMU2017JI002). Compliance with ethical standards Ethical approval The study had been approved by Ethics Committee of Peking University First Hospital for patients, the animal study had been approved by the Animals Ethical Committee of Peking University First Hospital. Conflict of interest No financial or non-financial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6785647

Introduction Wilms tumor is the most common urinary system malignant tumor in children. It tends to grow into vena cava, even invade into the atrium which increased operating difficulty and frequency of surgical complications [1, 2]. According to the statistics of 2731 Wilms tumor patients from 1986 to 1995 from the reports of Shamberger et al. [2], there were 165 (6%) cases with tumor thrombus, 134 (4.9%) cases with inferior vena cava tumor thrombus and 31 (1.1%) cases with tumor thrombus involving the right atrium. In literatures, there is no significant relationship between the incidence of tumor thrombus and pathological classification. The retrospective study is designed to analyze and summarize the diagnosis, treatment and prognosis of Wilms tumor children with venous tumor thrombus in our hospital. Methods General information This is a single-center retrospective study. 42 children with unilateral Wilms tumors accompanied by intravenous tumor thrombus were enrolled: 23 males and 19 females; 16 cases in the left and 26 in the right; average age of 4.3 years. All patients were treated in urology surgery department of Beijing Children’s Hospital from January 1996 to December 2017. Clinical symptoms and signs In these 42 children, there were 16 cases complained of abdominal pain, 37 cases complained of abdominal mass, and 14 cases complained of hematuria as the main symptoms for the first visiting; wherein, 2 cases had varicose veins in peripheral umbilicus during physical examination.

fulltextpubmed· Body· item PMC6785647

Methods General information This is a single-center retrospective study. 42 children with unilateral Wilms tumors accompanied by intravenous tumor thrombus were enrolled: 23 males and 19 females; 16 cases in the left and 26 in the right; average age of 4.3 years. All patients were treated in urology surgery department of Beijing Children’s Hospital from January 1996 to December 2017. Clinical symptoms and signs In these 42 children, there were 16 cases complained of abdominal pain, 37 cases complained of abdominal mass, and 14 cases complained of hematuria as the main symptoms for the first visiting; wherein, 2 cases had varicose veins in peripheral umbilicus during physical examination. Diagnostic methods In these 42 children, the locations of tumors and tumor thrombus were clearly indicated by abdominal enhanced computed tomography (CT). Among those cases, there were 5 (12%) cases with renal vein thrombus, 27 (64%) cases with inferior vena cava thrombus (including one case whose thrombus reached the atrial entrance), and 10 (24%) cases with intra-atrial tumor thrombus. On ultrasound examination, tumor thrombus was noted in 41 children, but one case was not found. Preoperative chest X-ray and lung CT showed that 4 cases had pulmonary metastasis. One case showed adhesions of tumor to the liver on CT images, but it did not invade the liver. Only one case was confirmed by the preoperative puncture biopsy, and 41 cases were not confirmed for tumor character by biopsy, but a clinical diagnosis was made according to CT and ultrasound results. Daum et al. [3] had classified Wilms tumor thrombus into four stages: in stage I the tumor thrombus is maximal 5 cm long and reaches the inferior vena cava, ending at the lower border of the liver; in stage II the tumor mass extends under the junction of the hepatic vein; in stage III the intracaval tumor reaches the hepatic veins; and in stage IV the tumor is located in the atrium. According to Daum staging, there were 5 cases at stage I, 21 cases at stage II, 6 cases at stage III, and 10 cases at stage IV (Table 1).Table 1 Effect analysis of preoperative chemotherapy in Daum stage IV tumor thrombus patients

fulltextpubmed· Body· item PMC6785647

aval tumor reaches the hepatic veins; and in stage IV the tumor is located in the atrium. According to Daum staging, there were 5 cases at stage I, 21 cases at stage II, 6 cases at stage III, and 10 cases at stage IV (Table 1).Table 1 Effect analysis of preoperative chemotherapy in Daum stage IV tumor thrombus patients No. Gender Age (y) Tumor volumetric change Thrombus change CPB Histopathology 1 Female 4.9 I – Yes N 2 Male 3.5 D – Yes N 3 Male 2.2 D D No Mesenchymal type 4 Male 3.6 D D No Germ type 5 Female 3.1 D – Yes N 6 Female 2.9 D D No Mixed type 7 Female 3.1 D D No Mixed type 8 Female 4.8 D – Yes N 9 Male 4.6 I – Yes N 10 Female 3.2 D D No Mesenchymal type CPB cardiopulmonary bypass, I increase, D decrease, N necrotic tumor tissue which could not be classified after preoperative chemotherapy, – unchange

fulltextpubmed· Body· item PMC6785647

ype 5 Female 3.1 D – Yes N 6 Female 2.9 D D No Mixed type 7 Female 3.1 D D No Mixed type 8 Female 4.8 D – Yes N 9 Male 4.6 I – Yes N 10 Female 3.2 D D No Mesenchymal type CPB cardiopulmonary bypass, I increase, D decrease, N necrotic tumor tissue which could not be classified after preoperative chemotherapy, – unchange Treatment methods Among these 42 Wilms tumors children with venous tumor thrombus, 36 cases underwent preoperative chemotherapy including three cases who received preoperative radiotherapy. All 42 children underwent radical nephrectomy with tumor and removal of intravenous or intra-atrial tumor thrombus. The retroperitoneal lymph nodes of 38 children resected and submitted separately for histopathologic evaluation. Because of no enlarged or hardened lymph nodes were found, the other four cases were not sent for lymph nodes pathological examination. Five cases were removed intracardiac tumor thrombus under deep hypothermic cardiopulmonary bypass (CPB) (Fig. 1). Appropriate chemotherapy and/or radiotherapy regimens were performed according to the pathological findings and National Wilms’ Tumor Study (NWTS)-4 or NWTS-5 clinical staging criteria.Fig. 1 The patient (no. 8 in Table 1), female, was 4.8 years old, with right renal Wilms tumor combined with atrial tumor thrombus. She underwent deep hypothermic cardiopulmonary bypass to remove intra-cardiac tumor thrombus. a, b computed tomography showed right renal tumor and atrial tumor thrombus before preoperative chemotherapy. The tumor shrank after chemotherapy, but the intra-atrial tumor thrombus did not shrink significantly; c, d intra-atrial tumor thrombus was removed under cardiopulmonary bypass in the operation

fulltextpubmed· Body· item PMC6785647

tumor thrombus. a, b computed tomography showed right renal tumor and atrial tumor thrombus before preoperative chemotherapy. The tumor shrank after chemotherapy, but the intra-atrial tumor thrombus did not shrink significantly; c, d intra-atrial tumor thrombus was removed under cardiopulmonary bypass in the operation Results Among the 42 cases, 6 cases underwent radical nephrectomy and the removal of tumor thrombus without preoperative chemotherapy. Because these tumor thrombus just reached the entrance of the inferior vena cava or within the renal vein, the nephrectomy is not difficult to perform. 36 children underwent preoperative chemotherapy with vincristine and actinomycin D for 4–8 weeks. Among the 36 cases, 3 received preoperative radiotherapy. After preoperative chemotherapy, the length of tumor thrombus shrinked in 26 cases; the size of tumor decreased in 31 cases. Especially in ten cases at Daum stage IV (Table 1), the length of tumor thrombus in five cases shrinked obviously after preoperative chemotherapy, which were out of the atrium. All children underwent radical nephrectomy and the removal of tumor thrombus, including five cases accepting CPB. 36 cases had complete removal of tumor thrombus without macroscopic residue, and 6 cases underwent segmental removal due to severe adhesions with vascular wall, with a few residues. The longest embolism was 20 cm, which entered the right atrium along the inferior vena cava; and the shortest was 1 cm, which only reached the renal vein but did not enter the inferior vena cava. One case with intra-atrial tumor thrombus, thrombus was pulled out smoothly because of no obvious adhesions between the thrombus and the vessel wall (Fig. 2). The longest operation time was 8.2 hours, and the shortest was 2.1 hours, with an average of 3.7 hours. The most intraoperative bleeding was up to 800 mL. There was no inpatient death and no postoperative complication seen.Fig. 2 The patient (no. 4 in Table 1), male, was 3.6 years old, with left renal wilms tumor combined with atrial tumor thrombus. After preoperative chemotherapy, the tumor thrombus was significantly reduced to the atrial entrance. Preoperative ultrasound showed that there was blood flow between the thrombus and the atrial entrance or the vena cava wall.

fulltextpubmed· Body· item PMC6785647

1), male, was 3.6 years old, with left renal wilms tumor combined with atrial tumor thrombus. After preoperative chemotherapy, the tumor thrombus was significantly reduced to the atrial entrance. Preoperative ultrasound showed that there was blood flow between the thrombus and the atrial entrance or the vena cava wall. a, b during the nephrectomy, vena cava was opened carefully, tumor with the whole thrombus was completely dragged out and removed; c abdominal computed tomography showed left renal tumor and atrial tumor thrombus before preoperative chemotherapy; d specimen of the whole renal with tumor and thrombus removed by operation

fulltextpubmed· Body· item PMC6785647

a, b during the nephrectomy, vena cava was opened carefully, tumor with the whole thrombus was completely dragged out and removed; c abdominal computed tomography showed left renal tumor and atrial tumor thrombus before preoperative chemotherapy; d specimen of the whole renal with tumor and thrombus removed by operation All 42 children had the pathological type of Wilms tumor, including 18 (43%) cases of mixed type, 5 (12%) cases of mesenchymal type, 3 (7%) case of germ type, 1 (2%) case of anaplastic type, 1 (2%) case of epithelial type, and 14 (33%) cases due to necrosis after chemotherapy which could not be classified. The distribution of pathological classification and tumor thrombus stage was summarized (Table 2). Post peritoneal lymph node metastasis was confirmed in eight cases. According to NWTS-4 or NWTS-5 criteria, 20 cases were in stage II, 9 cases in stage III and 13 cases in stage IV. For stage II favorable histology (FH) Wilms tumor with a good prognosis, vincristine and actinomycin D were routinely used for 15 months (NWTS-5 used for 19 weeks). While for stage III or IV FH (or UH) Wilms tumor, adriamycin and/or cisplatin, cisplatin and/or etoposide or cyclophosphamide and/or doxorubicin were added. 22 patients received radiotherapy immediately (less than 10 days) after the operation. One patient received radiotherapy 2 years after the operation because of the recurrence of liver metastasis. 8 cases were lost to follow-up among these 42 children. Follow-up (mean follow-up time is 7.6 years) shows that 32 patients survived without tumors, out of which 20 were in clinical stage II, 8 in clinical stage III, 6 in stage IV. The longest survival time was 20 years and the shortest was 1 year. These patients included three cases with intracardiac tumor thrombus underwent excision by CPB extracorporeal circulation. two patients died of tumor recurrence. One of them had local recurrence of liver metastasis 2 years after the operation, which showed adhesions with liver during the operation and epithelial mesenchymal type was the main type, and survived with tumor until the third year after the operation. The other case with local recurrence and multiple post peritoneal lymph node metastasis died after operation 2.4 years.Table 2 Distribution of pathological classification and tumor thrombus stage in the group of children (n = 42)

fulltextpubmed· Body· item PMC6785647

type was the main type, and survived with tumor until the third year after the operation. The other case with local recurrence and multiple post peritoneal lymph node metastasis died after operation 2.4 years.Table 2 Distribution of pathological classification and tumor thrombus stage in the group of children (n = 42) Variables Mixed type Epithelial type Germ type Mesenchymal type Anaplastic type N Daum I 3 0 1 1 0 0 Daum II 11 1 1 2 0 6 Daum III 2 0 0 0 1 3 Daum IV 2 0 1 2 0 5 N necrotic tumor tissue which could not be classified after preoperative chemotherapy Due to the large span of time, eight patients are lost to follow-up. Because of this, survival analysis was not conducted. Discussion Wilms tumor with intravenous thrombus is uncommon clinically in children. Abdominal mass or abdominal circumference increase is the most common symptom of Wilms tumor. About 75–95% masses can be touched when patients first see a doctor [4]. Venous tumor thrombus is usually found concurrently when the diagnosis of Wilms tumors made. 6 of 165 children with venous tumor embolus had the corresponding manifestations such as hepatomegaly, ascites and varicose veins in the abdominal wall, accounting for only 3.6% [2]. According to the retrospective data of our hospital, only 2 patients in 42 ones was found to have varicose veins in chest and abdominal wall, accounting for 5%.

fulltextpubmed· Body· item PMC6785647

venous tumor embolus had the corresponding manifestations such as hepatomegaly, ascites and varicose veins in the abdominal wall, accounting for only 3.6% [2]. According to the retrospective data of our hospital, only 2 patients in 42 ones was found to have varicose veins in chest and abdominal wall, accounting for 5%. Ultrasonography has become the first choice for preliminary diagnosis of Wilms tumors and intravenous tumor thrombus for its radiationlessness, rapidity and non-invasiveness [5]. Ultrasonography has an accuracy of 60–100% in the diagnosis of tumor thrombus and can evaluate the degree of adhesions between the thrombus and vascular wall by venous blood flow. However, Khanna et al. reports that in the primary nephrectomy group, sensitivity of Doppler sonography for the detection of cavoatrial thrombus was 70.0%, lower than CT 84.6% [6]. In this study, one case with renal vein thrombus was found by enhanced CT examination, but the thrombus was found by ultrasound examination. Based on our experience, if vena cava is widened and enlarged or a low-density filling-defect is shown by CT, tumor thrombus may exist. Enhanced CT and magnetic resonance imaging are more sensitive, which can accurately diagnose the intravenous and intra-atrial tumor thrombus and can show the location, size of the thrombus and the relationship with the vascular wall. They are helpful to judging the timing of operation, the choice of the operation methods and the judgement whether the tumor thrombus can be pulled out completely. Although inferior vena cava angiography has a certain diagnostic value, there are risks of the tumor thrombus falling off and embolism when using this examination. Preoperative chest X-ray should be a routine examination and lung CT may be used to determine the presence or absence of metastasis if necessary.

fulltextpubmed· Body· item PMC6785647

ompletely. Although inferior vena cava angiography has a certain diagnostic value, there are risks of the tumor thrombus falling off and embolism when using this examination. Preoperative chest X-ray should be a routine examination and lung CT may be used to determine the presence or absence of metastasis if necessary. Intravenous thrombus caused by Wilms tumor, which exceed the level of hepatic vein, especially when the thrombus reaches the atrium or the primary tumors are too large to be completely excised, preoperative chemotherapy is recommended. It can reduce the size of tumor and thrombus, probability of tumor rupture during the operation and the usage rate of CPB, death rate and surgical complications are also reduced [7]. SIOP-9 (The International Society of Pediatric Oncology in Europe) study found that preoperative chemotherapy for 4 weeks and 8 weeks was equally effective in improving the prognosis of children [8]. In our hospital, we recommend preoperative chemotherapy with vincristine and actinomycin D for 4–8 weeks. The study of Shamberger et al. showed that during the operation, 61% of the patients who did not receive preoperative chemotherapy were found to have adhesions between the thrombus and the vessel wall, and the children receiving preoperative chemotherapy accounted for 44% [2]. In our study, 86% patients underwent preoperative chemotherapy. Most cases were sensitive to chemotherapy: 72% thrombus shrinked and 85% tumor decreased in preoperative chemotherapy cases. Especially in 10 cases with the atrium thrombus (Daum stage IV), thrombus in half of these cases shrinked out of the atrium (Table 1). Benefiting from preoperative chemotherapy, the using of CPB was reduced. Only five cases need CPB to remove atrium thrombus. Preoperative chemotherapy significantly reduced complications associated with CPB including infection, thrombus rupture, and bleeding. Interestingly, it is not both tumor and tumor thrombus being sensitive for chemotherapy in Daum stage IV patients. Only five cases of tumor and tumor thrombus decreased simultaneously. There are no relevant reports. We think that the reason may be the obvious adhesion between the atrial tumor thrombus and the blood vessel wall. Even if the tumor thrombus is sensitive to chemotherapy, its shrinkage may be limited, which needs to be further studied.

fulltextpubmed· Body· item PMC6785647

of tumor and tumor thrombus decreased simultaneously. There are no relevant reports. We think that the reason may be the obvious adhesion between the atrial tumor thrombus and the blood vessel wall. Even if the tumor thrombus is sensitive to chemotherapy, its shrinkage may be limited, which needs to be further studied. In this study, tumor thrombus was not sensitive to preoperative chemotherapy in ten patients, including five patients with Daum IV. The pathological type was: mesenchymal type (n = 3), epithelial type (n = 1), mixed type (n = 1) and necrotic tumor tissue (n = 5). Pathologically, solid mature type tumor tissues, such as mesenchymal type, epithelial type or fetal rhabdomyoma type Wilms tumors, were not sensitive to preoperative chemotherapy, compared with germinal type tumors. However, children with these pathological types usually have a good prognosis after surgery and postoperative chemotherapy and/or radiotherapy. However, NWTS researchers believed that preoperative chemotherapy for Wilms tumor may interfere with the histopathologic type, affect the detection rate of anaplasia, reduce the clinical stage, and may miss the diagnosis of bilateral Wilms tumor, and will thus affect the prognosis. It was found that for some children with Wilms tumor without lymph node metastasis, which were evaluated as stage II after the preoperative chemotherapy, the recurrence rate of tumor was higher than that those without preoperative chemotherapy [9].

fulltextpubmed· Body· item PMC6785647

diagnosis of bilateral Wilms tumor, and will thus affect the prognosis. It was found that for some children with Wilms tumor without lymph node metastasis, which were evaluated as stage II after the preoperative chemotherapy, the recurrence rate of tumor was higher than that those without preoperative chemotherapy [9]. Tumor and thrombus removal are the basis of surgical treatment in Wilms tumor with intravenous thrombus in children. For children with no shrinkage or progression of tumors after preoperative chemotherapy, surgery should be performed as soon as possible [10, 11]. The surgical strategy we recommended as follows: for Daum stage I–II tumor thrombus, the renal artery was ligated after exposure of the renal pedicle, and the vena cava was blocked by the vascular clamps at both ends of the tumor thrombus when exposed along the renal vein. The renal vein was cut off, and the tumor thrombus was pulled first. If the thrombus could have been removed completely, then the renal vein was ligated. For the tumor thrombus infiltrating and growing into the blood vessel wall, a T-shaped incision of the vena cava can be made to separate the tumor thrombus with a brain dissector to avoid injury to the vena cava as far as possible, and the common incision of the vena cava can be sutured in situ. For the thrombus at stage III–IV, especially stage IV, CPB should be used by cooperating with the cardiothoracic surgeon. The thrombus should be removed gently to avoid pulmonary embolism due to the breakup and shedding of the tumor [12]. In our study group, five children with intracardiac tumor thrombus were operated on under CPB with hypothermia. There was no hospital mortality and postoperative complication in the five patients. Follow-up showed that one child died as a result of liver metastases after operation 3.2 years. Chiappini et al. [13] reported that 13 patients who underwent deep hypothermic CPB for resection of intracardiac tumor thrombus had a hospital mortality rate of 0, with postoperative complications mainly including respiratory failure and hemorrhage. After a follow-up for 33.9 months, 8 (62%) patients survived. There is no evidence that the recurrence rate increases in patients with intra-operative remnant tumors in vessel wall. In our study group, six cases underwent segmental removal with a few residues due to severe adhesions with vascular wall. Among these six cases, tumor thrombus in five cases was not sensitive to preoperative chemotherapy.

fulltextpubmed· Body· item PMC6785647

that the recurrence rate increases in patients with intra-operative remnant tumors in vessel wall. In our study group, six cases underwent segmental removal with a few residues due to severe adhesions with vascular wall. Among these six cases, tumor thrombus in five cases was not sensitive to preoperative chemotherapy. Postoperative chemotherapy was continued, and no recurrence was observed during chemotherapy. However, follow-up show that 1 case died due to the recurrence of the tumor in situ and multiple post peritoneal lymph node metastasis after operation 2.4 years; four of the other five cases survived without tumor till now, and one case lost follow-up due to long time term. Pathological type of the group was shown as follows: 18 cases of mixed type, 5 cases of mesenchymal type, 3 case of germ type, 1 case of anaplastic type, 1 case of epithelial type, and 14 cases due to necrosis after chemotherapy which could not be classified. The largest number of pathological types was mixed types, and most were distributed in Daum stage II. One anaplastic type case belongs to Daum stage III, which died as a result of multiple post peritoneal lymph node metastasis as the article had mentioned. Because most of patients underwent preoperative chemotherapy, the pathology of 14 cases showed necrosis could not be classified. Three germ type cases were distributed in Daum stage I, II and IV, in which stage I and II were survived free of tumor till now, and the follow-up times are 6.2 and 3 years after operation, respectively. However, the stage IV patient was lost to follow-up.

fulltextpubmed· Body· item PMC6785647

pathology of 14 cases showed necrosis could not be classified. Three germ type cases were distributed in Daum stage I, II and IV, in which stage I and II were survived free of tumor till now, and the follow-up times are 6.2 and 3 years after operation, respectively. However, the stage IV patient was lost to follow-up. Appropriate radiotherapy and chemotherapy were delivered according to pathological classification and clinical stage after the operation. According to the latest NWTS staging, the patients who receive any biopsy before resection of the tumor, those undergoing debris resection including separate removal of the thrombus in the vein, resection margins microscopically or macroscopic incomplete excision as well as tumor rupture before or intra-operatively including spillage confined to the flank or diffuse peritoneal contamination by the tumor or where peritoneal implants are present, are classified as those at stage III and require postoperative radiotherapy [14]. NWTS-5 pointed out that patients in stage III with non-anaplastic histopathology, vincristine, actinomycin D and adriamycin supplemented by abdominal radiotherapy are the best postoperative treatment options. Even if the cumulative dosage of adriamycin reaches 150 mg per m2, the incidence of long-term cardiotoxicity is still low. Although the long-term complications of radiotherapy may seriously affect the quality of life of the children and even cause death, postoperative radiotherapy still plays an important role in improving the prognosis of children with a poor prognosis by pathological classification and who are in stage III–V [15]. A retrospective study of NWTS showed that radiotherapy within 10 days after operation was important for improving the prognosis. How to control the dosage of radiotherapy and reduce the radiotherapy-related complications and mortality while improving the survival rate still requires constant experience summary.

fulltextpubmed· Body· item PMC6785647

V [15]. A retrospective study of NWTS showed that radiotherapy within 10 days after operation was important for improving the prognosis. How to control the dosage of radiotherapy and reduce the radiotherapy-related complications and mortality while improving the survival rate still requires constant experience summary. NWTS-4 reported that the 2-year survival rate of children with Wilms tumor was 91%. There was no significant difference in 3-year survival rate between the patients with venous or intra-atrial tumor thrombus and those without tumor thrombus in the same pathological type and stage. The percent of patients with a good and poor prognosis were 90% and 41.7%, respectively, while the values of patients at stage II, III and IV were 100, 94.7 and 75.3%, respectively [2]. Because there is basically no difference in prognosis, it is more important to minimize the surgical complications and the long-term harm caused by chemotherapy and radiotherapy.

fulltextpubmed· Body· item PMC6785647

prognosis were 90% and 41.7%, respectively, while the values of patients at stage II, III and IV were 100, 94.7 and 75.3%, respectively [2]. Because there is basically no difference in prognosis, it is more important to minimize the surgical complications and the long-term harm caused by chemotherapy and radiotherapy. In conclusion, comprehensive sequential treatment should be adopted for children with Wilms tumor accompanied by intravenous tumor thrombus. Preoperative chemotherapy should be performed for those with a higher surgical risk from larger tumors and thrombus to reduce the difficulty and complications of operation. Surgical removal of the tumors and tumor thrombus is the key to a good prognosis. Postoperative radiotherapy plays an important role in improving the prognosis of children who are above clinical stage II (stage III–IV), and it should be added within 10 days after operation. Standardized comprehensive treatment may enable most portions of children to survive for a long time. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions SX and NS conceptualized and designed the study, acquired, analyzed and interpreted data, and drafted the initial manuscript. WPZ and CRH acquired, analyzed, coordinated and supervised data collection. HCS critically reviewed the manuscript. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work.

fulltextpubmed· Body· item PMC6785647

gned the study, acquired, analyzed and interpreted data, and drafted the initial manuscript. WPZ and CRH acquired, analyzed, coordinated and supervised data collection. HCS critically reviewed the manuscript. All authors approved the final manuscript as submitted and agree to be accountable for all aspects of the work. Funding This study was funded by The Beijing Hospital Authority “Dengfeng” Talent Training Plan (DFL20151102), and The Beijing Hospital Authority “Yangfan plan” Pediatric Urology (ZYLX201709). Compliance with ethical standards Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Conflict of interest No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6785654

Introduction Mumps is a common type of respiratory infectious disease caused by mumps virus (MuV) [1] characterized by swelling of the parotid gland. MuV can also lead to orchitis, deafness, sterile meningitis, and encephalitis [2]. There is still no effective treatment, specifically for mumps. The effective way to prevent mumps is vaccination. In China, live-attenuated S79MuV vaccine originated from Jeryl Lynn strain has been licensed for vaccination since 1990, and the measles–mumps–rubella virus (MMR) vaccine was introduced into the National Immunization program in 2008 for the control of measles, mumps, and rubella [3, 4]. Although high coverage with MMR, incidence of mumps remained high after the one-dose measles–mumps–rubella (MMR) vaccine in China [4–6]; much more efforts are needed to seek for improved MuV vaccine candidates with restricted replication, sufficient immunogenicity, and reduced reactogenicity.

fulltextpubmed· Body· item PMC6785654

mumps, and rubella [3, 4]. Although high coverage with MMR, incidence of mumps remained high after the one-dose measles–mumps–rubella (MMR) vaccine in China [4–6]; much more efforts are needed to seek for improved MuV vaccine candidates with restricted replication, sufficient immunogenicity, and reduced reactogenicity. MuV is an enveloped, non-segmented, negative-sense (NNS) RNA virus in the family Paramyxoviridae, subfamily Paramyxovirinae, genus Rubulavirus.  The MuV genome encoded seven transcription units: the nucleo (N), V/phospho/I (V/P/I), matrix (M), fusion (F), small hydrophobic (SH), hemagglutinin neuraminidase (HN), and large (L) protein genes [7–9]. Similar to other NNS RNA viruses, the ribonucleoprotein (RNP) complex is the minimal machinery for transcription and replication of MuV, which consists of the nucleocapsid (N)-RNA template tightly associated with the RNA-dependent RNA polymerase, the large (L) polymerase protein, and the phosphoprotein (P) [10]. The nucleocapsid (N)-RNA is the template for RNA synthesis, and only encapsidated, but not naked RNA, can be transcribed. RNA synthesis begins with the binding of the RNA-dependent RNA polymerase (RdRp), a complex of the P and L proteins, to the NP protein-gRNA [11–16]. Recently, using reverse genetics to derive attenuated derivatives of wild-type RNA virus strains or live-attenuated RNA virus vaccine strains, creation of safer and highly effective vaccine candidates for MuV is allowed as for other NNS RNA viruses [11, 13–17]. Plasmids that can express viral anti-genome RNA, viral NP, P, and L proteins under the control of the T7 RNA polymerase promoter are essential for the recovery of MuV. When recovery succeeds, cDNA-rescued MuV could be propagated in the same manner with parental virus. And the rescued virus is able to differentiate from parental virus by introducing mutations as gene tag in the virus genome [12, 18]. The reverse genetic system of MuV can facilitate the rational design of safer, more efficient mumps vaccine candidates.

fulltextpubmed· Body· item PMC6785654

ed MuV could be propagated in the same manner with parental virus. And the rescued virus is able to differentiate from parental virus by introducing mutations as gene tag in the virus genome [12, 18]. The reverse genetic system of MuV can facilitate the rational design of safer, more efficient mumps vaccine candidates. In this study, a novel, more efficient method was used to construct a full-length cDNA clone of MuV-S79 without the need for restriction endonucleases in the assembly process and rMuV-S79 was successfully recovered in BHK cells stably expressing T7 RNA polymerase. Our results showed that rMuV-S79 reached a high virus titer in vitro, and did not induce inflammation changes in lung tissues in cotton rats. Neutralizing antibody titers induced by rMuV-S79 were high, long-lasting and could provide complete protection against MuV wild strain challenge. Methods Cells and MuV BHK-SR19-T7 cells [19] (kindly provided by Apath, LLC, Brooklyn, NY) and Vero cells (ATCC) were cultured in DMEM (Life Technologies, USA) culture medium added with 10% fetal bovine serum (FBS, Life Technologies, USA). The S79 strain of MuV (kindly provided by Professor Yiyu Lu, Zhejiang CDC, China) was passaged in Vero cells, and wide-type MuV was isolated from patients in Children’s Hospital, Zhejiang University School of Medicine after obtaining the written informed consents from the parents.

fulltextpubmed· Body· item PMC6785654

e serum (FBS, Life Technologies, USA). The S79 strain of MuV (kindly provided by Professor Yiyu Lu, Zhejiang CDC, China) was passaged in Vero cells, and wide-type MuV was isolated from patients in Children’s Hospital, Zhejiang University School of Medicine after obtaining the written informed consents from the parents. Construction of MuV-S79 genomic plasmids Viral RNA of MuV-S79 extracted with a RNeasy mini-kit (Qiagen, Germany) was reverse-transcribed into cDNA with Super Script® III reverse transcriptase (Life Technologies, USA) according to the manufacturer’s instructions. MuV genome was amplified with five pairs of MuV-specific primers (Table 1) dividing the genome into five overlapping fragments was designed using Q5® High-Fidelity 2X Master Mix (NEB, USA) and the DNA fragment was inserted into the pEASY-Blunt vector plasmid (Transgen, CHINA) following the manufacturer’s instructions. Five resultant plasmids covering the full-length MuV-S79 genome (pEASY-MuV-NP-P, pEASY-MuV-M-F, pEASY-MuV-SH-HN, pEASY-MuV-L1, and pEASY-MuV-L2) were send for sequencing. The sequence of MuV-S79 in our lab was submitted to Genbank with accession FJ416067.Table 1 Primers sequences used for virus genome PCR Primers Sequence (5′–3′) MuV-NP-5endF ACCAAGGGGAAAATGAAGATG MuV-NP-R CTTGAGTCTGGTGCTTCTGGTG MuV-M-F-F CACCGAGGATGCTCTGAACGAC MuV-M-F-R TAAGGAGGGTTGGATTGCCG MuV-SH-HN-F CTAGGGTCGTAACGTCTC MuV-SH-HN-R TAAGAAATGAGACACGCC MuV-L1-F GAGTTGTAGTGAATGTAGTAGG MuV-L1-R GTATTCTATTACCGTATTCAGC MuV-L2-F AGACCACTGTCAGCAAAG MuV-L2-R ACCAAGGGGAGAAAGTAG

fulltextpubmed· Body· item PMC6785654

(5′–3′) MuV-NP-5endF ACCAAGGGGAAAATGAAGATG MuV-NP-R CTTGAGTCTGGTGCTTCTGGTG MuV-M-F-F CACCGAGGATGCTCTGAACGAC MuV-M-F-R TAAGGAGGGTTGGATTGCCG MuV-SH-HN-F CTAGGGTCGTAACGTCTC MuV-SH-HN-R TAAGAAATGAGACACGCC MuV-L1-F GAGTTGTAGTGAATGTAGTAGG MuV-L1-R GTATTCTATTACCGTATTCAGC MuV-L2-F AGACCACTGTCAGCAAAG MuV-L2-R ACCAAGGGGAGAAAGTAG Construction of the full-length cDNA clone of MuV-S79 and the supporting plasmids for MuV-S79 NP, P, and L proteins DNA fragment contained with MuV 3ʹ and 5ʹ non-coding termini (NCT) (3′–145 nt and 5′–169 nt, respectively), anti-genomic hepatitis delta virus (HDV) ribozyme sequence, the T7 promoter, and the T7 terminator were amplified with in-fusion PCR and then was cloned into the pYES-2 plasmid to generate with plasmid p145161-MuV (+) with the GeneArt™ Seamless Cloning and Assembly Kit (Invitrogen, USA; Fig. 1a). The sequences of primer and approaches utilized in the PCR assays are available in needed upon request. Two fragments containing the full length of p145161-MuV (+) was amplified with specific primers (F:5′-TTCTGCCGCCTGCTTCAAACCG-3′, R:5′- TTTCCAGGTAGTGTCAAAATG-3′; F:5′-ATCGAATAAAGACTCTTCTG-3′,R:5′-CAGAATGGGCAGACATTACGAATGC-3′). Five fragments containing the MuV-S79 genomic were amplified with specific primers from pEASY-MuV-NP-P, pEASY-MuV-M-F, pEASY-MuV-SH-HN, pEASY-MuV-L1, and pEASY-MuV-L2. Plasmid pYES-MuV (+), a full-length cDNA clone of MuV-S79, was successfully generated by assembling seven overlapping fragments with GeneArt™ High-Order Genetic Assembly System (Fig. 1b).Fig. 1 Schematic representation of the pYES-MV (+). Four fragments, T7 promoter, 3′ and 5′ non-coding termini (NCT), anti-genomic HDV ribozyme and T7 terminator, were introduced into pYES-2 through seamless assembly after several rounds of fusion PCR, resulting in p145161-MuV (+) (a). The full-length MuV genome consisted of five overlapping fragments was assembled into p145161-MuV (+), creating pYES-MuV (+) (b). A silent change (C to U) in HN gene that distinguishes rescued recombinant virus (marked by “*”) from the parental virus strain in our laboratory

fulltextpubmed· Body· item PMC6785654

usion PCR, resulting in p145161-MuV (+) (a). The full-length MuV genome consisted of five overlapping fragments was assembled into p145161-MuV (+), creating pYES-MuV (+) (b). A silent change (C to U) in HN gene that distinguishes rescued recombinant virus (marked by “*”) from the parental virus strain in our laboratory The strategy to construct the supporting plasmids of pT7-MuV-S79-NP, pT7- MuV-S79-P, and pT7-MuV-S79-L using “seamless” cloning had showed in the previous study [12, 20, 21]. The sequence of primers used in the PCR assays is available on request. Generation of infectious rMuV-S79 from transfected cells BHK-SR-19-T7 cells in 6-well plates with cell density of 90% confluence were transfected with 5 µg of pYES-MuV (+), 1.5 µg of pT7-MuV-S79-NP, 0.25 µg pT7-MuV-S79-P, and 2.5 µg pT7-MuV-S79-L [22–24]. At 6 hours post-infection (hpi), cell transfection mixture was discarded and cell was cultured with Opti-MEM. At 72 hours post-transfection, confluent cell monolayers were directly transferred onto Vero cell monolayers (P0) at 75% confluence and incubated at 37 °C for 2–4 days. Extensive CPE (MuV-induced syncytia) could be visualized under microscope if successes. Supernatants (P1) from Vero cells were further passaged on confluent Vero cell monolayers and incubated for 3–5 days, and the virus were verified with immunofluorescence assay using mouse anti-Mumps nucleoprotein (ab106292, abcam).

fulltextpubmed· Body· item PMC6785654

Extensive CPE (MuV-induced syncytia) could be visualized under microscope if successes. Supernatants (P1) from Vero cells were further passaged on confluent Vero cell monolayers and incubated for 3–5 days, and the virus were verified with immunofluorescence assay using mouse anti-Mumps nucleoprotein (ab106292, abcam). Confirmation of sequences by RT-PCR All the plasmids, viral stocks were sequenced. A 0.71 kb DNA region of the HN protein gene containing the gene tag was amplified by a one-step RT-PCR kit (Qiagen, Germany) using primers MuV-HN-7634-Forward (5′-GAGAATTTTTCCGGCCCGTT-3′) and MuV-L-8342-Reverse (5′-CAAGTGATGGTCAATCTGGC-3′). The amplified products were analyzed on 1% agarose gel and sequenced. Viral replication kinetics in Vero cells Confluent Vero cells were grown in 6-well plates and then were inoculated with MuV at a multiplicity of infection (MOI) of 0.01, 0.1, and 1. After virus absorption for 1 h, the cells were washed three times with PBS. Infected cells were incubated at 37 °C incubator and then the cells were subjected to three freeze–thaw cycles, and the supernatant of MuV was harvested by centrifugation at 3000×g in an Eppendorf 5804R centrifuge for 10 min. Virus titers were detected in Vero cells using plaque assay according to our previous study [20].

fulltextpubmed· Body· item PMC6785654

ected cells were incubated at 37 °C incubator and then the cells were subjected to three freeze–thaw cycles, and the supernatant of MuV was harvested by centrifugation at 3000×g in an Eppendorf 5804R centrifuge for 10 min. Virus titers were detected in Vero cells using plaque assay according to our previous study [20]. Replication of rMuV-S79 in cotton rats Ten 4–6-week-old female specific-pathogen-free (SPF) cotton rats (kindly provided by Professor Enmei Liu from Children's hospital of Chongqing medical university) were randomly divided into two groups (each group with five cotton rats). Cotton rats of each group were inoculated with rMuV-S79, and Opti-MEM respectively. Each cotton rat was inoculated intranasally with 1 × 106 PFU of virus in a volume of 100 μl. At 4 dpi, cotton rats were sacrificed and lungs were collected for virus titration and did pulmonary histopathology.

fulltextpubmed· Body· item PMC6785654

up with five cotton rats). Cotton rats of each group were inoculated with rMuV-S79, and Opti-MEM respectively. Each cotton rat was inoculated intranasally with 1 × 106 PFU of virus in a volume of 100 μl. At 4 dpi, cotton rats were sacrificed and lungs were collected for virus titration and did pulmonary histopathology. Immunogenicity of rMuV-S79 in cotton rats Cotton rats (kindly provided by Professor Enmei Liu from Children's Hospital of Chongqing Medical University) between 4 and 6 weeks of age were divided into two groups, infected with rMuV-S79 (five cotton rats) and Opti-MEM (five cotton rats), respectively. The rats were anesthetized and vaccinated with viruses intranasally. Blood samples were obtained by retro-orbital puncture after anesthetized at week 3, week 4, week 5, week 7, and week 9 after vaccination. Serum neutralization of virus was detected using an endpoint dilution plaque reduction assay. At 4 week post-immunization, the cotton rats were challenged with 1.0 × 107 PFU of wild-type MuV and the presence of any clinical symptoms were evaluated twice daily. At 4 day post-challenge, all cotton rats were sacrificed and their lungs were collected for virus titration. Statistical analysis Statistical analysis was analyzed by one-way multiple comparisons utilizing Prism, version 8.0, statistical analysis software. P value of < 0.05 was considered statistically significant.

fulltextpubmed· Body· item PMC6785654

Immunogenicity of rMuV-S79 in cotton rats Cotton rats (kindly provided by Professor Enmei Liu from Children's Hospital of Chongqing Medical University) between 4 and 6 weeks of age were divided into two groups, infected with rMuV-S79 (five cotton rats) and Opti-MEM (five cotton rats), respectively. The rats were anesthetized and vaccinated with viruses intranasally. Blood samples were obtained by retro-orbital puncture after anesthetized at week 3, week 4, week 5, week 7, and week 9 after vaccination. Serum neutralization of virus was detected using an endpoint dilution plaque reduction assay. At 4 week post-immunization, the cotton rats were challenged with 1.0 × 107 PFU of wild-type MuV and the presence of any clinical symptoms were evaluated twice daily. At 4 day post-challenge, all cotton rats were sacrificed and their lungs were collected for virus titration. Statistical analysis Statistical analysis was analyzed by one-way multiple comparisons utilizing Prism, version 8.0, statistical analysis software. P value of < 0.05 was considered statistically significant. Results Recovery of rMuV-S79 from a full-length cDNA clone pYES-MuV (+), a MuV-S79 cDNA clone, was successfully established with the GeneArt™ High-Order Genetic Assembly System [25]. Figure 1 illustrates a schematic representation of the full-length plasmid pYES-MuV (+) which under the control of a T7 RNA polymerase promoter, hepatitis delta virus (HDV) ribozyme sequence, and T7 terminators [25]. BHK-SR-19-T7 cells stably expressing T7 RNA polymerase were transfected with pYES-MuV (+), pT7-S79-NP, pT7-S79-P, and pT7-S79-L to rescue infectious MuV from cDNA. On day 3 post-transfection, the cell monolayers were harvested and directly transferred onto Vero cell monolayers at 70–80% confluence. MuV-induced syncytia was observed 2–3 days afterwards (Fig. 2a).Fig. 2 pYES-MuV (+) plasmid and helper plasmids pT7-S79-NP, pT7-S79-P, and pT7-S79-L were transfected into BHK-SR19-T7 cells. Transfected BHK-T7 cells were co-cultured with Vero cells on day 3. CPE was observed after 48 h of coculture (a). The rescued virus supernatant (P1) were further passaged onto Vero cells, and incubated for 24 h (b). The successful recovery of rMuV-S79 was further confirmed by detection of NP protein expression in Vero cells infected with the rescued rMuV-S79 by immunofluorescence assay (c). Vero cells on 6-well cell culture cluster were infected with viruses at MOI of 1, 0.1, and 0.01, and collected at different time points (24 h, 48 h, 72 h and 96 h). After three freeze–thaw cycles, virus titers were determined by plaque assay in Vero cells. Virus growth curves are shown d

fulltextpubmed· Body· item PMC6785654

y immunofluorescence assay (c). Vero cells on 6-well cell culture cluster were infected with viruses at MOI of 1, 0.1, and 0.01, and collected at different time points (24 h, 48 h, 72 h and 96 h). After three freeze–thaw cycles, virus titers were determined by plaque assay in Vero cells. Virus growth curves are shown d Identification of rMuV-S79 To confirm the rescued rMuV-S79, we detected the expression of NP protein on Vero cells which were infected with the rescued rMuV-S79 in 24-well plates by immunofluorescence assay (Fig. 2c). Gene tag represented silent changes at nucleotide (nt) position 8134 (C to T) which in HN gene introduced in pYES-MuV (+). To verify that the rMuV-S79 was derived from cDNA but not cross-contamination from the MuV-S79 parental strain grown in our laboratory, the regions spanning the nucleotide tag were amplified by RT-PCR and sent for sequencing. Sequence results of RT-PCR products showed that the recovered virus was from pYES-MuV (+). Viral replication kinetics of rMuV-S79 in Vero cell Replication kinetics of rMuV-S79 in Vero cells was confirmed. As demonstrated in Fig. 2d, rMuV-S79 infected Vero cells at MOI of 0.01, 0.1, and 1. At MOI of 0.1 and 1, the virus titers of rMuV-S79 reached the highest level 48 h post-infection (hpi) in Vero cells, and the virus titers reached the highest level at 72 hpi at MOI of 0.01.

fulltextpubmed· Body· item PMC6785654

tics of rMuV-S79 in Vero cells was confirmed. As demonstrated in Fig. 2d, rMuV-S79 infected Vero cells at MOI of 0.01, 0.1, and 1. At MOI of 0.1 and 1, the virus titers of rMuV-S79 reached the highest level 48 h post-infection (hpi) in Vero cells, and the virus titers reached the highest level at 72 hpi at MOI of 0.01. Safety of rMuV-S79 in cotton rats To evaluate the virus replication of rMuV-S79 in vivo, specific pathogen-free cotton rats were divided into two groups vaccinated with rMuV-S79 and Opti-MEM, respectively. No clinical symptoms of respiratory tract infection appeared in cotton rats inoculated with any of the rMuVs. Four days after inoculation, cotton rats were sacrificed to extract left lung tissues for detecting the viral titer (Table 2). The average viral titer of rMuV-S79 in lung tissues was 2.68 ± 0.14 log10PFU/g (Table 2).Table 2 Replication of rMuV-S79 in the cotton rats Groups Viral replication in lung % infected animals Viral titer (log10 PFU/g) rMuV-S79 100 2.68 ± 0.14 Opti-MEM 0 Not detected Five cotton rats were inoculated with rMuV-S79 via intranasal route. Five cotton rats in control group were received the same volume of Opti-MEM without virus. Two groups of cotton rats were terminated at 4th day post-inoculation and viral titers in lung tissues were determined by plaque assay

fulltextpubmed· Body· item PMC6785654

4 Opti-MEM 0 Not detected Five cotton rats were inoculated with rMuV-S79 via intranasal route. Five cotton rats in control group were received the same volume of Opti-MEM without virus. Two groups of cotton rats were terminated at 4th day post-inoculation and viral titers in lung tissues were determined by plaque assay Histological examinations of lung tissues obtained from cotton rats 4 days after vaccination were performed. Histological sections of lung tissues after hematoxylin and eosin staining (HE staining) are shown in Fig. 3a. There was no significant morphological difference between the rMuV-S79 and Opti-MEM groups. Lung tissues of the rMuV-S79 group did not show signs of inflammation in comparison with the control group.Fig. 3 Cotton rats were grouped infected with 106 PFU of rMuV-S79. Five cotton rats were inoculated Opti-MEM as control group. Histological examination was conducted by HE staining of lung tissues from vaccination group (a) and control group (b) at 4th day post-inoculation. Sera were obtained at 3–5, 7, and 9 weeks after immunization to detect neutralization anti-MuV antibodies. The antibodies titers at each time point quantified by 50% plaque reduction assay are calculated and shown as mean NT titers (c) These results indicated that the rMuV-S79 recovered was safe in vivo.

fulltextpubmed· Body· item PMC6785654

Histological examinations of lung tissues obtained from cotton rats 4 days after vaccination were performed. Histological sections of lung tissues after hematoxylin and eosin staining (HE staining) are shown in Fig. 3a. There was no significant morphological difference between the rMuV-S79 and Opti-MEM groups. Lung tissues of the rMuV-S79 group did not show signs of inflammation in comparison with the control group.Fig. 3 Cotton rats were grouped infected with 106 PFU of rMuV-S79. Five cotton rats were inoculated Opti-MEM as control group. Histological examination was conducted by HE staining of lung tissues from vaccination group (a) and control group (b) at 4th day post-inoculation. Sera were obtained at 3–5, 7, and 9 weeks after immunization to detect neutralization anti-MuV antibodies. The antibodies titers at each time point quantified by 50% plaque reduction assay are calculated and shown as mean NT titers (c) These results indicated that the rMuV-S79 recovered was safe in vivo. Vaccine immunogenicity of rMuV-S79 Cotton rats (4–6 weeks old) (five animals per group) were inoculated with rMuV-S79 via the intranasal route, and the control group received the same volume of Opti-MEM (Table 3). The serum samples were collected at weeks 3, 5, 7, and 9 after immunization for analyzing the immunogenicity of rMuV-S79. To examine the neutralizing antibody titers against MuV, the neutralization test (NTs) was conducted with the 50% plaque reduction assay. Our results demonstrated that neutralizing antibody titers induced by rMuV-S79 peaked at week 5 with a titer of 7.92 log2 neutralizing antibody titer and lasted a long time. The neutralizing antibodies could provide complete protection against MuV wild strain challenge (Fig. 3b). At week 9 post-vaccination, cotton rats were inoculated with 1.0 × 107 PFU of wild-type MuV and all cotton rats were sacrificed at day 4 post-challenge. No infectious virus was detected in the lung tissue in the rMuV-S79 vaccinated cotton rats; however, an average titer of 3.35 ± 0.26 log10 PFU/g was detected in lung tissue from uninoculated but challenged controls (Table 4).Table 3 Cotton rats were grouped to test neutralizing anti-MuV antibodies in serum

fulltextpubmed· Body· item PMC6785654

t-challenge. No infectious virus was detected in the lung tissue in the rMuV-S79 vaccinated cotton rats; however, an average titer of 3.35 ± 0.26 log10 PFU/g was detected in lung tissue from uninoculated but challenged controls (Table 4).Table 3 Cotton rats were grouped to test neutralizing anti-MuV antibodies in serum Groups (5 per group) Route Vaccine Dose (PFU/ml) rMuV-S79 I.N. rMuV-S79 1 × 106 Control I.N. Opti-MEM Opti-MEM only I.N. intranasal Table 4 Immunogenicity of rMuV-S79 in cotton rats Groups Viral replication in lung % infected animals Viral titer (log10 PFU/g) rMuV-S79 0 Not detectedA Opti-MEM 100 3.35 ± 0.26B Five cotton rats in vaccination group were intranasally inoculated with 1.0 × 106 PFU and the blanket control group was received Opti-MEM of the same volume. Both groups of cotton rats were challenged with 1 × 107 PFU of wild-type MuV after 9 week post-infection and sacrificed at day 4 post-challenge to collect lung tissues for virus titration assay and RT-PCR Values within a column followed by different capital letters (A and B) are significantly different Discussion Symptoms caused by MuV are normally mild, short-living and disappear without sequelae. However, serious complications like sensorineural or encephalitis deafness may occur. Mumps still occur in people who previously had one or two doses of MMR vaccine, driving us to develop a safer and more efficacious vaccine. Efficient reverse genetic system of negative-strand RNA viruses has provided a new approach for the study of virus growth, and has been used in the prevention and treatment of disease.

fulltextpubmed· Body· item PMC6785654

s still occur in people who previously had one or two doses of MMR vaccine, driving us to develop a safer and more efficacious vaccine. Efficient reverse genetic system of negative-strand RNA viruses has provided a new approach for the study of virus growth, and has been used in the prevention and treatment of disease. In the early studies, the common strategy applied to construct full-length cDNA of MuV, measles virus was stepwise cloning using restriction enzyme. In this research, full-length cDNA clone of MuV-S79 was constructed using a novel plasmid assemble strategy which restriction and ligation were not needed for generating plasmid in the assembly process by using a GeneArt™ High-Order Genetic Assembly System. Based on this novel assembly system, full-length genomic clone of measles virus has been generated in our previous research [20].

fulltextpubmed· Body· item PMC6785654

using a novel plasmid assemble strategy which restriction and ligation were not needed for generating plasmid in the assembly process by using a GeneArt™ High-Order Genetic Assembly System. Based on this novel assembly system, full-length genomic clone of measles virus has been generated in our previous research [20]. In the past, common strategies to rescue MuV using reverse genetic systems were based on the vaccinia helper viruses which could express T7 RNA polymerase [12]. However, it is difficult to separate the rescued MuV from the helper viruses. Stably-transfected BHK cells expressing T7 RNA polymerase have been used to rescue bovine respiratory syncytial virus, hMPV and measles virus [19, 26]. In this study, BHK-SR-19-T7 cells were co-transfected with a plasmid expressing cDNA genome of MuV and supporting plasmids expressing the MuV NP, P, and L proteins. The success of this efficient recovery process lies in vaccinia virus-freeness. The rescued viruses generated from this process were passaged for fewer times than biologically derived virus with reducing possibility of adventitious contamination. Replication kinetics, safety, and immunogenicity of rMuV-S79 were confirmed both in vitro and in vivo. We found that rMuV-S79 were well replicated in Vero cell and did not induce inflammation changes in lung tissues in cotton rats. Our results showed that vaccination with rMuV-S79 could provide complete protection against MuV wild strain challenge.

fulltextpubmed· Body· item PMC6785654

and immunogenicity of rMuV-S79 were confirmed both in vitro and in vivo. We found that rMuV-S79 were well replicated in Vero cell and did not induce inflammation changes in lung tissues in cotton rats. Our results showed that vaccination with rMuV-S79 could provide complete protection against MuV wild strain challenge. Reverse genetics systems are helpful for virus research and can provide vaccine candidates. With a robust reverse genetic system, virus can be engineered with mutations, insertions, and deletions. In this study, an efficient reverse genetic system of MuV-S79 was generated, providing the potential to engineer the virus genome to express foreign genes, as described for measles viruses [27, 28]. Novel recombinant MuV vaccine candidates expressing foreign gene at different loci of the MuV-S79 genome could be constructed in future study based on this efficient reverse genetic system. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions Conceived and designed the experiments: ZYZ and YLW. Performed the experiments: DZ, MYZ, YLW, RXL, XQH, CDZ, CFQ and DMZ. Analyzed the data: DZ, YLW, DMZ, ZYZ. Wrote the manuscript: DZ, YLW, MYZ and ZYZ, and all other co-authors edited the manuscript. All authors approved the final manuscript as submitted and agreed to be accountable for all aspects of the work. DZ and MYZ contributed equally to this paper. Funding This work was supported partly by the Natural Science Foundation for Young Scholars of Zhejiang Province (LQ19H100005).

fulltextpubmed· Body· item PMC6785654

Author contributions Conceived and designed the experiments: ZYZ and YLW. Performed the experiments: DZ, MYZ, YLW, RXL, XQH, CDZ, CFQ and DMZ. Analyzed the data: DZ, YLW, DMZ, ZYZ. Wrote the manuscript: DZ, YLW, MYZ and ZYZ, and all other co-authors edited the manuscript. All authors approved the final manuscript as submitted and agreed to be accountable for all aspects of the work. DZ and MYZ contributed equally to this paper. Funding This work was supported partly by the Natural Science Foundation for Young Scholars of Zhejiang Province (LQ19H100005). Compliance with ethical standards Ethical approval This study was approved by the Ethical Committee of Children's Hospital, Zhejiang University School of Medicine (No. 2013119). All animal procedures conformed to the Guide for the Care and Use of Laboratory Animals, and were approved by the Zhejiang University Medical Laboratory Animal Care and Use Committee. Conflict of interest The authors have no financial relationships relevant to this article to disclose.

fulltextpubmed· Body· item PMC7040062

Introduction Systemic lupus erythematosis (SLE) is a chronic autoimmune disease characterized by the production of autoantibodies and the deposition of immune complexes, affecting a wide range of organs. Genetic factors, environmental factors and hormonal factors are believed to contribute to the occurrence of SLE. However, the pathogenesis of SLE is complex and remains unknown. Breakdown of self-tolerance plays a critical role in the occurrence and development of SLE. Innate and adaptive immune responses against self-antigen induce the production of autoantibodies and the deposition of immune complexes in tissues leads to the activation of complement, accumulation of neutrophils and monocytes, and self-reactive lymphocytes [1]. Despite the improvement in the survival of SLE in the past decades, further improvement in the disease prognosis is hampered by organ damage caused by disease itself and adverse events related to conventional therapies. The in-depth study of disease pathogenesis is helpful to find new therapeutic targets and new biomarkers of SLE. In this review, we summarized recent advances in immunological pathogenesis and related targeting treatment of SLE.

fulltextpubmed· Body· item PMC7040062

organ damage caused by disease itself and adverse events related to conventional therapies. The in-depth study of disease pathogenesis is helpful to find new therapeutic targets and new biomarkers of SLE. In this review, we summarized recent advances in immunological pathogenesis and related targeting treatment of SLE. Dysregulation of innate immunity Dendritic cells (DCs) Type I interferon (IFN) in SLE Recent studies have found a close relationship between type I IFN and SLE [2, 3], especially IFN-α. In more than half of SLE patients, gene expression of the “IFN-α signature” was found in peripheral blood mononuclear cells [4, 5]. IFN-α can activate lymphocyte, DCs and natural killer (NK) cells, thus breaking the autoimmune tolerance. In the case of infection, the dsRNA/ssRNA or dsDNA of virus/bacteria served as exogenous type I IFN attractant to activate the nuclear factor-κB (NF-κB) pathway and then produce IFN-α, which stimulates the immune system to produce autoantibody forms B cells to the nuclear antigen components of apoptotic cells [6]. Proper clearance of apoptotic cells is thought to prevent exposure of self-antigens and inhibit the activation of immune cells. In SLE, however, the rate of apoptosis increased or clearance is suboptimal, leading to an increase in autoantigen–antibody complexes, which have been proved to be endogenous type I IFN inducing agents, and can continue to produce type I IFN, forming a vicious cycle. In addition, IFN-α can promote the activation of T helper (Th) cells, improve the ability of antigen presentation of DCs, and subsequently induce the production of such cytokines as interleukin (IL)-1, IL-2, IL-4, IL-6 and IL-8. It also can affect the expression of mitochondrial genes, change the activity of adenosine triphosphate sensitive K channels, and cause various energy metabolism disorders.

fulltextpubmed· Body· item PMC7040062

ability of antigen presentation of DCs, and subsequently induce the production of such cytokines as interleukin (IL)-1, IL-2, IL-4, IL-6 and IL-8. It also can affect the expression of mitochondrial genes, change the activity of adenosine triphosphate sensitive K channels, and cause various energy metabolism disorders. Interaction between pattern recognition receptors (PRRs) and DCs DCs, as antigen presenting cells, can activate primitive T cells and stimulate the proliferation and differentiation of B cells, playing a role in the innate immune system and in the activation of the adaptive response. In SLE patients, IFN-α can promote the transformation of monocytes into DCs, while DCs recognize antigens and continuously produce IFN-α, which in turn circulates and drives the autoimmune response of SLE.

fulltextpubmed· Body· item PMC7040062

erentiation of B cells, playing a role in the innate immune system and in the activation of the adaptive response. In SLE patients, IFN-α can promote the transformation of monocytes into DCs, while DCs recognize antigens and continuously produce IFN-α, which in turn circulates and drives the autoimmune response of SLE. The presence of dying cells in lymph nodes and various tissues is a common feature of SLE [7, 8]. Apoptotic cells are removed suboptimally and exposed for prolonged periods of time to form autoantigens, contributing to break the immune tolerance. In the innate immune system, PRRs recognize the apoptotic cell debris or damaged cells and then activate the immune cells. At present, there are at least three distinct types of PRRs: the toll-like receptors (TLRs), the nucleotide binding and oligomerization domain receptors (NLRs), and the retinoid acid inducible gene-I-like receptors (RLRs). TLR plays a key role in the innate immune system. In mouse models, production of antinuclear antibodies depends on endosomal TLRs, which bind dsDNA or ssRNA [9–11]. In SLE patients, TLR9 ligand (such as CpG) can activate plasma cell-like DCs (pDCs) through the interferon regulatory factor (IRF) signaling pathway, producing a large amount of type I IFN (Fig. 1). In addition, the activation of pDCs by TLR7 ligand resulted in increased expression of IL-1β and IL-23, and promoted the differentiation of Th17 (Fig. 1). Furthermore, TLR ligand can also activate B cells and produce autoantibodies to form immune complexes containing ribonucleic proteins and nucleosomes. DCs can identify immune complexes containing chromatin through the surface receptor, FcγIIa, and promote nucleic acid endocytosis, thereby maintain and amplify the immune response. After NLR ligand activates keratinocytes and DCs, different forms of inflammatory ligands are formed and combined with corresponding inflammasomes, such as NAcht leucine-rich-repeat protein/absent in melanoma 2. Then, caspase-1 and caspase-5 are activated, respectively, to promote the production of IL-1β and IL-18. Moreover, incompletely digested DNA existed in mice and humans aggravates the disease by increasing IFN-stimulatory DNA responses (Fig. 1).Fig. 1 Pattern recognition receptors play a vital role in the innate immunity in lupus.

fulltextpubmed· Body· item PMC7040062

se-1 and caspase-5 are activated, respectively, to promote the production of IL-1β and IL-18. Moreover, incompletely digested DNA existed in mice and humans aggravates the disease by increasing IFN-stimulatory DNA responses (Fig. 1).Fig. 1 Pattern recognition receptors play a vital role in the innate immunity in lupus. PRRs pattern recognition receptors, NLR nucleotide binding and oligomerization domain receptors, TLR toll-like receptor, RLR retinoid acid inducible gene-I-like receptors, DC dendritic cell, BCR B-cell receptor, FcR fragment crystallizable receptor, NALP1 NAcht leucine-rich-repeat protein 1, AIM2 absent in melanoma 2, ASC apoptotic speck-like protein containing a caspase recruitment domain, IFN interferon, IL interleukin Neutrophils Neutrophils, critical components of innate immune system, are involved in inflammatory and infectious processes. Improper activation of neutrophils will release protease, tissue damage factors and reactive oxygen species, leading to tissue damage in SLE. Meanwhile, activated neutrophils can release a large number of cytokines and chemokines, leading to immune regulation disorders [12].

fulltextpubmed· Body· item PMC7040062

ed in inflammatory and infectious processes. Improper activation of neutrophils will release protease, tissue damage factors and reactive oxygen species, leading to tissue damage in SLE. Meanwhile, activated neutrophils can release a large number of cytokines and chemokines, leading to immune regulation disorders [12]. In recent years, neutrophils have been found to be involved in autoimmune disease with a new structure: neutrophils extracellular traps (NETs). NETs are fibrous networks assembled from nuclear and granula components which protrude from the membrane of neutrophils that are activated. NETs also contain calprotectin, matrix metalloproteinase 9, lysosomal membrane protein-2. NETosis is the forming progress of NETs. Studies showed that autoantibodies in vasculitis and SLE are components of NETs. Furthermore, NETs are also involved in the sepsis-associated organ damage [13, 14]. The suboptimal clearance of NETs and/or excessive NETs formation is involved in the pathogenesis of SLE [15]. Previous studies revealed that NETs formation and imbalance of NET degradation externalize autoantigens, which induce type I IFN synthesis and endothelial damage [16, 17]. NET-related histones trigger innate immunity by activating TLRs and the NLR-pyrin domain containing (NLRP3) inflammasome. NETs also activate caspase-1, the enzyme of the inflammasome, leading to the release of active IL-1β and IL-18 [18]. Furthermore, NETs combine with complement 1q to activate the classic pathway of complement, consuming a large amount of complement, while activated complements can inhibit the degradation of NETs and aggravate the autoimmunity. A part of lupus glomerulonephritis can be observed to have local NETs formation, and NET-related histone release elicits cytotoxic and immunosimulatory effects [19]. The suboptimal clearance of SLE is associated with disease activity, which is believed to be the result of activation of germinal center B cells [20]. A recent study has found that NETs contain ubiquitinated proteins, one of the translated modified proteins, which can involve in autoimmunity. Specifically, K63 ubiquitination is involved in DNA repair, signaling through NF-κB and endosomal traffic regulation, all of which are related to the modulation of immune responses [21]. In fact, there is a decrease in ubiquitination in NETs from subjects with SLE patients and, in the case of NETosis, it leads to more serious oxidative damage [22].

fulltextpubmed· Body· item PMC7040062

on is involved in DNA repair, signaling through NF-κB and endosomal traffic regulation, all of which are related to the modulation of immune responses [21]. In fact, there is a decrease in ubiquitination in NETs from subjects with SLE patients and, in the case of NETosis, it leads to more serious oxidative damage [22]. Dysregulation of adaptive immunity T cells Breakdown of immune tolerance is critical in the development of SLE and T cells play an important role in this process. In addition to showing abnormal cytokine secretion and cell signal transduction, it can also lead to inappropriate recruitment and activation of B cells and DCs in inflammatory sites [23].

fulltextpubmed· Body· item PMC7040062

ity T cells Breakdown of immune tolerance is critical in the development of SLE and T cells play an important role in this process. In addition to showing abnormal cytokine secretion and cell signal transduction, it can also lead to inappropriate recruitment and activation of B cells and DCs in inflammatory sites [23]. T-cell signaling alteration T-cell receptor (TCR)-CD3 signaling pathway CD3 is a marker expressed on the surface of mature T cells, which forms the TCR-CD3 complex in a non-covalent bond with TCR, and participates in the immune response to antigen stimulation. CD3ζ is the main signaling molecule in the TCR-CD3, which contains immunoreceptor tyrosine-based activation motif (ITAM) domains. Lck, the Src kinase lymphocyte-specific protein tyrosine kinase, phosphorylates ITAMs of CD3ζ following TCR recognition and engagement of the MHC-antigen complex. Phosphorylated CD3 ITAMs recruit the ζ-associated protein kinase 70 (ZAP-70); Lck phosphorylates and activates ZAP-70, resulting in calcium influx into T cells [24]. In SLE, the expression of CD3ζ chain was significantly decreased, leading to the recompilation of TCR complex, and CD3ζ was replaced by the homologous Fc receptor common gamma subunit chain (FcRγ) [25]. FcRγ recruits the spleen tyrosine kinase, resulting in the higher calcium influx into T cells. Heightened calcium responses lead to increased activation of calcineurin. Calcineurin dephosphorylates inactive cytoplasmic nuclear factor of activated T cells (NFAT) and dephosphorylated NFAT translocates to the nucleus. Therefore, promoter of CD40L gene as well as T cells become more easily to be activated. On the other hand, activated calmodulin kinase IV increases the expression of intronuclear cAMP responsive element modulator α and inhibits the production of IL-2. Lck localizes to lipid rafts, while accumulation of lipid rafts can aggravate the condition of the lupus mouse in previous studies [26]. Further research shows that T cells isolated from SLE patients have higher levels of ganglioside M1 and cholesterol, a component of the lipid raft domain, which confirmed that lipid rafts play an important role in the pathogenesis of SLE (Fig. 2).Fig. 2 T-cell signaling alteration in systemic lupus erythematosus (SLE).

fulltextpubmed· Body· item PMC7040062

Further research shows that T cells isolated from SLE patients have higher levels of ganglioside M1 and cholesterol, a component of the lipid raft domain, which confirmed that lipid rafts play an important role in the pathogenesis of SLE (Fig. 2).Fig. 2 T-cell signaling alteration in systemic lupus erythematosus (SLE). TCR T cell receptor, Lck lymphocyte-specific protein tyrosine kinase, ZAP-70 zeta-chain-associated protein kinase 70, FcRγ Fc receptor common gamma subunit chain, Syk Spleen tyrosine kinase, NFAT nuclear factor of activated T cells, CaMKIV activated calmodulin kinase IV, CREM cAMP responsive element modulator, IL interleukin, PIP2 phosphatidylinositol-4, 5-bisphosphate, PIP3 phosphatidylinositol-3, 4, 5-triphosphate, PI3K phosphoinositide-3 kinase, Akt protein kinase B, mTORC mammalian target of rapamycin complex, ERM ezrin/radixin/moesin, ROCK Rho-associated protein kinase

fulltextpubmed· Body· item PMC7040062

kinase IV, CREM cAMP responsive element modulator, IL interleukin, PIP2 phosphatidylinositol-4, 5-bisphosphate, PIP3 phosphatidylinositol-3, 4, 5-triphosphate, PI3K phosphoinositide-3 kinase, Akt protein kinase B, mTORC mammalian target of rapamycin complex, ERM ezrin/radixin/moesin, ROCK Rho-associated protein kinase CD44–Rock–ERM signaling pathway CD44 is a cell surface molecule involved in T cell activation and adhesion. Enhanced expression of CD44 was found in SLE patients of which splicing variants CD44V3 and CD44V6 were correlated with disease activity [27–29]. The role of CD44 in adhesion and migration requires interaction with the ezrin/radixin/moesin (ERM) proteins. Rho-associated protein kinase (ROCK) is a serine/threonine kinase that phosphorylates the ERM protein. In patients with SLE, the phosphorylation level of ERM protein increased, and T-cell adhesion and migration were enhanced in patients with SLE. In addition, ROCK can also activate IRF4, affect the differentiation of Th17 and control the production of IL-17 and IL-21 [30]. PI3K-Akt-mTOR signaling pathway Phosphoinositide-3 kinase (PI3K) is a member of the lipid downstreams kinase family. At present, class I PI3K is the most studied one. It can be activated by G protein coupled receptor and receptor tyrosine kinase. Akt is an important target kinase downstreamed PI3K. The mammalian target of rapamycin (mTOR) is a central regulator integrating nutritional information, and mTOR signal activation increases protein synthesis.

fulltextpubmed· Body· item PMC7040062

PI3K is the most studied one. It can be activated by G protein coupled receptor and receptor tyrosine kinase. Akt is an important target kinase downstreamed PI3K. The mammalian target of rapamycin (mTOR) is a central regulator integrating nutritional information, and mTOR signal activation increases protein synthesis. Studies in humans and animals have found that the activity of PI3K is enhanced in SLE, while the application of PI3K inhibitors can reduce inflammation in tissues and relieve clinical symptoms [31, 32]. PI3Ks are recruited to the TCR complex following activation and generate phosphatidylinositol-3,4,5-triphosphate (PIP3) from membrane phospholipids. Phosphoinositide-dependent protein kinase 1 then phosphorylates and activates Akt through PIP3. Phosphorylated Akt activates mTOR and promotes the synthesis of proteins, which participate in T-cell division, proliferation and survival (Fig. 2). Previous studies have shown that Akt expression is up-regulated in T and B cells in peripheral blood of SLE, and the level of Akt/mTOR activation in B cells is positively correlated with the severity of the disease [33, 34]. Recently, Borlado et al. [35] found that the active form of PI3K in P65PI3KTg mice formed lupus-like renal changes. T-cell subsets and imbalance Imbalance of Th1/Th2 cells Th cell is a subtype of CD4+ T cells. Dysfunction of Th cells is closely related to the occurrence and development of SLE. And the imbalance of Th1/Th2 cells is considered to be an important part in the pathogenesis of SLE.

fulltextpubmed· Body· item PMC7040062

Studies in humans and animals have found that the activity of PI3K is enhanced in SLE, while the application of PI3K inhibitors can reduce inflammation in tissues and relieve clinical symptoms [31, 32]. PI3Ks are recruited to the TCR complex following activation and generate phosphatidylinositol-3,4,5-triphosphate (PIP3) from membrane phospholipids. Phosphoinositide-dependent protein kinase 1 then phosphorylates and activates Akt through PIP3. Phosphorylated Akt activates mTOR and promotes the synthesis of proteins, which participate in T-cell division, proliferation and survival (Fig. 2). Previous studies have shown that Akt expression is up-regulated in T and B cells in peripheral blood of SLE, and the level of Akt/mTOR activation in B cells is positively correlated with the severity of the disease [33, 34]. Recently, Borlado et al. [35] found that the active form of PI3K in P65PI3KTg mice formed lupus-like renal changes. T-cell subsets and imbalance Imbalance of Th1/Th2 cells Th cell is a subtype of CD4+ T cells. Dysfunction of Th cells is closely related to the occurrence and development of SLE. And the imbalance of Th1/Th2 cells is considered to be an important part in the pathogenesis of SLE. Th cells can be divided into Th1 and Th2 cells according to the secretion of different cytokines (the function of several cytokines, see Table 1) and the adjustment process is a dynamic process. Th1 cells secrete tumor necrosis factor-α (TNF-α), IL-2, IFN-γ, which involve in the activation of macrophages and CD8+ T cells, associated with organ-specific autoimmune diseases. Th2 cells secrete IL-4, IL-6, and IL-10, which can promote the activation of B lymphocytes and induce the production of IgG1. Under normal circumstances, the two types of cells regulate and inhibit each other through cytokines to maintain the immune balance. In SLE, the above balance is broken, but the tendency of the balance is still controversial at present. The most scholars believe that active SLE is characterized by decreased function of Th1 and hyperfunction of Th2, which leads to excessive activation of B cells, generation of autoantibodies and tissue injury [36, 37]. However, Dolff et al. [38] found that Th1 dominated the balance of Th1/Th2 in the chronic course of SLE, especially in patients with lupus nephritis IV. Further studies are needed.Table 1 Several important cytokines in the balance of Th1/Th2 in SLE

fulltextpubmed· Body· item PMC7040062

on of B cells, generation of autoantibodies and tissue injury [36, 37]. However, Dolff et al. [38] found that Th1 dominated the balance of Th1/Th2 in the chronic course of SLE, especially in patients with lupus nephritis IV. Further studies are needed.Table 1 Several important cytokines in the balance of Th1/Th2 in SLE Cytokines Source Physiological effect Trends in SLE Functions in SLE IL-2 Activated T cells and NK cells To induce T cell proliferation and maintain immune tolerance ↓ The decrease of IL-2 promotes T cells to differentiate into Th17, inhibits apoptosis and activates autoimmune T cells IL-4 Th2 cells Promote humoral immunity, inhibit cellular immunity ↓ Promote the production of IgG dsDNA antibody; promote the occurrence of lupus nephritis IL-6 Macrophage, T and B lymphocytes and other immune cells Participate in inflammatory response and immune response ↑ B cells express high levels of IL-6R and bind to IL-6 to promote B cells to produce IgG and dsDNA, resulting in immune damage IL-10 Macrophage, monocyte, T and B lymphocytes It has both anti-inflammatory and inflammatory functions ↑ Promote the activation and proliferation of B cells while inhibiting the function of APC and Th1 IFN-γ Activated T cells and NK cells Regulate immune response and fight tumors ↑ Promote the activation of B cells TNF-α Mononuclear macrophages Involved in the inflammatory process of autoimmunity ↑ Promote the expression of major histocompatibility complex antigens, producing immune responses Th T helper, SLE systemic lupus erythematosis, IL interleukin, NK natural killer, IFN interferon, TNF tumor necrosis factor, IgG immunoglobulin G, APC antigen presenting cell

fulltextpubmed· Body· item PMC7040062

ved in the inflammatory process of autoimmunity ↑ Promote the expression of major histocompatibility complex antigens, producing immune responses Th T helper, SLE systemic lupus erythematosis, IL interleukin, NK natural killer, IFN interferon, TNF tumor necrosis factor, IgG immunoglobulin G, APC antigen presenting cell Imbalance of Th17/Treg cells Th17 cells, a subset of effector CD4+ T cells, are identified based on their ability to produce IL-17A, IL-17F and IL-22, mediating inflammatory responses and participate in the occurrence of autoimmune diseases. IL-17 is the main cytokine that promotes Th17 to participate in SLE. It has been confirmed that the level of IL-17 in the kidney of patients with lupus nephritis is increased, and the gene expression of IL-17 in urinary sediment is increased too [39, 40]. Furthermore, the expression of Th17 was also found in the skin, lung and kidney tissues of SLE patients. And increased Th17 was associated with disease activity in SLE. IL-17 and B-cell stimulating factor (BLys) working together to up-regulate the differentiation and survival of B cells, thereby up-regulating humoral immunity to produce autoantibodies.

fulltextpubmed· Body· item PMC7040062

7 was also found in the skin, lung and kidney tissues of SLE patients. And increased Th17 was associated with disease activity in SLE. IL-17 and B-cell stimulating factor (BLys) working together to up-regulate the differentiation and survival of B cells, thereby up-regulating humoral immunity to produce autoantibodies. Regulatory T (Treg) cells are involved in self-tolerance and their impaired function is associated with the development of autoimmunity. Tregs are capable of modulating the function of effector T cells, maintaining immunological homeostasis, and preventing autoimmunity. Several studies have found that the number of Tregs in SLE patients is reduced while the function is absent [41, 42]. Under normal conditions, Th17 and Tregs are in a state of dynamic equilibrium, which is destroyed in SLE [43]. Currently, it is generally believed that the increase of Th17 cells is accompanied by the decrease of Tregs and the dynamic changes of both are involved in the immune response process.

fulltextpubmed· Body· item PMC7040062

tion is absent [41, 42]. Under normal conditions, Th17 and Tregs are in a state of dynamic equilibrium, which is destroyed in SLE [43]. Currently, it is generally believed that the increase of Th17 cells is accompanied by the decrease of Tregs and the dynamic changes of both are involved in the immune response process. T follicular helper (Tfh) cells Tfh cells, a T helper-cell subset assisting B cells in germinal centers (GCs), play a major role in GC formation and the selection of high-affinity B cells. Multiple evidences show that Tfh cells and GC responses are associated with the occurrence of SLE. The Tfh cell phenotype in the circulation (cTfh) of patients with SLE is composed as follows: chemokine receptor CXCR3 and CCR6, inducible co-stimulator (ICOS), programmed death molecule-1 (PD-1). ICOS delivers activation signals to CD4+ T cells when these cells interact with APCs, while PD-1 delivers inhibitory signals. Blocking the ICOS ligand in NZB/NZW mice can inhibit the function of Tfh and the formation of GC, and reduce the anti-dsDNA antibody titers [44]. After co-culture of naive B cells with cTfh in vitro, cTfh can produce IL-21, induce B-cell proliferation and differentiation, and produce IgG and IgA. In vivo experiments showed that increased cTfh cells were positively correlated with the disease activity and serum autoantibody titers [45, 46]. Recent study suggests that immune complexes containing nucleic acid also promote the generation of autoantibodies by enhancing Tfh-cell responses in SLE, which further proved that Tfh is involved in the pathogenesis of SLE.

fulltextpubmed· Body· item PMC7040062

lls were positively correlated with the disease activity and serum autoantibody titers [45, 46]. Recent study suggests that immune complexes containing nucleic acid also promote the generation of autoantibodies by enhancing Tfh-cell responses in SLE, which further proved that Tfh is involved in the pathogenesis of SLE. B cells There is abnormal central and peripheral tolerance of B cells in SLE patients. A large number of self-reactive B cells produce variety of autoantibodies leading to the occurrence of lupus.

fulltextpubmed· Body· item PMC7040062

lls were positively correlated with the disease activity and serum autoantibody titers [45, 46]. Recent study suggests that immune complexes containing nucleic acid also promote the generation of autoantibodies by enhancing Tfh-cell responses in SLE, which further proved that Tfh is involved in the pathogenesis of SLE. B cells There is abnormal central and peripheral tolerance of B cells in SLE patients. A large number of self-reactive B cells produce variety of autoantibodies leading to the occurrence of lupus. Classic T–B cells interactions Immature B cells show a unique activation tendency through the integration signals downstream of B-cell receptor (BCR) and TLRs. BCR recognizes specific antigens containing RNA and/or DNA and forms protein polypeptides after TLR management, then activating B cells. The activated B cells migrate to the boundary of the follicle and interact with CD4+ T cells through TCR and co-stimulators. On the one hand, activated B cells secrete cytokine IL-6, TNF, IFN-γ and IL-10 [47]. On the other hand, activated CD4+ T cells migrate to B-cell follicles to produce IL-21 and IFN-γ as Tfh cells. Tfh cells promote GC formation through the production of IL-21, which sustains the expression of B-cell lymphoma 6 (BCL-6) and promotes B-cell activation, class-switch recombination and plasma cell differentiation. Long-lived plasma cells are eventually formed (Fig. 3).Fig. 3 Classic T–B cells interactions in SLE. BCR B-cell receptor, TLR Toll-like receptor, MHC-II major histocompatibility complex-II, BCL B-cell lymphoma, ICOS inducible co-stimulator, ICOSL inducible co-stimulator ligand, TCR T cell receptor, IL interleukin, IgM immunoglobulin M, IgG immunoglobulin G, BAFF B-cell activating factor, BAFFR B-cell activating factor receptor, IFNγ interferon γ, IFNγR interferon γ receptor, GC germinal center

fulltextpubmed· Body· item PMC7040062

complex-II, BCL B-cell lymphoma, ICOS inducible co-stimulator, ICOSL inducible co-stimulator ligand, TCR T cell receptor, IL interleukin, IgM immunoglobulin M, IgG immunoglobulin G, BAFF B-cell activating factor, BAFFR B-cell activating factor receptor, IFNγ interferon γ, IFNγR interferon γ receptor, GC germinal center B-cell activating factor (BAFF) is also involved in T–B cells interactions. BAFF is overexpressed, which promotes the proliferation of B cells and prolongs the survival time of self-reactive B cells. BAFF transgenic mice showed severe B-cell proliferation, anti-ds DNA antibody formation, serum IgM, IgA, IgE and IgG elevation, and renal tissue showed lupus-like changes such as immune complex deposition [48]. Moreover, studies in NZB/NZW lupus mice showed an increase in BAFF in the early stage of SLE, and BAFF serum content was positively proportional to the degree of renal injury.

fulltextpubmed· Body· item PMC7040062

NA antibody formation, serum IgM, IgA, IgE and IgG elevation, and renal tissue showed lupus-like changes such as immune complex deposition [48]. Moreover, studies in NZB/NZW lupus mice showed an increase in BAFF in the early stage of SLE, and BAFF serum content was positively proportional to the degree of renal injury. B-cell subsets Regulatory B cells (Bregs) are a group of cells with negative regulation of the immune response. Its immunomodulatory effect mainly depends on the secretion of IL-10 and transforming growth factor β. IL-10 can inhibit the production of pathogenic Th1 cytokines, affect the activation and apoptosis of B lymphocytes, and regulate antigen presentation, playing an important role in autoimmune regulation and inflammation. Studies in mice showed that Bregs produced IL-10, which regulates the T-cell-dependent immune response [49]. A growing number of human SLE studies showed that Bregs in patients with lupus were lower than in healthy people, especially in patients with lupus nephritis, and the number of these cells increases after immunosuppressive treatment [50]. In addition, the response of Bregs to CD40 stimulation and the secretion of IL-10 were reduced in peripheral blood of SLE patients, which indicate that Bregs in SLE had dysfunction [51].

fulltextpubmed· Body· item PMC7040062

people, especially in patients with lupus nephritis, and the number of these cells increases after immunosuppressive treatment [50]. In addition, the response of Bregs to CD40 stimulation and the secretion of IL-10 were reduced in peripheral blood of SLE patients, which indicate that Bregs in SLE had dysfunction [51]. Potential therapeutic targets in SLE The treatment guidelines for SLE were established from American College of Rheumatology 1999 to European League Against Rheumatism 2008, and no new drugs were added in these years. The cornerstones of SLE therapies now are non-steroidal anti-inflammatory drugs, glucocorticoids, hydroxychloroquine, and immunosuppressive agents. However, all of these treatments are aimed at controlling the symptoms of the disease and do not address the underlying cause; they have a broad range of nonspecific effects and are associated with considerable toxicities. With the deepening understanding of the pathogenesis of SLE, drugs targeted at possible links of the disease have been studied, providing a new direction for the treatment of SLE. Targeting innate immunity The advances in the understanding of the molecular basis of innate immunity have led to the identification of IFNs, particularly IFN-α, as key mediators in the pathogenesis of SLE. Targeting of IFNs (Table 2), therefore, has emerged as important developments for novel drug research in lupus.Table 2 Agents targeting innate immunity

fulltextpubmed· Body· item PMC7040062

in the understanding of the molecular basis of innate immunity have led to the identification of IFNs, particularly IFN-α, as key mediators in the pathogenesis of SLE. Targeting of IFNs (Table 2), therefore, has emerged as important developments for novel drug research in lupus.Table 2 Agents targeting innate immunity Type Agents Targets for agents Clinical evaluation IFN targeting therapies Rontalizumab Anti-IFNα Did not meet the end point Sifalimumab Anti-IFNα No clinical benefits with AE of herps zoster AGS-009 Anti-IFNα Safe and well tolerated in phase I RCT JNJ-55920839 Anti-IFNβ Phase I RCT is ongoing Anifrolumab Anti-IFNAR Safe and effective in reducing IFN signature AMG-811 Anti-IFNγ Safe and well tolerated with no significant benefits IFN-K IFNα inhibition Safe and well tolerated with no significant benefits pDC targeting therapies BIIB059 Anti-BDCA2 Safe and effective in reducing IFN signature JNJ-56022473 Anti-CD123 Phase I RCT is ongoing ABT-199 Bcl-2 inhibitor Outcome of phase I trial is pending RCT randomized controlled trial, IFN interferon, pDC plasmacytoid dendritic cell, BDCA blood dendritic cell antigen, Bcl B-cell lymphoma, AE adverse events

fulltextpubmed· Body· item PMC7040062

9 Anti-BDCA2 Safe and effective in reducing IFN signature JNJ-56022473 Anti-CD123 Phase I RCT is ongoing ABT-199 Bcl-2 inhibitor Outcome of phase I trial is pending RCT randomized controlled trial, IFN interferon, pDC plasmacytoid dendritic cell, BDCA blood dendritic cell antigen, Bcl B-cell lymphoma, AE adverse events Anifrolumab is a fully human IgG1κ monoclonal antibody directly against the subunit 1 of the type I interferon receptor. It has been assessed in phase I and phase II clinical trials. The phase II study [52] showed that the effect size was larger in patients with a high IFN signature at baseline in patients treated with anifrolumab. There was no significant difference in adverse events except for Herpes zoster. Further studies are ongoing in active SLE patients, including in lupus nephritis (LN) (NCT02446899, NCT02547922). Rontalizumab and sifalimumab, unlike anifrolumab, are anti-IFNα drugs that have been tested in SLE patients. SLE patients treated with rontalizumab showed some efficacy in patients with low IFN signature; however, it did not meet the primary end points [53]. Sifalimumab also showed no efficacy. Neither of them entered further development stages. AGS-009, JNJ-55920839 and AMG-811 are new anti-IFN monoclonal antibodies being assessed in phase I clinical trials.

fulltextpubmed· Body· item PMC7040062

umab showed some efficacy in patients with low IFN signature; however, it did not meet the primary end points [53]. Sifalimumab also showed no efficacy. Neither of them entered further development stages. AGS-009, JNJ-55920839 and AMG-811 are new anti-IFN monoclonal antibodies being assessed in phase I clinical trials. IFN-a-kinoid (IFN-K), a vaccine composed of IFNa2b coupled to a carrier protein, is another option in blocking IFN-α. It acts by inducing antibody production against all IFNα subtypes. Current study showed that IFN-K significantly reduced the expression of the IFN signature compared to placebo, but with no differences in disease activity scores, serum C3, C4 or anti-ds-DNA concentrations. Plasmacytoid dendritic cells (pDCs) have the most potent capacity to produce IFNα of any IFN-producing cell. The treatment option targeting pDCs directly have, therefore, long been expected in SLE. Alternative strategies targeting the pDCs (Table 2) include the use of anti-blood dendritic cell antigen 2 antibody, anti-CD123 monoclonal antibodies and BCL-2 inhibitors, which were assessed in different phase of clinical trials. Targeting adaptive immunity T-cell target therapies B cells require T cell help to produce high-affinity IgG autoantibodies. Distinct signals are necessary for the activation of T cells. The second signal can be activated via co-stimulatory signals, including CD40/40L, CD28, cytotoxic T-lymphocyte antigen 4 (CTLA-4), CD80/CD86 and ICOSL/ICOS.

fulltextpubmed· Body· item PMC7040062

ity T-cell target therapies B cells require T cell help to produce high-affinity IgG autoantibodies. Distinct signals are necessary for the activation of T cells. The second signal can be activated via co-stimulatory signals, including CD40/40L, CD28, cytotoxic T-lymphocyte antigen 4 (CTLA-4), CD80/CD86 and ICOSL/ICOS. Abatacept is a fusion protein composed of the Fc region of the immunoglobulin IgG1 fused to the extracellular domain of CTLA-4, which has a higher affinity with CD80/CD86 than CD28. It failures the activation of T cells by blocking the co-stimulation of T and B lymphocytes, and further preventing B-cell response [54]. The effect of this drug in arthritis is clear, but the effect in SLE remains unclear. In a phase II/III clinical trial [55], abatacept demonstrated efficacy in increasing C3 and C4, accompanied by reducing ds-DNA levels. However, subsequent RCT focusing on LN [56] did not meet the primary end points. CD40-CD40L is another important receptor/ligand pair required for Tfh cell differentiation. BG9588 is anti-CD40L monoclonal antibodies (mAb). Early trial with BG9588 was discontinued because of thromboembolic events. New anti-CD40L mAb, dapirolizumab, is being assessed (NCT02804763). More agents against receptor/ligand pair see Table 3.Table 3 Agents targeting adaptive immunity

fulltextpubmed· Body· item PMC7040062

d for Tfh cell differentiation. BG9588 is anti-CD40L monoclonal antibodies (mAb). Early trial with BG9588 was discontinued because of thromboembolic events. New anti-CD40L mAb, dapirolizumab, is being assessed (NCT02804763). More agents against receptor/ligand pair see Table 3.Table 3 Agents targeting adaptive immunity Type Mechanism of action Agents Targets for agents Clinical evaluation B-cell targeting therapies Blocking B-cell surface antigen Rituximab Anti-CD20 Effective in refractory SLE. Allergic response is the main AE Ofatumumab Anti-CD20 Effective in increasing C3 and C4, decreasing anti-dsDNA. Infection is the main AE TRU-015 Anti-CD20 Phase I RCT is terminated Obinutuzumab Anti-CD20 Safe and well tolerated in phase I trial Epratuzumab Anti-CD22 Phase III trial did not meet the primary end points SM03 Anti-CD22 Safe and well tolerated XmAb 5871 Anti-CD19 Phase II trial is ongoing Milatuzumab Anti-CD74 Outcomes of phase I trial is pending Blocking B-cell survival factors Belimumab Anti-BAFF Effective in improving time to first flare and exhibiting a steroid sparing effect Blisibimod Anti-BAFF Effective in increasing C3 and C4 levels and decreasing urinary protein Atacicept Anti-BAFF/APRIL Got Several efficacy, but trials were terminated for fatal infections B-cell tolerization Abetimus sodium Anti-immunoglobulin receptor on B cells Clinical trials were terminated T-cell targeting therapies Blocking co-stimulatory factors Abatacept Competing with CD28 Effective in increasing C3 and C4, decreasing anti-dsDNA levels BG9588 Anti-CD40 Clinical trials were terminated for thromboembolic event Dapirolizumab Anti-CD40L Safe and well tolerated in phase I trial MEDI-570 Anti-ICOS Outcomes of phase I trial is pending AMG557 Anti-ICOSL Outcomes of phase I trial is pending Theralizumab Anti-CD28 Phase II trial is ongoing BAFF B-cell activating factor, APRIL a proliferation-inducing ligand, ICOS inducible co-stimulator, ICOSL inducible co-stimulator ligand, SLE systemic lupus erythematosis, AE adverse events, RCT randomized controlled trial

fulltextpubmed· Body· item PMC7040062

Anti-ICOSL Outcomes of phase I trial is pending Theralizumab Anti-CD28 Phase II trial is ongoing BAFF B-cell activating factor, APRIL a proliferation-inducing ligand, ICOS inducible co-stimulator, ICOSL inducible co-stimulator ligand, SLE systemic lupus erythematosis, AE adverse events, RCT randomized controlled trial B-cell target therapies The hallmark of immunological abnormalities in SLE is loss of B-cell tolerance, increasing the production of a variety of autoantibodies that against nuclear antigen. Therefore, novel therapeutic agents are developed to target at the growth/survival factors, surface molecules and receptors of B cells, leading to their apoptosis, depletion or anergy.

fulltextpubmed· Body· item PMC7040062

bnormalities in SLE is loss of B-cell tolerance, increasing the production of a variety of autoantibodies that against nuclear antigen. Therefore, novel therapeutic agents are developed to target at the growth/survival factors, surface molecules and receptors of B cells, leading to their apoptosis, depletion or anergy. Belimumab is a human IgG1λ mAb that inhibits B-cell survival and differentiation by blocking the soluble BLys, which is also called BAFF. It was approved in the USA and Europe in 2011 for the treatment of adults with active autoantibody-positive SLE already receiving standard therapy. According to the phase III RCTs, the drug demonstrated a greater therapeutic response in a subpopulation of patients characterized by having higher baseline disease activity as defined by anti-dsDNA positivity, hypocomplementemia (C3 or C4), or corticosteroid treatment requirement [57]. A proliferation-inducing ligand (APRIL) shares similar functions with BAFF and is also important for the survival and activation of B cells [58]. Unlike BAFF, which binds to BAFF receptor only, APRIL binds to transmembrane activator-1 and calcium modulator ligand interactor (TACI), and B-cell maturation antigen receptors with a higher affinity than BAFF. Studies in vivo showed that TACI-Ig (but not BAFF-R-Ig) can suppress serum IgM antibodies, reduce plasma cell frequency in the spleen and inhibit IgM responses to a T-cell-dependent antigen [59]. Atacicept is the representative of TACI-Ig agent. Other B-targeted agents are also under evaluation (Table 3).

fulltextpubmed· Body· item PMC7040062

ty than BAFF. Studies in vivo showed that TACI-Ig (but not BAFF-R-Ig) can suppress serum IgM antibodies, reduce plasma cell frequency in the spleen and inhibit IgM responses to a T-cell-dependent antigen [59]. Atacicept is the representative of TACI-Ig agent. Other B-targeted agents are also under evaluation (Table 3). Rituximab is a human–mouse chimeric mAb against CD20 receptors that can induce the apoptosis of B cells, inhibit the proliferation of B cells, and effectively remove the abnormal proliferation of B cells. It was first marketed and approved by the FDA to treat B-cell lymphomas and showed significant clinical benefits. Subsequent studies demonstrated that rituximab is effective in refractory SLE manifestations, including nephritis and neuropsychiatric disease in both adult and pediatric patients [60–63]. The main adverse event is allergic response because it is a chimeric anti-CD20 antibody. Other anti-CD20 antibodies, including the fully human mAb (ofatumumab) and engineered versions with improved antibody-dependent cellular cytotoxicity killing (obinutuzumab), are investigated in the SLE pipeline [64]. Because of the similar rationale to target B-cell-specific surface antigens that are expressed broadly across different B-cell subsets, therapeutics against CD22, CD19 and CD74 are also being explored (details see Table 3).

fulltextpubmed· Body· item PMC7040062

pendent cellular cytotoxicity killing (obinutuzumab), are investigated in the SLE pipeline [64]. Because of the similar rationale to target B-cell-specific surface antigens that are expressed broadly across different B-cell subsets, therapeutics against CD22, CD19 and CD74 are also being explored (details see Table 3). Other target therapies The immunological pathogenesis of SLE is complex. The innate and acquired immune networks are interlinked with each other mutually complementary, so any point cannot exist independently. Cytokines, complements, immune complexes and kinases of the intracellular machinery play important roles in SLE. Agents targeting them have potential therapeutic effects and many clinical trials are ongoing (details see Table 4). Several other strategies, not discussed here, target on proteasome inhibitor, spleen tyrosin kinase inhibitor, Janus kinase inhibtor, sphingosine 1-phosphate receptor modulator, Calgranuline B modulator and chaperonin 10 might also prove of value.Table 4 Other specific targeting agents

fulltextpubmed· Body· item PMC7040062

re ongoing (details see Table 4). Several other strategies, not discussed here, target on proteasome inhibitor, spleen tyrosin kinase inhibitor, Janus kinase inhibtor, sphingosine 1-phosphate receptor modulator, Calgranuline B modulator and chaperonin 10 might also prove of value.Table 4 Other specific targeting agents Type Agents Targets for agents Clinical evaluation Targeting cytokines Tocilizumab Anti-IL-6 receptor Effective in increasing C3 and C4, decreasing anti-dsDNA levels Etanercept Anti-TNF Safe and well tolerated BT063 Anti-IL-10 Phase II trial is ongoing Targeting complement Eculizumab Anti-C5 Randomized trials are ongoing Targeting IC SM101 Anti-IC Safe and well tolerated, no serious AE Targeting kinases of the intracellular machinery Evobrutinib Anti-BKT Randomized trials are ongoing IC immune complexes, IL interleukin, TNF tumor necrosis factor, AE adverse events, BKT Bruton’s tyrosine kinase

fulltextpubmed· Body· item PMC7040062

umab Anti-C5 Randomized trials are ongoing Targeting IC SM101 Anti-IC Safe and well tolerated, no serious AE Targeting kinases of the intracellular machinery Evobrutinib Anti-BKT Randomized trials are ongoing IC immune complexes, IL interleukin, TNF tumor necrosis factor, AE adverse events, BKT Bruton’s tyrosine kinase Conclusions SLE is a multifactorial and complex autoimmune disease, which is characterized by various cellular and molecular aberrations. The pathogenesis of SLE is still far away to be fully understood. Dysregulated immune response in SLE has been extensively studied, including innate immunity and adaptive immunity. And a dramatic expansion has been achieved in our understanding of cellular and molecular phenotypes in the pathogenesis of SLE. B lymphocyte plays a central role in adaptive immune response of SLE, which involved in the production of autoantibodies, presentation of autoantigens and activation of autoreactive T cells. Furthermore, T lymphocyte plays a role through co-stimulator-mediated signaling pathway and cytokines secreted by subsets of T cells. The role of innate immune response in SLE pathogenesis has also been noticed, especially the discovery of TLR on pDC that can be activated by immune complex, inducing the production of IFN-α and the formation of NETs. These abnormalities co-exist and complement each other. Figure 4 shows the link between these factors and the sites of action of relevant therapeutic targets. Understanding the immune pathophysiology of SLE has led to the emergence of new biologic agents that aim to specifically target abnormal immune processes and thus reduce the unwanted adverse events associated with conventional broad-spectrum immunosuppressant therapies. Even though our understanding of SLE remains incomplete and most of the novel drugs are in clinical trials, these new biologic agents and small-molecule drugs may culminate in the development of safer and more effective therapies.Fig. 4 The immune pathogenesis of SLE and targets of SLE treatment (treatment targets are marked by red boxes).

fulltextpubmed· Body· item PMC7040062

standing of SLE remains incomplete and most of the novel drugs are in clinical trials, these new biologic agents and small-molecule drugs may culminate in the development of safer and more effective therapies.Fig. 4 The immune pathogenesis of SLE and targets of SLE treatment (treatment targets are marked by red boxes). NETosis neutrophil extracellular trap formation, PMN polymorphonuclear neutrophils, DC dendritic cell, BDCA blood dendritic cell antigen, BCL B-cell lymphoma, IL interleukin, IFN interferon, TNF tumor necrosis factor, APRIL a proliferation-inducing ligand, BAFF B-cell activating factor, BCMA B-cell maturation antigen, TAIC transmembrane activator-1 and calcium modulator ligand interactor, ICOS inducible co-stimulator, ICOSL inducible co-stimulator ligand, HLA human leukocyte antigen, BCR B-cell receptor, BTK Bruton’s tyrosine kinase, MHC major histocompatibility complex, TCR T cell receptor, CXCR5 CXC chemokine receptor type 5 Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Lu Pan and Mei-Ping Lu contributed equally to this work and should be considered co-first authors. Author contributions LP looked up the literatures and wrote the initial draft. MPL revised the manuscript. JHW and MX supplement the materials. SRY developed the study design and conceptualization. All authors reviewed and agreed the final manuscript. Funding None. Compliance with ethical standards Ethical approval Not needed.

fulltextpubmed· Body· item PMC7040062

Author contributions LP looked up the literatures and wrote the initial draft. MPL revised the manuscript. JHW and MX supplement the materials. SRY developed the study design and conceptualization. All authors reviewed and agreed the final manuscript. Funding None. Compliance with ethical standards Ethical approval Not needed. Conflict of interest The authors have no conflict of interests to disclose. No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6486944

Introduction The first human milk bank (HMB) was established in Austria over a century ago [1]. Today, there are 233 active milk banks and 14 planned milk banks in Europe and 27 active milk banks in the United States, providing donor milk for ill and preterm infants [2, 3]. This growth has been stimulated by evidence showing the clinical benefits of breast milk or donor human milk (DHM) for preterm infants. Guidelines or recommendations for the operation of milk banking were created by the Human Milk Banking Association of North America (HMBANA) [4] and some European countries such as Italian and Britain as well as Australian [5–7]. The Committee on Nutrition of the European Society for Pediatric Gastroenterology, Hepatology, and Nutrition recommends that fresh own mother’s milk (OMM) is the first choice for preterm babies in neonatal intensive care units (NICUs), and then DHM should be the second choice [8]. The benefits of human milk have been well documented worldwide, especially to the preterm infants, such as decreasing rates of sepsis, necrotizing enterocolitis, allergies and sudden infant death syndrome, while increasing IQ, tolerance for feeding and long term developmental, neurocognitive and cardiovascular outcomes [1, 8–11].

fulltextpubmed· Body· item PMC6486944

s of human milk have been well documented worldwide, especially to the preterm infants, such as decreasing rates of sepsis, necrotizing enterocolitis, allergies and sudden infant death syndrome, while increasing IQ, tolerance for feeding and long term developmental, neurocognitive and cardiovascular outcomes [1, 8–11]. HMB was a novel concept in mainland China when the first HMB opened in March, 2013 in Guangzhou which is one of the largest open cities in southern China. Subsequently human milk banking developed very fast. Until December 2016, there were other 13 ones operated in succession which were located in big cities in the south, east, north, central and southeast of China, respectively. DHM was used not only for preterm infants but also for other ill children. This article is a description of human milk banking practices and experiences with donor screening and processing, as well as the use of DHM in mainland China.

fulltextpubmed· Body· item PMC6486944

n big cities in the south, east, north, central and southeast of China, respectively. DHM was used not only for preterm infants but also for other ill children. This article is a description of human milk banking practices and experiences with donor screening and processing, as well as the use of DHM in mainland China. Methods The human milk banking standards of practice in mainland China referred to the guidelines published by HMBANA and some European countries but with Chinese characteristics. All donors are screened through a questionnaire survey for health history first, and then signed an informed consent form stating that they donated their breast milk voluntarily and promised not to interfere in the use and distribution of the donor milk. The donor inclusion criteria were strict as below: (1) in good physical and psychological health; (2) no tobacco, illegal drug, or excessive alcohol use; (3) not regularly using medication or herbal supplements; (4) have not received organ or tissue transplant or blood transfusion in the past 12 months; (5) mother of a healthy growing infant without any congenital diseases or genetic diseases; (6) promising not to deprive her infant’s nutrition and only to donate the extra breast milk. At last, the mothers should undergo blood tests for human immunodeficiency virus, hepatitis B and C, cytomegalovirus, and syphilis. All tests were undertaken in laboratories of respective hospital. After the questionnaire and the results of blood tests were confirmed by the doctors in milk banks, the qualified donors would be informed by telephone and could come to the milk banks and donate their milk freely. These screening criteria met international recommendations for human milk banking [5–8]. Every 3 months the blood tests were repeated and at the same time the donors’ general health status were checked regularly until the 10th month postpartum. At the beginning of practice, all the donors were required to donate their milk at each milk bank where it was collected only by the medical staff with a hospital grade sterilized One-Day Pump. Before the formal national policy was published, frozen milk collected at home by the donor themselves was not accepted to ensure the safety of DHM.

fulltextpubmed· Body· item PMC6486944

actice, all the donors were required to donate their milk at each milk bank where it was collected only by the medical staff with a hospital grade sterilized One-Day Pump. Before the formal national policy was published, frozen milk collected at home by the donor themselves was not accepted to ensure the safety of DHM. The raw donor milk was pooled from the same donor and separated into several containers then stored in refrigerator at 4 °C immediately. Before pasteurization, one sample was randomly selected from each donor for bacteriological examination. If the total bacterial colony counts were > 105, the milk was considered to be “unqualified” or “pathological” and would be discarded. The raw milk was typically pasteurized by Holder pasteurization (62.5 °C for 30 minutes) according to the recommendation by HMBANA and EMBA. At the beginning, we tested each sample for bacteriological detection and after pasteurization only some samples were tested randomly from each batch. Pasteurized milk was discarded if any microbial content was found.

fulltextpubmed· Body· item PMC6486944

by Holder pasteurization (62.5 °C for 30 minutes) according to the recommendation by HMBANA and EMBA. At the beginning, we tested each sample for bacteriological detection and after pasteurization only some samples were tested randomly from each batch. Pasteurized milk was discarded if any microbial content was found. The recipients were the inpatient preterm infants or those of very low birth weight, as well as infants with necrotizing enterocolitis. In some hospitals, the recipient criteria expanded to other conditions determined at the clinical level as below: (1) immunologic deficiency caused by transplantation, radiotherapy or chemotherapy; (2) requiring nutritional support after a major operation (such as congenital heart disease, necrotizing enterocolitis, intestinal atresia); (3) serious infectious diseases such as sepsis or severe pneumonia; (4) cow’s milk protein allergy with malnutrition, etc. Each HMB was approved by the hospital’s ethics committee before it was established. The information and data of each HMB was recorded and reviewed including the donors, the recipients, the process and use of DHM. We used descriptive statistics by Microsoft Excel.

fulltextpubmed· Body· item PMC6486944

The recipients were the inpatient preterm infants or those of very low birth weight, as well as infants with necrotizing enterocolitis. In some hospitals, the recipient criteria expanded to other conditions determined at the clinical level as below: (1) immunologic deficiency caused by transplantation, radiotherapy or chemotherapy; (2) requiring nutritional support after a major operation (such as congenital heart disease, necrotizing enterocolitis, intestinal atresia); (3) serious infectious diseases such as sepsis or severe pneumonia; (4) cow’s milk protein allergy with malnutrition, etc. Each HMB was approved by the hospital’s ethics committee before it was established. The information and data of each HMB was recorded and reviewed including the donors, the recipients, the process and use of DHM. We used descriptive statistics by Microsoft Excel. Results The data and running trend of milk banks in mainland China During the past 3.5 years from March 2013 to December 2016, there were 14 HMB developed and operated successfully in mainland China (Fig. 1, Table 1). The total donors increased over the years from 309 in 2013 to 1429 in 2016. Similarly, the total donation times and donated milk volumes increased several times during these 3 years, from 1273 to 8331 and from 230.9 to 2740.7 L, respectively (Table 1).Fig. 1 The map of HMBs in mainland China. There were three HMBs in Guangdong, and two in Jiangsu. HMB human milk bank Table 1 Data of milk banking in mainland China (2013–2016)

fulltextpubmed· Body· item PMC6486944

Results The data and running trend of milk banks in mainland China During the past 3.5 years from March 2013 to December 2016, there were 14 HMB developed and operated successfully in mainland China (Fig. 1, Table 1). The total donors increased over the years from 309 in 2013 to 1429 in 2016. Similarly, the total donation times and donated milk volumes increased several times during these 3 years, from 1273 to 8331 and from 230.9 to 2740.7 L, respectively (Table 1).Fig. 1 The map of HMBs in mainland China. There were three HMBs in Guangdong, and two in Jiangsu. HMB human milk bank Table 1 Data of milk banking in mainland China (2013–2016) Variables 2013 2014 2015 2016 Number of human milk banks 2 4 9 14 Total eligible donors 309 279 663 1429 Total donation times 1273 2330 2933 8331 Total donated milk volumes (L) 230.9 813.9 822.7 2740.7 Average volumes (L)/donor 0.75 2.92 1.24 1.92 Average times/donor 4.12 8.35 4.42 5.83 Average donors/bank/mon 23.8 8.5 12.2 13.6 Average times/bank/mon 53 127.6 81.1 89.1 Unfortunately, the average volumes (L) per donor, average times per donor, average donors per bank per month and average times per bank per month did not increased over the years (Table 1).

fulltextpubmed· Body· item PMC6486944

Variables 2013 2014 2015 2016 Number of human milk banks 2 4 9 14 Total eligible donors 309 279 663 1429 Total donation times 1273 2330 2933 8331 Total donated milk volumes (L) 230.9 813.9 822.7 2740.7 Average volumes (L)/donor 0.75 2.92 1.24 1.92 Average times/donor 4.12 8.35 4.42 5.83 Average donors/bank/mon 23.8 8.5 12.2 13.6 Average times/bank/mon 53 127.6 81.1 89.1 Unfortunately, the average volumes (L) per donor, average times per donor, average donors per bank per month and average times per bank per month did not increased over the years (Table 1). The characteristics of the eligible donors In total, there were 2680 eligible donors in these 14 milk banks during these 3.5 years in mainland China. Most of the donors delivered at full term (90.6%) and 81.8% of them were 25–35 years old. The lactating women who donated less than 3 times accounted for 45.0%, and only 24.4% donated more than 10 times. 77.2% of them began to donate milk after one month postpartum period, 60.6% of them had college education. Other characteristics of the donors such as the mode of delivery, the occupation and the way of getting donation information were analyzed below (Table 2). There were few non-eligible donors until now because of strict screening.Table 2 Characteristics of the eligible donors in mainland China

fulltextpubmed· Body· item PMC6486944

hem had college education. Other characteristics of the donors such as the mode of delivery, the occupation and the way of getting donation information were analyzed below (Table 2). There were few non-eligible donors until now because of strict screening.Table 2 Characteristics of the eligible donors in mainland China Variables n (%) Donation times < 3 1206 (45.0) 3–9 820 (30.6) ≥ 10 654 (24.4) First donation time (postpartum) About 1 wk 209 (7.8) 1 wk–1 mon 402 (15.0) 1–3 mon 847 (31.6) 3–6 mon 796 (29.7) 6–10 mon 426 (15.9) Preterm/term delivery Preterm 252 (9.4) Term 2428 (90.6) Mode of delivery Vaginal delivery 1801 (67.2) Cesarean delivery 879 (32.8) Age (y) 20–25 255 (9.5) 25–30 1313 (49.0) 30–35 879 (32.8) > 35 233 (8.7) Occupation Company employee 622 (23.2) Government employee 169 (6.3) Medical worker 204 (7.6) Teacher 142 (5.3) Self-employed 233 (8.7) Housewife 407 (15.2) Others 903 (33.7) Education Above bachelor’s degree 236 (8.8) Bachelor’s degree 1388 (51.8) Junior college 662 (24.7) Senior high school 255 (9.5) Junior high school 139 (5.2) Ways of getting milk donation information Internet media 871 (32.5) Medical staff 788 (29.4) Local television 399 (14.9) Newspapers 271 (10.1) Others 351 (13.1)

fulltextpubmed· Body· item PMC6486944

) Education Above bachelor’s degree 236 (8.8) Bachelor’s degree 1388 (51.8) Junior college 662 (24.7) Senior high school 255 (9.5) Junior high school 139 (5.2) Ways of getting milk donation information Internet media 871 (32.5) Medical staff 788 (29.4) Local television 399 (14.9) Newspapers 271 (10.1) Others 351 (13.1) The use of donated milk and the characteristics of the recipients A total of 4678 received DHM as nutritional therapy due to several indications including prematurity (n = 2990, 63.9%), feeding intolerance (n = 711, 15.2%), maternal illness (n = 345, 7.4%), serious infection (n = 314, 6.7%), necrotising enterocolitis (n = 244, 5.2%), post-surgery (n = 38, 0.8%) and others (n = 36, 0.8%) (Fig. 2). Anyhow, most of the recipients were born before 37 weeks of gestation age and below 2500 g of birth weight. But, 79.0% of them only received the DHM less than 15 days, 18.1% for less than 1 month (Table 3).Fig. 2 Disease types of the recipients Table 3 Characteristics of the recipients Variables n (%) Gestation age of recipients (wk) < 28 217 (4.6) ≥ 28 – < 31 1316 (28.1) ≥ 31 – < 34 2273 (48.6) ≥ 34 – < 37 633 (13.5) ≥ 37 239 (5.1) Birth weight of recipients (g) < 1000 226 (4.8) ≥ 1000 – < 1500 1572 (33.6) ≥ 1500 – < 2500 2355 (50.3) ≥ 2500 525 (11.2) Duration of receiving donor human milk < 15 d 3696 (79.0) ≥ 15 d – < 1 mon 847 (18.1) ≥ 1 – < 2 mon 112 (2.4) > 2 mon 23 (0.5)

fulltextpubmed· Body· item PMC6486944

16 (28.1) ≥ 31 – < 34 2273 (48.6) ≥ 34 – < 37 633 (13.5) ≥ 37 239 (5.1) Birth weight of recipients (g) < 1000 226 (4.8) ≥ 1000 – < 1500 1572 (33.6) ≥ 1500 – < 2500 2355 (50.3) ≥ 2500 525 (11.2) Duration of receiving donor human milk < 15 d 3696 (79.0) ≥ 15 d – < 1 mon 847 (18.1) ≥ 1 – < 2 mon 112 (2.4) > 2 mon 23 (0.5) Discussion Since the early 1990s, the Chinese Government has introduced policy of “Baby Friendly Hospital Initiative” together with regulations on the marketing of infant formula. As a result, the breastfeeding rate appeared to be increasing [12–14]. Unfortunately, the rate of exclusive breastfeeding declined rapidly soon afterwards. Many local studies showed the breastfeeding rate in China was far below the target of 80% “exclusive breastfeeding to 4 months” proposed by the Chinese Children’s Development Plan [15–17] and below the goal recommended by the World Health Organization (WHO) of “exclusive breastfeeding for 6 months” [18]. It was reported that only 59.4% had initiated breastfeeding early (i.e., within 1 hour of birth); only 55.5% and 9.4% had continued breastfeeding for 1 and 2 years, respectively, and only 28.7% of infants younger than 6 months had been exclusively breastfed [19]. And United Nations International Children’s Emergency Fund reported that in 2014 the rate of exclusive breastfeeding among infants aged 6 months in China was only 28% with no increase in 3 years [20]. Multiple factors affected breastfeeding rates, including demographics, social support, socioeconomic status, parents’ educational backgrounds, and high cesarean section rates [21, 22], etc. Meanwhile, many misconceptions about the breastfeeding still existed both in the general population and among healthcare professionals even in the neonatology department or NICU, such as the nutritional value of infant formula being the same as breast milk, breast milk not having any nutrition value after 10-month postpartum, and that DHM was not safe.

fulltextpubmed· Body· item PMC6486944

ut the breastfeeding still existed both in the general population and among healthcare professionals even in the neonatology department or NICU, such as the nutritional value of infant formula being the same as breast milk, breast milk not having any nutrition value after 10-month postpartum, and that DHM was not safe. Theoretically, the benefits of breast milk feeding are well known like optimal nutrition, easy digestibility, and immunologic protection for infants, as well as improved nutritional, psychological, and cardiovascular health and cognitive abilities in later life [23–26]. In addition, human milk contains growth factors that can protect immature tissues, promote maturation, particularly of the gastrointestinal tract, and promote healing of damaged tissues. Since the introduction of DHM, many studies have demonstrated the clinical efficacy for preterm infants [8, 9, 27]. At the same time, the benefits of human milk for nourishing preterm infants have been demonstrated unequivocally in recent decades. It was very clear that the first recipients of DHM were preterm infants, especially the very and extremely low birth weight infants.

fulltextpubmed· Body· item PMC6486944

d the clinical efficacy for preterm infants [8, 9, 27]. At the same time, the benefits of human milk for nourishing preterm infants have been demonstrated unequivocally in recent decades. It was very clear that the first recipients of DHM were preterm infants, especially the very and extremely low birth weight infants. Occasionally, DHM has also been used to treat illnesses in older children or even in adults, such as cystic fibrosis, failure to thrive, congenital anomalies, necrotizing enterocolitis, immune deficiency, cardiac postoperative therapy, and cancer [28–32]. Similarly, short-term clinical and lifesaving effects of DHM in other seriously ill infants and children were proven, especially in children with postoperative intestinal problems, which current nutritional knowledge could not explained easily [33]. Obviously, future studies should address the mechanisms for these benefits.

fulltextpubmed· Body· item PMC6486944

arly, short-term clinical and lifesaving effects of DHM in other seriously ill infants and children were proven, especially in children with postoperative intestinal problems, which current nutritional knowledge could not explained easily [33]. Obviously, future studies should address the mechanisms for these benefits. As shown above, the operation of human milk banking in mainland China was over 100 years later than the first HMB in the world. But from the speed of development in the past 4 years, it was over 10 times faster (3 HMBs in 10 years and 14 in 4 years). The total number of HMBs and the donors, the total volume of DHM and the number of recipients increased rapidly and steadily these years, but the average number of donors of each milk bank per month did not increased accordingly. Each HMB had an average of only 12–13 new donors per month, and the average volume of DHM was less than 1000 mL per day which was far from enough for the need of hospitalized children. Why? The reasons were manifold. First, the breast milk feeding rate was still very low in China as explained above. Second, all donors were encouraged to donate their human milk at each HMB with the help of trained nurse. Frozen milk collected at home was refused generally. Therefore, the number of donors, and the total volume of DHM were both limited obviously. In the future, lactating women’s knowledge and attitude about milk donation should be promoted several educational channels.

fulltextpubmed· Body· item PMC6486944

man milk at each HMB with the help of trained nurse. Frozen milk collected at home was refused generally. Therefore, the number of donors, and the total volume of DHM were both limited obviously. In the future, lactating women’s knowledge and attitude about milk donation should be promoted several educational channels. Most eligible milk donors were well-educated (bachelor degree or above accounted for 60.6%) and employed women. Approximately 90% of the donors had full-term delivery; most of their age was between 25 and 35 years old. These features were similar to the Taiwan HMBs’ [34]. However, most of the donors only donated less than 3 times, the donors who could continue donation more than 10 times were less than 1/4. 77.2% of the donors began to donate their milk after at least 1 month postpartum because of the traditional Chinese custom of sitting on the moon. Unfortunately, the donors also significantly reduced after 6 months postpartum. Of course, the data were consistent with the decline in breastfeeding rate after the end of maternity leave in China. In general, both the number of donors and the number or the amount of donations was too limited and dissatisfactory. Therefore, the future efforts should be focusing on increasing milk donation and promoting the benefits of breastfeeding. At the same time, the donation process should be changed to offer more convenience to those intended donors, such as: (1) drive mobile collection carts into community; (2) offer some kind of benefits to donors such as free parking space in the hospital, payment of the bus or taxi to the donor from home to the bank and back, free check-up visit to their infants, a small toy-gift for their babies, etc.; (3) organize collection points in different areas of the city such as pharmacies; and (4) invite more volunteers to serve at the donors’ home.

fulltextpubmed· Body· item PMC6486944

ing space in the hospital, payment of the bus or taxi to the donor from home to the bank and back, free check-up visit to their infants, a small toy-gift for their babies, etc.; (3) organize collection points in different areas of the city such as pharmacies; and (4) invite more volunteers to serve at the donors’ home. OMM is the first choice in preterm infant feeding. When OMM is not available or insufficient, DHM is the recommended alternative. When neither OMM nor DHM is available, preterm formula should be used. This is the guideline of the European Society for Pediatric Gastroenterology, Hepatology and Nutrition and also is the preterm infants’ feeding recommendation of WHO [8, 35]. In mainland China, hospitalized preterm infants were prioritized in DHM distribution. 94.8% of the recipients were premature babies, and most of their gestational age was 28–34 weeks, and majority (88.8%) were low birth weight infants, including extremely low birth weight infant and very low birth weight infant. Among these preterm infant recipients, most received DHM within 24 hours after birth, which was similar to the situation of DHM’s clinical application in European and American countries [11, 36, 37].

fulltextpubmed· Body· item PMC6486944

ity (88.8%) were low birth weight infants, including extremely low birth weight infant and very low birth weight infant. Among these preterm infant recipients, most received DHM within 24 hours after birth, which was similar to the situation of DHM’s clinical application in European and American countries [11, 36, 37]. Due to the difference in time of operation, the number of donors, the donor milk volume and the number of recipients was quite different between each HMB in mainland China. However, the average DHM consumption per recipient varied from 313 to 5794 mL, and the duration receiving DHM varied from 4.4 to 35 days, most of which was not more than 15 days (79%). The reason for such short duration of DHM consumption were as follows: (1) some recipients had relative big gestational age or ideal birth weight whose conditions were stable and only stayed in hospital for several days; (2) there was not enough DHM for all preterm infants and aim was to provide DHM for these babies within the first few days after admission to achieve feed tolerance as soon as possible; (3) some recipients’ mothers had their own breast milk to feed their babies.

fulltextpubmed· Body· item PMC6486944

were stable and only stayed in hospital for several days; (2) there was not enough DHM for all preterm infants and aim was to provide DHM for these babies within the first few days after admission to achieve feed tolerance as soon as possible; (3) some recipients’ mothers had their own breast milk to feed their babies. In Taiwan, they kept supplying DHM to infants in need even after discharge [34]. However, the policy was quite different from other milk banks in Europe and USA. In many countries, DHM was only provided to the sick infants in hospital or until gastrointestinal tolerance for 2 weeks. The benefits or effect of human milk or DHM on morbidity, specifically necrotising enterocolitis, late onset sepsis, retinopathy of prematurity, bronchopulmonary dysplasia, early achievement of full feeding, encourage successful catch-up growth and neurodevelopment in preterm infants have been well known [9–11, 36, 37]. Meanwhile, some studies found that these protective effects showed a time- and dose-dependent relationship [38]. Therefore, it was still necessary to observe and verify whether there was significant effect on these premature babies when they were provided with such a short time and so little HDM.

fulltextpubmed· Body· item PMC6486944

known [9–11, 36, 37]. Meanwhile, some studies found that these protective effects showed a time- and dose-dependent relationship [38]. Therefore, it was still necessary to observe and verify whether there was significant effect on these premature babies when they were provided with such a short time and so little HDM. In mainland China, DHM was also provided to other sick children, such as those with feeding intolerance, severe infection as severe pneumonia or sepsis, malnutrition after major surgery, leukemia after chemotherapy, graft versus host response after transplantation, Pierre-Robin syndrome, or other situations including lack of breastfeeding because of mother’s illness. And the clinical effects were obvious, especially for that acute malnutrition caused by infection or surgery [33]. Actually, DHM was reported earlier to be used on other patients, even adult patients [38]. There was a study which showed that DHM improved the quality of life measures in the physical, psychological, and spiritual domains for most cancer patients [25]. DHM may be a lifesaving therapy for infants and young children with unusual medical conditions. In 2002, more than 300 infants and young children and 15 adults received donor milk from 6 milk banks in the United States and 1 milk bank in Canada [39].

fulltextpubmed· Body· item PMC6486944

, psychological, and spiritual domains for most cancer patients [25]. DHM may be a lifesaving therapy for infants and young children with unusual medical conditions. In 2002, more than 300 infants and young children and 15 adults received donor milk from 6 milk banks in the United States and 1 milk bank in Canada [39]. Nevertheless, the human milk banking developed rapidly in mainland China, there were following some issues needing to be solved and improved which were also the limitation of this study: (1) the standards of operation of human milk banking should be unified. There were half of these 14 HMBs only collected the fresh DHM in HMB by nurses, other 7 HMBs also collected frozen DHM; (2) there were big differences in the amount of milk donated and the number of donors between each HMB; (3) at present, both donation and use of DHM were totally free in mainland China, and there was no charge standard for the clinical application. Anyway, the cost of HMB was relatively high, and almost all cost of the human milk banking operation was undertaken by the local hospital. Meanwhile, some local public welfare organizations or groups set up special fund for human milk donation. But how long would this free donation plus free use pattern persist?

fulltextpubmed· Body· item PMC6486944

ation. Anyway, the cost of HMB was relatively high, and almost all cost of the human milk banking operation was undertaken by the local hospital. Meanwhile, some local public welfare organizations or groups set up special fund for human milk donation. But how long would this free donation plus free use pattern persist? Clinically, the use of DHM has been shown to have many benefits. Therefore, the HMB should be considered a reasonable and effective tool in the delivery of health care to infants and children. National policy from the government or professional guidelines from academic societies should be introduced urgently to assure HMB going well that included the use of donor milk as an extension of policies related to the collection, storage, and use of own mothers’ milk. HMB should be an integral part of Chinese health care, especially as part of the “baby-friendly hospital” policy as it was in other countries, and promoted, protected and supported by government. Members of Group of Child Health Care, Society of Pediatrics, Chinese Medical Association are listed in “Acknowledgements” section Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements Members list of National Human Milk Bank Group, Children Health of the Chinese Medical Doctors Association: Xi-Hong Liu, Shu-Ping Han, Qiu-Fen Wei, Feng-Ying Zheng, Ting Zhang, Hui-Min Chen. Members list of Group of Child Health Care, Society of Pediatrics, Chinese Medical Association: Mao Meng, Xi-Hong Liu.

fulltextpubmed· Body· item PMC6486944

ledgements Members list of National Human Milk Bank Group, Children Health of the Chinese Medical Doctors Association: Xi-Hong Liu, Shu-Ping Han, Qiu-Fen Wei, Feng-Ying Zheng, Ting Zhang, Hui-Min Chen. Members list of Group of Child Health Care, Society of Pediatrics, Chinese Medical Association: Mao Meng, Xi-Hong Liu. Author contributions XHL analyzed the data and drafted the manuscript, SPH, QFW, FYZ, TZ, and HMC designed the study and collected the data. All authors approved the final version of the manuscript. Funding This study was supported by the Guangdong provincial commission of health and family planning appropriate technology promotion project (2015-7 Guangdong). Ethical approval Each hospital had passed ethical approval before operating the human milk bank. Conflict of interest No financial or nonfinancial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC6872507

Introduction The prevalence of childhood asthma in China is increasing significantly. The national statistics in 1990, 2000 and 2010 showed the cumulative prevalence in children under 14 years of age was 1.09% [1], 1.97% [2], and 3.02% [3], respectively. Early identification of these children will allow earlier treatment and improve outcomes. Using an objective, clinically feasible and inexpensive test will improve the diagnostic level. Challenge test for diagnosing asthma using methacholine, histamine or cold air is expensive and difficult for the regional clinics that provide the bulk of care for children in China. There are not enough resources to diagnose children who had asthma. Studies by Galant et al. [4], Tse et al. [5] and Dundas et al. [6] showed that using bronchodilator response (BDR) rather than the classic challenge test is an effective way of diagnosing asthma in children. They found that BDR ≥ 8% or ≥ 9% as the positive threshold value had the best combination of sensitivity and specificity. These studies did not include native Chinese children, so we want to find the threshold of BDR for diagnosing asthma in Chinese children. Methods The Ethics Committee of Capital Institute of Pediatrics approved the study and signed informed consent was obtained from each child’s parent or legal guardian.

fulltextpubmed· Body· item PMC6872507

Using an objective, clinically feasible and inexpensive test will improve the diagnostic level. Challenge test for diagnosing asthma using methacholine, histamine or cold air is expensive and difficult for the regional clinics that provide the bulk of care for children in China. There are not enough resources to diagnose children who had asthma. Studies by Galant et al. [4], Tse et al. [5] and Dundas et al. [6] showed that using bronchodilator response (BDR) rather than the classic challenge test is an effective way of diagnosing asthma in children. They found that BDR ≥ 8% or ≥ 9% as the positive threshold value had the best combination of sensitivity and specificity. These studies did not include native Chinese children, so we want to find the threshold of BDR for diagnosing asthma in Chinese children. Methods The Ethics Committee of Capital Institute of Pediatrics approved the study and signed informed consent was obtained from each child’s parent or legal guardian. Control group Children aged 4–12 years were selected from kindergartens and primary schools located near the Children’s Hospital Affiliated to the Capital Institute of Pediatrics from January 2012 to December 2015. First, leaflets were released to the children’s parents. If they consented to participate in the study, their children would perform the BDR [BDR is used to determine the reversibility of airway obstruction by measuring the changes of forced expiratory volume in the first second (FEV1) before and after inhalation of bronchodilators] test at the appointed time and fill in a detailed questionnaire on that day. The original questionnaire is a section of the American Thoracic Society pulmonary disease questionnaire for children under the age of 13 years (AST-DLD-78-C) [7]. Physicians from our department translated the original questionnaire into Chinese. Later other physicians translated the Chinese questionnaire back into English to check the quality and accuracy of the translation.

fulltextpubmed· Body· item PMC6872507

oracic Society pulmonary disease questionnaire for children under the age of 13 years (AST-DLD-78-C) [7]. Physicians from our department translated the original questionnaire into Chinese. Later other physicians translated the Chinese questionnaire back into English to check the quality and accuracy of the translation. The inclusion criteria included: (1) subjects were willing to participate in the study, parents signed informed consent; (2) subjects were 4–12 years old; (3) pulmonary physical examination was normal. The exclusion criteria included: (1) abnormalities of the thorax; (2) previous history of severe cardiac (significant changes in hemodynamics) or lung disease, or other systemic diseases; (3) recurrent episodes of wheezing diseases (such as asthma, bronchiolitis), tuberculosis, pleurisy, history of chronic lung disease; (4) upper or lower respiratory tract infections within the previous 4 weeks; (5) obesity [body mass index (BMI) > 30] [8]; (6) regular smoking for over 1 month (including first-hand and second-hand smoking); (7) a living environment in which they are exposed to harmful gases or smog from serious pollution; (8) poor cooperation.

fulltextpubmed· Body· item PMC6872507

or lower respiratory tract infections within the previous 4 weeks; (5) obesity [body mass index (BMI) > 30] [8]; (6) regular smoking for over 1 month (including first-hand and second-hand smoking); (7) a living environment in which they are exposed to harmful gases or smog from serious pollution; (8) poor cooperation. We sent leaflets to 541 parents whose children were in kindergartens or primary schools nearby. 450 parents agreed to participate in our study. On the appointed day, 53 children coughed, expectorated or were absented. 11 children had obesity or thoracic deformity. Six children could not cooperate with the test. A total of 380 children completed the test. Detailed questionnaires were given to the children, and 23 of them did not answer it. 56 patients with suspected asthma or other lung diseases were excluded. Therefore, there were 301 cases of children who met the requirements and were included in the study as the control group. Asthmatic children Asthmatic children aged 4–12 years were recruited from the Asthma Prevention and Treatment Center of the Children’s Hospital Affiliated to the Capital Institute of Pediatrics, diagnosed by specialists. Diagnostic criteria were used according to the national guidelines for the diagnosis and prevention of asthma in Chinese children (2008 edition) [9]. If the patients were diagnosed with asthma, and fit the inclusion criteria, they were included in the asthma group.

fulltextpubmed· Body· item PMC6872507

Asthmatic children Asthmatic children aged 4–12 years were recruited from the Asthma Prevention and Treatment Center of the Children’s Hospital Affiliated to the Capital Institute of Pediatrics, diagnosed by specialists. Diagnostic criteria were used according to the national guidelines for the diagnosis and prevention of asthma in Chinese children (2008 edition) [9]. If the patients were diagnosed with asthma, and fit the inclusion criteria, they were included in the asthma group. The inclusion criteria included: (1) subjects were willing to participate in the study, parents signed informed consent form; (2) asthma diagnosed by specialists; (3) have not used controller medications in the previous 6 weeks (including inhaled corticosteroids and leukotriene receptor modulators); (4) no symptoms or mild symptoms, no wheezing upon initial visit.

fulltextpubmed· Body· item PMC6872507

were willing to participate in the study, parents signed informed consent form; (2) asthma diagnosed by specialists; (3) have not used controller medications in the previous 6 weeks (including inhaled corticosteroids and leukotriene receptor modulators); (4) no symptoms or mild symptoms, no wheezing upon initial visit. The exclusion criteria included: (1) thorax was abnormal, such as chicken, funnel chest, costal margin eversion, etc.; (2) previous history of tuberculosis, pleurisy, or chronic lung disease, severe cardiac (significant changes in hemodynamics), or other systemic diseases; (3) upper or lower respiratory tract infections within the previous 4 weeks; (4) regular smoking for over 1 month (both first-hand and second-hand smoke); (5) obesity (BMI > 30) [8]; (6) a living environment in which they are exposed to harmful gases or smog from serious pollution; (7) in the past 6 hours, short acting bronchodilators had been used; (8) in the past 24 hours, long-acting bronchodilators had been used; (9) in the past 3 days, systemic steroid had been used; (10) poor cooperation.

fulltextpubmed· Body· item PMC6872507

8]; (6) a living environment in which they are exposed to harmful gases or smog from serious pollution; (7) in the past 6 hours, short acting bronchodilators had been used; (8) in the past 24 hours, long-acting bronchodilators had been used; (9) in the past 3 days, systemic steroid had been used; (10) poor cooperation. There were 306 patients that fulfilled the inclusion criteria, but five patients took relevant medication recently, eight had upper respiratory infection in the last 4 weeks, four had thorax abnormalities, three could not cooperate with the spirometer tests. Consequently, they were all excluded. 286 patients completed the study. According to the classification of asthma severity of Global Initiative for Asthma 2008 [10], asthmatic children were divided into four groups: intermittent status, mild persistent status, moderate persistent status, and severe persistent asthma. Patients were assessed for 1 month to determine their severity. In this study, we used the Master Screen IOS (made by JARGER in Germany) for testing. All operations and quality control of spirometer testing were referred to Practical Guide to Pulmonary Function testing [11].

fulltextpubmed· Body· item PMC6872507

There were 306 patients that fulfilled the inclusion criteria, but five patients took relevant medication recently, eight had upper respiratory infection in the last 4 weeks, four had thorax abnormalities, three could not cooperate with the spirometer tests. Consequently, they were all excluded. 286 patients completed the study. According to the classification of asthma severity of Global Initiative for Asthma 2008 [10], asthmatic children were divided into four groups: intermittent status, mild persistent status, moderate persistent status, and severe persistent asthma. Patients were assessed for 1 month to determine their severity. In this study, we used the Master Screen IOS (made by JARGER in Germany) for testing. All operations and quality control of spirometer testing were referred to Practical Guide to Pulmonary Function testing [11]. All subjects produced at least three technically acceptable spirometer curves (in fewer than 8 attempts). The best curve was recorded for analysis. the main observation parameters included pre- and post-bronchodilator FEV1, and the percentage of predicted value of FEV1, forced vital capacity (FVC), peak expiratory flow (PEF), average flow rate of 25–75% out of vital capacity (MMEF) and the BDR [calculated as: (FEV1 L post-bronchodilator − FEV1 L pre-bronchodilator)/FEV1 L pre-bronchodilator × 100%]. After the baseline spirometer test, the subjects inhaled 0.5% salbutamol sulfate (GlaxoSmithKline, United Kingdom) using a PARI compressor nebulizing with a mask. For subjects ≥ 5 years old, 1 mL (5 mg) was inhaled. For subjects < 5 years old, 0.5 mL (2.5 mg) was inhaled. 15 minutes after nebulization, spirometer tests were performed again.

fulltextpubmed· Body· item PMC6872507

rometer test, the subjects inhaled 0.5% salbutamol sulfate (GlaxoSmithKline, United Kingdom) using a PARI compressor nebulizing with a mask. For subjects ≥ 5 years old, 1 mL (5 mg) was inhaled. For subjects < 5 years old, 0.5 mL (2.5 mg) was inhaled. 15 minutes after nebulization, spirometer tests were performed again. Statistical analysis Data were analyzed using the SPSS 20.0 software. Student’s t tests were used to compare the characteristics of each group, as well as the changes to spirometer parameters before and after bronchial dilation tests and to compare spirometer between asthmatic children and non-asthmatic children. The characteristics of different severity groups of asthma patients were compared with a variance analysis. Linear correlation analysis was performed to evaluate the relationship between the FEV1 improvement rate and gender, age, height, and weight. The data were used to plot a receiver-operating characteristic (ROC) curve (this is a comprehensive index reflecting the continuous variables of sensitivity and specificity). It reveals the relationship between sensitivity and specificity by composition. It draws a curve with sensitivity as ordinate and specificity as abscissa. The larger the area under the curve, the higher the diagnostic accuracy represents the sensitivity and specificity of BDR for diagnosing childhood asthma.

fulltextpubmed· Body· item PMC6872507

cificity). It reveals the relationship between sensitivity and specificity by composition. It draws a curve with sensitivity as ordinate and specificity as abscissa. The larger the area under the curve, the higher the diagnostic accuracy represents the sensitivity and specificity of BDR for diagnosing childhood asthma. Results Basic characteristics There were 301 normal children as the control group and 286 asthmatic children as the asthma group, the demographic and clinical data of the two groups were consistent. There were no significant differences between the control group and the asthma group in age (P = 0.10), height (P = 0.27) or weight (P = 0.81) (Table 1). There were 79 children younger than 6 years old in the control group and 87 in asthma group, accounted for 26.2% and 30.4% separately.Table 1 The basic characteristics of the non-asthmatic and asthmatic groups Variables Non-asthmatic group (n = 301) Asthmatic group (n = 286) Males, n (%) 160 (53.2) 194 (67.8) Age (y), mean ± SD 7.56 ± 2.41 7.22 ± 2.44 Height (cm), mean ± SD 129.61 ± 15.63 128.19 ± 15.75 Weight (kg), mean ± SD 29.65 ± 11.01 29.89 ± 12.27 SD standard deviation

fulltextpubmed· Body· item PMC7091166

Immunomodulating therapy Corticosteroids should be avoided in common type of infection. However, it can be considered in the following situations:With rapidly deteriorating chest imaging and occurence of ARDS. With obvious toxic symptoms, encephalitis or encephalopathy, hemophagocytic syndrome and other serious complications. With septic shock. With obvious wheezing symptoms. Intravenous methylprednisolone (1–2 mg/kg/day) is recommended for 3–5 days, but not for long-term use [3, 5, 9–11]. Intravenous immunoglobulin can be used in severe cases when indicated, but its efficacy needs further evaluation. The recommended dose is 1.0 g/kg/day for 2 days, or 400 mg/kg/day for 5 days [6, 9, 12, 13]. Bronchoalveolar lavage (BAL) BAL is not suitable for most patients, and there is an increased risk of cross-infection. The indications should be strictly controlled. BAL can be considered if patients have obvious symptoms of airway obstruction, refractory massive atelectasis indicated by imaging, a significant increase in peak pressure during ventilator therapy, decrease of tidal volume, or poor oxygenation which cannot be reversed by conservative treatments.

fulltextpubmed· Body· item PMC6872507

Results Basic characteristics There were 301 normal children as the control group and 286 asthmatic children as the asthma group, the demographic and clinical data of the two groups were consistent. There were no significant differences between the control group and the asthma group in age (P = 0.10), height (P = 0.27) or weight (P = 0.81) (Table 1). There were 79 children younger than 6 years old in the control group and 87 in asthma group, accounted for 26.2% and 30.4% separately.Table 1 The basic characteristics of the non-asthmatic and asthmatic groups Variables Non-asthmatic group (n = 301) Asthmatic group (n = 286) Males, n (%) 160 (53.2) 194 (67.8) Age (y), mean ± SD 7.56 ± 2.41 7.22 ± 2.44 Height (cm), mean ± SD 129.61 ± 15.63 128.19 ± 15.75 Weight (kg), mean ± SD 29.65 ± 11.01 29.89 ± 12.27 SD standard deviation Non-asthmatic group There were no significant differences in age, height, weight and main spirometer parameters between male and female subjects (Supplementary Table 1). The main spirometer parameters (FEV1, FVC, PEF, MMEF) in non-asthmatic children post-bronchodilator were higher than the baseline (Table 2), but the increase is relatively small. And the BDR in non-asthmatic children was 3.30 ± 3.85%. There was no correlation with gender (rs = 0.016, P > 0.5), age (rs = 0.106, P > 0.5), height (rs = 0.118, P = 0.041), or weight (rs = 0.143, P = 0.013).Table 2 Pre- and post-BD parameters in non-asthmatic and asthmatic group

fulltextpubmed· Body· item PMC6872507

but the increase is relatively small. And the BDR in non-asthmatic children was 3.30 ± 3.85%. There was no correlation with gender (rs = 0.016, P > 0.5), age (rs = 0.106, P > 0.5), height (rs = 0.118, P = 0.041), or weight (rs = 0.143, P = 0.013).Table 2 Pre- and post-BD parameters in non-asthmatic and asthmatic group Parameters Non-asthmatic group Asthmatic group Pre-BD Post-BD P Pre-BD Post-BD P FEV1 (L) 1.76 ± 0.58 1.81 ± 0.59 < 0.001 1.48 ± 0.54 1.60 ± 0.57 < 0.001 FVC (L) 1.91 ± 0.65 1.93 ± 0.66 < 0.001 1.78 ± 0.69 1.84 ± 0.69 < 0.001 PEF (L) 4.11 ± 1.26 4.26 ± 1.26 < 0.001 3.37 ± 1.20 4.61 ± 1.20 < 0.001 MMEF (L) 2.07 ± 0.77 2.42 ± 0.83 < 0.001 1.46 ± 0.62 1.79 ± 0.69 < 0.001 Values are mean ± SD. BD bronchodilator, FEV1 forced expiratory volume in the first second, FVC forced vital capacity, PEF peak expiratory flow, MMEF average flow rate of 25–75% out of vital capacity, SD standard deviation

fulltextpubmed· Body· item PMC6872507

1.20 4.61 ± 1.20 < 0.001 MMEF (L) 2.07 ± 0.77 2.42 ± 0.83 < 0.001 1.46 ± 0.62 1.79 ± 0.69 < 0.001 Values are mean ± SD. BD bronchodilator, FEV1 forced expiratory volume in the first second, FVC forced vital capacity, PEF peak expiratory flow, MMEF average flow rate of 25–75% out of vital capacity, SD standard deviation Asthma group At this group, 53.8% (154/286) had intermittent asthma, 35.3% (101/286) had mild persistent asthma, and 10.8% (31/286) had moderate persistent asthma (Supplementary Table 2). PEF decreased more in the moderate group compared to the intermittent group (P < 0.05). There was no significant difference in other characteristics between different severity groups (P > 0.05). The main spirometer parameters of asthmatic children were significantly improved post-bronchodilator (Table 2). The BDR of asthmatic children was 9.45 ± 9.15%. There was no significant correlation with gender (rs = 0.058, P > 0.1), age (rs = 0.018, P > 0.5), height (rs = 0.014, P > 0.5) or weight (rs = -0.054, P > 0.1).

fulltextpubmed· Body· item PMC6872507

he main spirometer parameters of asthmatic children were significantly improved post-bronchodilator (Table 2). The BDR of asthmatic children was 9.45 ± 9.15%. There was no significant correlation with gender (rs = 0.058, P > 0.1), age (rs = 0.018, P > 0.5), height (rs = 0.014, P > 0.5) or weight (rs = -0.054, P > 0.1). Comparison of spirometer parameters between non-asthmatic children and asthmatic children Compared with the non-asthmatic children, the main spirometer parameters of the asthmatic children were significantly lower (Table 3). FEV1 is 1.76 in the non-asthmatic children, 1.48 in the asthmatic children, and FVC 1.91, 1.78; PEF 4.11, 3.37; MMEF 2.07, 1.47, respectively. Comparing of the improvement to main spirometer parameters post-bronchodilator between non-asthmatic children and asthmatic children, we found FVC improved the least, and MMEF improved the most among spirometer parameters. The main spirometer parameters of asthmatic children all significantly improved compared with non-asthmatic children (Table 4).Table 3 Comparison of pulmonary function parameters in non-asthmatic and asthmatic group Parameters Non-asthmatic group Asthmatic group P FEV1 1.76 ± 0.58 1.48 ± 0.54 < 0.001* FVC 1.91 ± 0.65 1.78 ± 0.69 0.016* PEF 4.11 ± 1.26 3.37 ± 1.20 < 0.001* MMEF 2.07 ± 0.77 1.47 ± 0.62 < 0.001† Values are mean ± SD. FEV1 forced expiratory volume in the first second, FVC forced vital capacity, PEF peak expiratory flow, MMEF average flow rate of 25–75% out of vital capacity, SD standard deviation. *P value of Student’s t test. †P value of rank sum test

fulltextpubmed· Body· item PMC7091166

e strictly controlled. BAL can be considered if patients have obvious symptoms of airway obstruction, refractory massive atelectasis indicated by imaging, a significant increase in peak pressure during ventilator therapy, decrease of tidal volume, or poor oxygenation which cannot be reversed by conservative treatments. Organ function support In case of circulation dysfunction, vasoactive drugs should be used to improve microcirculation on the basis of adequate liquid support [3]. Patients with acute renal injury should be given continuous blood purification on time. In the meantime, paying attention to the brain function monitoring if neccessary. If intracranial hypertension and convulsion occurs in children, it is necessary to reduce the intracranial pressure and control convulsion timely [6, 12, 13]. Respiratory support In the case of respiratory distress that occurs despite nasal catheter or mask oxygenation, heated humidified high-flow nasal cannula (HHHFNC), non-invasive ventilation such as continuous positive airway pressure (CPAP), or non-invasive high-frequency ventilation can be used. If improvement is not possible, mechanical ventilation with endotracheal intubation and a protective lung ventilation strategy should be adopted.

fulltextpubmed· Body· item PMC6872507

3.37 ± 1.20 < 0.001* MMEF 2.07 ± 0.77 1.47 ± 0.62 < 0.001† Values are mean ± SD. FEV1 forced expiratory volume in the first second, FVC forced vital capacity, PEF peak expiratory flow, MMEF average flow rate of 25–75% out of vital capacity, SD standard deviation. *P value of Student’s t test. †P value of rank sum test Table 4 Comparison of the improvement rate of main pulmonary function parameters in non-asthmatic and asthmatic group Parameters (%) Non-asthmatic group Asthma group P ΔFEV1 3.30 ± 3.85 9.45 ± 9.15 < 0.001 ΔFVC 0.89 ± 3.55 4.53 ± 7.86 < 0.001 ΔPEF 4.06 ± 7.54 8.73 ± 11.53 < 0.001 ΔMMEF 19.30 ± 17.53 25.36 ± 24.00 < 0.001 Values are mean ± SD. FEV1 forced expiratory volume in the first second, FVC forced vital capacity, PEF peak expiratory flow, MMEF average flow rate of 25–75% out of vital capacity, SD standard deviation, Δ improvement rate The ROC curve is plotted in Fig. 1. The area under the curve is 0.738. A comparison of different BDR thresholds in the bronchodilation test is available in Supplementary Table 3. The maximum value of the Youden index was 7.5%, its sensitivity and specificity were 50.7% and 87.7%, respectively. When BDR was 9%, the sensitivity and specificity were 30.9% and 94.7%, respectively (Supplementary Table 3).Fig. 1 Sensitivity and specificity of BDR in the BDT. BDR bronchodilator response, BDT bronchodilator test Discussion The main pathological and physiological change of asthma patients is chronic airway inflammation. The most prominent feature of respiratory dysfunction in asthma patients is variable expiratory airflow limitation.

fulltextpubmed· Body· item PMC6872507

The ROC curve is plotted in Fig. 1. The area under the curve is 0.738. A comparison of different BDR thresholds in the bronchodilation test is available in Supplementary Table 3. The maximum value of the Youden index was 7.5%, its sensitivity and specificity were 50.7% and 87.7%, respectively. When BDR was 9%, the sensitivity and specificity were 30.9% and 94.7%, respectively (Supplementary Table 3).Fig. 1 Sensitivity and specificity of BDR in the BDT. BDR bronchodilator response, BDT bronchodilator test Discussion The main pathological and physiological change of asthma patients is chronic airway inflammation. The most prominent feature of respiratory dysfunction in asthma patients is variable expiratory airflow limitation. Airway responsiveness to bronchodilators can be used as a predictor of asthma in the childhood population [12–14]. This has been shown in various populations other than native Chinese children. In a large and populous country like China, medical resources are strained and complex and expensive tests are not widely available. Finding easy to administer and inexpensive tests is essential to get the testing and diagnostic process started at the local level. Then the treatment can be started earlier improving morbidity and reducing costs.

fulltextpubmed· Body· item PMC6872507

untry like China, medical resources are strained and complex and expensive tests are not widely available. Finding easy to administer and inexpensive tests is essential to get the testing and diagnostic process started at the local level. Then the treatment can be started earlier improving morbidity and reducing costs. Bronchodilation test is a good choice, but we have been using adult indicators for a long time. The cutoff point of 12% for adult is too conservative for children. In the study carried out by Galant et al. among 51 non-asthmatic children and 346 controller-naïve asthmatic children between 4 and 17 years, the BDR value could achieve 12% in only 30.6% asthmatic children, across all severity [4]. Meanwhile, when observing BDR value in the above study, results were 2.2% [95% confidence interval (CI) 0.2–4.3] in the non-asthmatic group compared with 8.6% (95% CI 7.5–9.8) in the asthmatic group. The range seen was 7.6% (95% CI 5.8–9.5) for mild asthma to 10.1% (95% CI 7.6–12.6) in the severe persistent group. In addition, in a study [15] carried out by Harvard University among 3052 children in rural area between 8 and 15 years in Anhui Province in China, results showed BDR was 3 ± 5% in non-asthmatic children, and 7 ± 9% in asthmatic children. Moreover, in a study [6] among 142 children between 5 and 10 years in UK, 9% increase in FEV1 after bronchodilator use was suggested as the cutoff point with good sensitivity and specificity.

fulltextpubmed· Body· item PMC6872507

15 years in Anhui Province in China, results showed BDR was 3 ± 5% in non-asthmatic children, and 7 ± 9% in asthmatic children. Moreover, in a study [6] among 142 children between 5 and 10 years in UK, 9% increase in FEV1 after bronchodilator use was suggested as the cutoff point with good sensitivity and specificity. It has been shown that a persistent BDR value, even less than 12%, in asthmatic children suggests poor prognosis. In the article written by Sharma et al. [16], it showed in a 4 years study among 1041 asthmatic children in America, individuals who had a BDR of 10% had poor clinical outcomes (e.g., more hospital visits, more prednisone bursts, increased nocturnal awakenings, and missing more days of school) similar to those with a BDR of 12% and 200 mL. The same results were also obtained in Galant et al. [17] study among 679 asthmatic children among 5–18 years. In this study, we obtained the subjects’ information from the questionnaires which the subjects reported it by themselves or by their parents. We had a small response in FEV1 in the control group. We had careful screened this population but may have had some influence of general or indoor air pollution cause an increase in airway reactivity that our screening did not eliminate. Despite this the technique of using BDR to separate asthmatic from non-asthmatic children was effective.

fulltextpubmed· Body· item PMC6872507

e in FEV1 in the control group. We had careful screened this population but may have had some influence of general or indoor air pollution cause an increase in airway reactivity that our screening did not eliminate. Despite this the technique of using BDR to separate asthmatic from non-asthmatic children was effective. In this study, we enrolled mild asthmatic children as these would be the ones who would likely pose the most diagnostic dilemmas. Their symptoms are atypical and not serious, often neglected by themselves and their parents, and they are easy to be missed by doctors when they see a doctor. If there is a simple and easy test to help diagnosing quickly, their asthma will be controlled more timely and their prognosis will be better. Of the 286 asthmatic children, 53.8% (154/286) had intermittent asthma, 35.3% (101/286) had mild persistent asthma, and 10.8% (31/286) had moderate persistent asthma. The results of this study showed that the BDR in non-asthmatic children was 3.30 ± 3.85%, which was consistent with the BDR results (3 ± 5%) of large-scale studies on children aged 8–15 years in rural China conducted by Kumar et al. [15]. The BDR in asthmatic children was 9.45 ± 9.15%, which was generally consistent with the results by Galant et al. [4] and Tse et al. [5].

fulltextpubmed· Body· item PMC6872507

thmatic children was 3.30 ± 3.85%, which was consistent with the BDR results (3 ± 5%) of large-scale studies on children aged 8–15 years in rural China conducted by Kumar et al. [15]. The BDR in asthmatic children was 9.45 ± 9.15%, which was generally consistent with the results by Galant et al. [4] and Tse et al. [5]. BDR of the intermittent asthma group, mild persistent group and moderate persistent group was 9.09 ± 8.25%, 9.80 ± 10.54%, and 10.13 ± 8.84%, respectively, indicating no significant differences among the three groups. It prompts the thought that there is little difference in BDR between asthma patients with different attack frequencies and different severities. Our results showed no relationship between BDR and gender, age, height or weight, and can be used as an independent and objective index to diagnose childhood asthma some other studies have found a relationship between BDR and gender [17–20]. The subjects of these studies were people at a special stage, these may be the influencing factors (for example, women who use contraceptives). To evaluate the diagnostic value of a test method comprehensively and accurately, we used ROC in the analysis. The area under the ROC curve (AUC) can be understood as the average sensitivity in all specificity and reflects the diagnostic value of the method [21]. When AUC = 0.5, the method is generally considered to not work at all. When AUC > 0.7, the method is considered to have great discrimination [22, 23]. In our study, AUC was 0.738, which showed that the BDR has significant diagnostic value for asthma.

fulltextpubmed· Body· item PMC6872507

all specificity and reflects the diagnostic value of the method [21]. When AUC = 0.5, the method is generally considered to not work at all. When AUC > 0.7, the method is considered to have great discrimination [22, 23]. In our study, AUC was 0.738, which showed that the BDR has significant diagnostic value for asthma. At present, the BDR threshold for asthma diagnosis in children is the same as the one for adults used widely in clinics. We found that this existing standard threshold was prone to misdiagnosis (when using BDR > 12%, the sensitivity was only 28.7% though the specificity rate of 96.3%). Many children patients with asthma were not diagnosed early, correctly and did not receive appropriate early treatment. When the BDR threshold was set to > 7.5%, the sensitivity was increased to 50.7%. At the same time, the specificity was 87.7%. This significantly improves the diagnostic accuracy of childhood asthma, reduces misdiagnosis, and prevents the children and their parents from bearing the psychological, mental and economic costs. International studies have also shown that a BDR threshold of > 12% was ineffective, and that > 9% or > 8% had better sensitivity and specificity. Although some studies have shown BDR are different in different races [24], previous results are generally consistent with ours [4–6, 25]. In summary, compared with non-asthmatic children, BDR in asthmatic children is significantly higher. BDR is not correlated with gender, age, height or weight. A BDR threshold of > 7.5% is useful in diagnosing asthma in native Chinese children.

fulltextpubmed· Body· item PMC6872507

At present, the BDR threshold for asthma diagnosis in children is the same as the one for adults used widely in clinics. We found that this existing standard threshold was prone to misdiagnosis (when using BDR > 12%, the sensitivity was only 28.7% though the specificity rate of 96.3%). Many children patients with asthma were not diagnosed early, correctly and did not receive appropriate early treatment. When the BDR threshold was set to > 7.5%, the sensitivity was increased to 50.7%. At the same time, the specificity was 87.7%. This significantly improves the diagnostic accuracy of childhood asthma, reduces misdiagnosis, and prevents the children and their parents from bearing the psychological, mental and economic costs. International studies have also shown that a BDR threshold of > 12% was ineffective, and that > 9% or > 8% had better sensitivity and specificity. Although some studies have shown BDR are different in different races [24], previous results are generally consistent with ours [4–6, 25]. In summary, compared with non-asthmatic children, BDR in asthmatic children is significantly higher. BDR is not correlated with gender, age, height or weight. A BDR threshold of > 7.5% is useful in diagnosing asthma in native Chinese children. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary file1 (DOC 48 kb) Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

fulltextpubmed· Body· item PMC6872507

In summary, compared with non-asthmatic children, BDR in asthmatic children is significantly higher. BDR is not correlated with gender, age, height or weight. A BDR threshold of > 7.5% is useful in diagnosing asthma in native Chinese children. Electronic supplementary material Below is the link to the electronic supplementary material. Supplementary file1 (DOC 48 kb) Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements We appreciate the valuable support of Shuo Li, Xin Song, and Yan-Tao Zhang in spirometer performance. Author contributions XHK collected the data, drafted and edited the manuscript. WW collected and analyzed the data. LC designed the study, and reviewed the manuscript, he was the supervisor. All the authors have read and approved the final manuscript. Funding This study was supported by the Merck Investigator Studies Program. Compliance with ethical standards Ethical approval This study was approved by the Ethics Committee of Capital Institute of Pediatrics. Signed informed consent was obtained from each child’s parent or legal guardian. Conflict of interest No financial or non-financial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC7090514

Up to now, no antiviral therapeutic regimens with exact efficacy are recommended to be used in children with coronavirus disease 2019 (COVID-19). Interim Guidance for Diagnosis and Treatment (the sixth edition) of COVID-19 [1] only provided potential antiviral treatments in adults. According to the current guidelines for management in adults and children and available resources in antiviral drugs, we herein discussed the pharmaceutical care of the five antiviral treatments (IFN-α, lopinavir/ritonavir, ribavirin, chloroquine diphosphate and arbidol) in children with COVID-19 (Table 1).Table 1 Dosage regimen and precaution of antiviral drugs in children Drugs Age available Dosage regimen of COVID-19 in children Precaution/contraindication IFN-α Nebulization: using with caution in neonates and infants younger than 2 months Nebulization: 200,000–400,000 IU/kg or 2–4 μg/kg in 2 mL sterile water, twice daily for 5–7 days Spray: 1–2 sprays on each nostril and 8–10 sprays on the oropharynx, once every 1–2 h, 8–10 sprays/day for 5–7 days Contraindication: CrCl < 50 mL/min; histories of mental illness, severe or unstable heart disease, or aplastic anemia LPVr China: OS ≥ 6 months, T ≥ 2 years USA: OS ≥ 14 days, T ≥ 6 months Body weight (kg) 7–15: 12 mg/3 mg/kg/time, twice daily for 1–2 weeks 15–40: 10 mg/2.5 mg/kg/time, twice daily for 1–2 weeks > 40: 400 mg/100 mg/time, twice daily for 1–2 weeks Contraindication: patients with severe hepatic insufficiency Not be recommended: children with jaundice Ribavirin China: oral dosage forms ≥ 6 years USA and Europe: oral dosage forms ≥ 3 years

fulltextpubmed· Body· item PMC7090514

7–15: 12 mg/3 mg/kg/time, twice daily for 1–2 weeks 15–40: 10 mg/2.5 mg/kg/time, twice daily for 1–2 weeks > 40: 400 mg/100 mg/time, twice daily for 1–2 weeks Contraindication: patients with severe hepatic insufficiency Not be recommended: children with jaundice Ribavirin China: oral dosage forms ≥ 6 years USA and Europe: oral dosage forms ≥ 3 years Intravenous infusion at a dose of 10 mg/kg every time (maximum 500 mg every time), 2–3 times daily Not be recommended: CrCl < 50 mL/min Should be discontinued: SCr > 2 mg/dL Warning: hemolytic anemia CD Using with caution No recommendation Acute poisoning is usually fatal with a dose of 50 mg/kg Arbidol ≥ 2 years for influenza in Russia No recommendation Using with caution in patients with liver dysfunction IFN-α interferon-α, LPVr lopinavir/ritonavir, CD chloroquine diphosphate, COVID-19 coronavirus disease 2019, CrCl creatinine clearance, SCr serum creatinine, OS oral solutions, T tablets

fulltextpubmed· Body· item PMC7090514

a dose of 50 mg/kg Arbidol ≥ 2 years for influenza in Russia No recommendation Using with caution in patients with liver dysfunction IFN-α interferon-α, LPVr lopinavir/ritonavir, CD chloroquine diphosphate, COVID-19 coronavirus disease 2019, CrCl creatinine clearance, SCr serum creatinine, OS oral solutions, T tablets IFN-α IFN-α is a broad-spectrum antiviral drug, which could inhibit the synthesis of viral RNA and inhibit viral replication and spread. IFN-α, combined with ribavirin, which could reduce viral replication, moderated the host response and improved clinical outcome in MERS-CoV infected rhesus macaques [2]. In China, IFN-α is available in injections, sprays, gels, etc. IFN-α nebulization or spray are commonly used in children for treating bronchiolitis [3, 4], herpes angina [5, 6], hand-foot-mouth disease [7, 8], etc. In the experts' consensus statements, it could be also used for treatment of COVID-19 in children [9], IFN-α is the only antiviral drug which is clearly recommended to be used in children with COVID-19.

fulltextpubmed· Body· item PMC7090514

mmonly used in children for treating bronchiolitis [3, 4], herpes angina [5, 6], hand-foot-mouth disease [7, 8], etc. In the experts' consensus statements, it could be also used for treatment of COVID-19 in children [9], IFN-α is the only antiviral drug which is clearly recommended to be used in children with COVID-19. IFN-α nebulization can be given at a dosage of 200,000–400,000 IU/kg or 2–4 μg/kg (in 2 mL sterile water) two times daily for 5–7 days. IFN-α2b spray can be used for high-risk populations who have a close history of contact with suspected infected patients or those with only upper respiratory tract symptoms in the early phase. One to two sprays can be used on each nostril, and 8–10 sprays on the oropharynx. The dose of IFN-α2b injection is 8000 IU, once every 1–2 h, 8–10 sprays/day for 5–7 days. Intramuscular injection of high-dose IFN-α (> 2 μg/kg/time) could cause myelosuppression in children [10]. Overdose of IFN-α also could cause liver enzyme abnormalities, renal failure, bleeding, etc. It should be cautious while prescribing for children.

fulltextpubmed· Body· item PMC7090514

ection is 8000 IU, once every 1–2 h, 8–10 sprays/day for 5–7 days. Intramuscular injection of high-dose IFN-α (> 2 μg/kg/time) could cause myelosuppression in children [10]. Overdose of IFN-α also could cause liver enzyme abnormalities, renal failure, bleeding, etc. It should be cautious while prescribing for children. IFN-α is contraindicated in patients with abnormal liver function. In children with creatinine clearance (CrCl) below 50 mL/min, IFN-α is prohibited. IFN-α is also contraindicated in children with histories of mental illness, severe or unstable heart disease, or aplastic anemia. IFN-α nebulization should be used with caution in neonates and infants younger than 2 months [10]. Adverse reactions of IFN-α mainly include low-grade fever and flu-like symptoms (both in children with intramuscularly injection) [11]. Growth and development inhibition is more common when combining IFN-α with ribavirin. Suicidal ideation is more common in children (mainly adolescents) compared with adults (2.4% vs. 1%) [12]. To our knowledge, IFN-α has few drug interactions. However, IFN-α should be used with caution while combining with sleeping pills and sedatives.

fulltextpubmed· Body· item PMC7090514

pment inhibition is more common when combining IFN-α with ribavirin. Suicidal ideation is more common in children (mainly adolescents) compared with adults (2.4% vs. 1%) [12]. To our knowledge, IFN-α has few drug interactions. However, IFN-α should be used with caution while combining with sleeping pills and sedatives. Lopinavir/ritonavir (LPVr) LPVr is mainly used for treating HIV. Based on the clinical experiences in treating SARS [13] and MERS [14], LPVr is proposed to treat COVID-19. LPVr is available in oral tablets and solutions. LPVr oral solution is more suitable for children with a body surface area less than 0.6 m2 or those who are unable to swallow tablets. LPVr oral solution contains approximately 42% (v/v) ethanol and 15% (w/v) propylene glycol, which is not recommended in premature infants within 42 weeks and neonates within 14 days based on drug instructions in the USA [15]. In China, LPVr oral solution is suitable for children aged 6 months or older [16]. Differences in age limitation maybe due to different excipients and the manufacture process used. The dosage regimen of LPVr was recommended as follows [17]: LPVr tablets (200 mg/50 mg): 12 mg/3 mg/kg every time for the children with 7–15 kg body weight (BW); for those with BW of 15–40 kg, 10 mg/2.5 mg/kg every time; for those with BW of 40 kg or more, 400 mg/100 mg can be administrated every time. LPVr tablets are administered twice daily for 1–2 weeks.

fulltextpubmed· Body· item PMC7090514

ed as follows [17]: LPVr tablets (200 mg/50 mg): 12 mg/3 mg/kg every time for the children with 7–15 kg body weight (BW); for those with BW of 15–40 kg, 10 mg/2.5 mg/kg every time; for those with BW of 40 kg or more, 400 mg/100 mg can be administrated every time. LPVr tablets are administered twice daily for 1–2 weeks. Lopinavir (LPV) is mainly metabolized by the liver, so LPVr should be used with caution in patients with mild to moderate hepatic insufficiency, and contraindicated in patients with severe hepatic insufficiency. In addition, LPVr could cause increased PR interval, second- or third-degree cardiac block [18]. LPVr should be used with caution in children with congenital QT interval extension syndrome or hypokalemia. The most common adverse reactions of LPVr include diarrhea (adults 19.5%; children 12%), vomiting (adults 6.8%; children 21%), rash (adults 5%; children 12%), etc. [19]. Children are more likely to present with adverse reactions such as rash and vomiting, these symptoms should be closely monitored in children. For LPVr, lopinavir is a substrate of CYP3A enzyme, and ritonavir is a strong inhibitor of CYP3A enzyme. LPVr should be cautiously used while combining with drugs metabolized by CYP3A enzyme or drugs affecting CYP3A enzyme activity. For children with jaundice, LPVr may increase free bilirubin and exacerbate jaundice. Therefore, LPVr should not be used in children with jaundice.

fulltextpubmed· Body· item PMC7090514

navir is a strong inhibitor of CYP3A enzyme. LPVr should be cautiously used while combining with drugs metabolized by CYP3A enzyme or drugs affecting CYP3A enzyme activity. For children with jaundice, LPVr may increase free bilirubin and exacerbate jaundice. Therefore, LPVr should not be used in children with jaundice. Ribavirin Ribavirin is a broad-spectrum antiviral drug, which has inhibitory effects on RNA viruses and DNA viruses. Different dosage forms and age restrictions of ribavirin can be seen in China and other countries. In China, ribavirin is available in injections, oral dosage forms (capsules, granules, tablets), aerosols, etc. Clinical trials for oral dosage forms have not been carried out in children under 6 years in China, so oral ribavirin is not recommended to be used in children younger than 6 years in China. Ribavirin is available in oral dosage forms in USA and European countries and inhalation in USA. In these countries, the oral dosage forms are only recommended to be used in children aged 3 years or older. Intravenous infusion of ribavirin injections at a dose of 10 mg/kg every time (maximum 500 mg every time), 2–3 times daily was recommended for children with COVID-19 [17].

fulltextpubmed· Body· item PMC7090514

ropean countries and inhalation in USA. In these countries, the oral dosage forms are only recommended to be used in children aged 3 years or older. Intravenous infusion of ribavirin injections at a dose of 10 mg/kg every time (maximum 500 mg every time), 2–3 times daily was recommended for children with COVID-19 [17]. Ribavirin should be used with caution in patients with abnormal liver function. In patients with creatinine clearance (CrCl) below 50 mL/min, ribavirin is not recommended. In patients with serum creatinine (SCr) higher than 2 mg/dL, ribavirin should be discontinued. The most common adverse reactions of ribavirin in children include fever (80%), headache (62%), neutropenia (33%), fatigue (30%), etc. [20]. Ribavirin should be noted to enter red blood cells and can be largely accumulated, which could lead to hemolytic anemia [21, 22]. Large doses of ribavirin could cause decreased hemoglobin and serious heart damage. Children with heart diseases should be suggested to avoid using ribavirin. If necessary, ribavirin should not be given at a high dose and the hemoglobin and hematocrit should be closely monitored.

fulltextpubmed· Body· item PMC7090514

ould lead to hemolytic anemia [21, 22]. Large doses of ribavirin could cause decreased hemoglobin and serious heart damage. Children with heart diseases should be suggested to avoid using ribavirin. If necessary, ribavirin should not be given at a high dose and the hemoglobin and hematocrit should be closely monitored. Chloroquine diphosphate (CD) CD is an optimized drug based on the structure from a classic antimalarial drug named quinine which is mainly used for malaria, parenteral amoebiasis, etc. CD has shown apparent efficacy in treating COVID-19 in adult clinical trials [23]. CD is available in oral tablets and injections. CD tablets were recommended for oral administration in 18–65 years of infected adults at a dose of 0.5 g every time, twice daily [1], for 7 days. For BW ≤ 50 kg patients, CD dosage needs to be decreased to 0.5 g, once daily, during 3–7 days after administration in later released file [24]. There is no dosage recommendation of CD in COVID-19 children so far. Acute poisoning of CD is usually fatal with a dose of 50 mg/kg according to the instruction. A report regarded chloroquine concentration > 25 μmol/L as a fatal predictor [25]. Extreme caution should be followed while prescribing CD for children.

fulltextpubmed· Body· item PMC7090514

[24]. There is no dosage recommendation of CD in COVID-19 children so far. Acute poisoning of CD is usually fatal with a dose of 50 mg/kg according to the instruction. A report regarded chloroquine concentration > 25 μmol/L as a fatal predictor [25]. Extreme caution should be followed while prescribing CD for children. CD should be used with caution in patients with heart diseases, liver or kidney dysfunction, hematoporphyria, mental illness. There are mild adverse reactions of CD in treating malaria, including dizziness, headache, loss of appetite, etc. [26]. At higher doses of CD, the main adverse reaction is ocular toxicity, which could affect vision. If eye discomfort or visual abnormality occurs, CD should be discontinued. Other adverse reactions of CD include arrhythmia, drug-induced psychosis, leukopenia, etc. CD is mainly metabolized by liver and the burden of liver could be aggravated while combining with the other drugs (e.g., chlorpromazine) metabolized by liver. CD has a direct inhibitory effect on neuromuscular junctions, which could be aggravated while combining with drugs (e.g., clindamycin, streptomycin, gentamicin, etc.). Combination of CD with heparin could increase bleeding risk. For the patients with digitalization, CD could cause cardiac block. Other drug interactions (with indomethacin, thyroxine, isoniazid, etc.) also need to be noted.

fulltextpubmed· Body· item PMC7090514

ld be aggravated while combining with drugs (e.g., clindamycin, streptomycin, gentamicin, etc.). Combination of CD with heparin could increase bleeding risk. For the patients with digitalization, CD could cause cardiac block. Other drug interactions (with indomethacin, thyroxine, isoniazid, etc.) also need to be noted. Arbidol Arbidol (umifenovir) is a broad-spectrum antiviral compound approved in Russia and China for prophylaxis and treatment of influenza. This compound shows activities against numerous DNA and RNA viruses [27]. Arbidol was found to be effective to SARS-CoV-2 in vitro [28]. Arbidol is available in oral dosage forms in China and Russia [29]. The dosage regimen of arbidol (0.2 g every time, twice daily, not be given over 10 days) in adults with COVID-19 was recommended [1]. There is no recommendation of dosage regimen of arbidol in children with COVID-19 so far. Arbidol is mainly metabolized by the liver, it should be used with caution in patients with liver dysfunction. Adverse reactions include nausea, diarrhea, dizziness, elevated serum aminotransferase, etc. The average plasma protein binding (PB) rate of arbidol is 89.2–91.6%. Arbidol could compete with drugs of higher PB rate for plasma protein, leading to increased concentration of combined drugs.

fulltextpubmed· Body· item PMC7090514

atients with liver dysfunction. Adverse reactions include nausea, diarrhea, dizziness, elevated serum aminotransferase, etc. The average plasma protein binding (PB) rate of arbidol is 89.2–91.6%. Arbidol could compete with drugs of higher PB rate for plasma protein, leading to increased concentration of combined drugs. In conclusion, all antiviral drugs are only tried to be used for treating COVID-19. Antiviral drugs should be used after weighing advantages and disadvantages with caution in children. For those with mild symptoms, low dosage of IFN-α nebulization can be used. In addition, LPVr is a choice for COVID-19 children. Ribavirin is usually used as a combined drug. The combination of three or more antiviral drugs at the same time is not recommended. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions YW and LQZ drafted, revised, reviewed, and approved the final manuscript. Funding There is no funding data for this article. Compliance with ethical standards Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Conflict of interest Author declares no conflict of interests in the past 36 months.

fulltextpubmed· Body· item PMC7090695

Introduction The outbreak of coronavirus disease 2019 (COVID-19; formally known as 2019-nCoV), has become a most challenging health emergency [1, 2]. Based on the current epidemiological and clinical evidences, the incubation period in pediatric patients ranges from 1 to 14 days [3]. So far, no documented cases of vertical transmission from mother to fetus have been reported [4]; however, mild-to-moderate respiratory distress, fever, thrombocytopenia, increased transaminase, and other non-specific presentations in neonates with negative tests who were born to infected mother warranted further studies on vertical transmission [5].

fulltextpubmed· Body· item PMC7090695

ertical transmission from mother to fetus have been reported [4]; however, mild-to-moderate respiratory distress, fever, thrombocytopenia, increased transaminase, and other non-specific presentations in neonates with negative tests who were born to infected mother warranted further studies on vertical transmission [5]. Owing to rigorous quarantine and control measures taken in China, routine neonatal health surveillance and follow-up have become challenging. Women and children are vulnerable to COVID-19 infection, so avoidance of routine hospital visits is recommended by the National Health Commission of China. However, delayed treatment of rapid and progressive newborn diseases can occur. Neonatal out-patient visits are of utmost important to those with hyperbilirubinemia. For unrecognized and accelerated severe early neonatal hyperbilirubinemia, appropriate interventions are utmost important to reduce the risks of neurological dysfunction, kernicterus, or even death. From a national survey in neonates in China in 2009, 348 cases of kernicterus were reported among 33 hospitals. An important finding of the study is that these patients presented with symptoms around ages of 5–6 days, and were mostly at home [6]. The characteristics of onset age of kernicterus suggest that monitoring of bilirubin level at home is a useful way to alert hospital visit and to prevent the development of extreme hyperbilirubinemia.

fulltextpubmed· Body· item PMC7090695

nding of the study is that these patients presented with symptoms around ages of 5–6 days, and were mostly at home [6]. The characteristics of onset age of kernicterus suggest that monitoring of bilirubin level at home is a useful way to alert hospital visit and to prevent the development of extreme hyperbilirubinemia. Therefore, we developed an online follow-up program for convenient monitoring of bilirubin level of newborns that is based on our practical experiences. The aim is to make our management strategies of neonatal jaundice tailored to the infection prevention and control during the COVID-19 epidemic. Management strategies during hospitalization Risk factor screening for severe hyperbilirubinemia Risk factors of severe hyperbilirubinemia include preterm birth, perinatal asphyxia, sepsis, metabolic acidosis, isoimmune hemolysis, glucose-6-phosphate dehydrogenase (G-6-PD) deficiency, cephalohematoma, significant skin bruising, hypoalbuminemia, jaundice observed in the first 24 hours, and exclusive breastfeeding with excessive weight loss [7]. Maternal medical history and birth history should be reviewed in detail. Every newborn infant should be examined comprehensively. According to the history, physical examination and risk factors, necessary diagnostic investigations, and laboratory tests (total serum bilirubin, count of blood cell, hematocrit, liver function, blood type, Coomb’s test, G-6-PD screening, head ultrasound, etc.) were chosen to explore the underlying conditions.

fulltextpubmed· Body· item PMC7090695

sively. According to the history, physical examination and risk factors, necessary diagnostic investigations, and laboratory tests (total serum bilirubin, count of blood cell, hematocrit, liver function, blood type, Coomb’s test, G-6-PD screening, head ultrasound, etc.) were chosen to explore the underlying conditions. Early establishment of breastfeeding For infants without contraindications of enteral feeding, breastfeeding should be started at 20–30 min after birth. Infant’s weight is measured every 1–2 days. Breastfed infants usually reach the maximum weight loss by day 3 of age, and most lose weight less than 10% of their birth weight. If the weight loss is more than 10%, the adequacy of milk intake should be evaluated. Other evidence of adequate intake includes 4–6 thoroughly wet diapers in 24 h and the passage of 3–4 stools per day by the fourth day [7]. Medical staff should evaluate mother’s lactation skills every day and identify the risks of inadequate breast milk intake promptly.

fulltextpubmed· Body· item PMC7090695

the adequacy of milk intake should be evaluated. Other evidence of adequate intake includes 4–6 thoroughly wet diapers in 24 h and the passage of 3–4 stools per day by the fourth day [7]. Medical staff should evaluate mother’s lactation skills every day and identify the risks of inadequate breast milk intake promptly. Monitoring and management of hyperbilirubinemia before discharge Jaundice is usually seen first in the face of the infant, and then progresses to the trunk and extremities. Since the visual estimation of the degree of jaundice is not reliable, we recommend transcutaneous bilirubin (TCB) measurement as the first choice. The interval between two measurements is 12–24 h. The results should be recorded in the chart. TCB is correlated with total serum bilirubin (TSB) decreasing as serum bilirubin concentration higher than 255 μmol/L (15 mg/dL), so TSB should be checked to confirm when TCB > 255 μmol/L. During the first days after birth, the bilirubin level is changing dynamically, so we use the hour-specific nomogram developed by Bhutani to predict the subsequent severe hyperbilirubinemia [8]. The bilirubin level below the 40th percentile is labeled as a low-risk zone and that above the 95th is labeled as a high-risk zone. Bilirubin levels between 40 to 75th and 75th to 95th percentile are low–intermediate-risk zone and high–intermediate-risk zone, respectively.

fulltextpubmed· Body· item PMC7090695

the subsequent severe hyperbilirubinemia [8]. The bilirubin level below the 40th percentile is labeled as a low-risk zone and that above the 95th is labeled as a high-risk zone. Bilirubin levels between 40 to 75th and 75th to 95th percentile are low–intermediate-risk zone and high–intermediate-risk zone, respectively. The management plan is developed based on the risk zones as follows:TCB level < 75th percentile (low-risk or low–intermediate-risk zone): the risk of subsequent significant hyperbilirubinemia is low; infants just need routine care and repeated TCB in 24 hours. TCB level between 75 and 95th percentile (high–intermediate-risk zone) without any risk factors: the risk of subsequent significant hyperbilirubinemia is still low; infants just need routine care and repeat TCB in 24 hours. TCB level between 75 and 95th percentile (high–intermediate-risk zone) with at least one of the risk factors: the risk of subsequent significant hyperbilirubinemia is high; infants need aggressive breast feeding, ensure adequate intake and reduce the enterohepatic circulation. TCB should be repeated in 12 hours. Evaluate the causes of jaundice. TCB level > 95th percentile (high-risk zone): the risk of subsequent significant hyperbilirubinemia is very high; TSB should be checked. Infants need prompt intervention, start phototherapy, or exchange transfusion if the criteria met. Monitor the bilirubin level closely and evaluate the causes of jaundice.

fulltextpubmed· Body· item PMC7090695

TCB level between 75 and 95th percentile (high–intermediate-risk zone) with at least one of the risk factors: the risk of subsequent significant hyperbilirubinemia is high; infants need aggressive breast feeding, ensure adequate intake and reduce the enterohepatic circulation. TCB should be repeated in 12 hours. Evaluate the causes of jaundice. TCB level > 95th percentile (high-risk zone): the risk of subsequent significant hyperbilirubinemia is very high; TSB should be checked. Infants need prompt intervention, start phototherapy, or exchange transfusion if the criteria met. Monitor the bilirubin level closely and evaluate the causes of jaundice. Parenting education With the rapid development of internet technology, smartphone application software (APP) has been used successfully in the monitoring for transcutaneous bilirubin level of newborn infants [9, 10]. We use online training instead of the classroom teaching during the epidemic. Parents can access the resources including education videos and training brochures on social media. Every parent should be fully informed of the potential harm of hyperbilirubinemia, the importance of bilirubin monitoring, the availability of online resources, and methods for assessing a newborn infant’s condition. In addition, detailed information about COVID-19 and prevention strategies should be provided.

fulltextpubmed· Body· item PMC7090695

l media. Every parent should be fully informed of the potential harm of hyperbilirubinemia, the importance of bilirubin monitoring, the availability of online resources, and methods for assessing a newborn infant’s condition. In addition, detailed information about COVID-19 and prevention strategies should be provided. Discharge Indications of discharge Healthy newborn infants with gestational age at 35 or more weeks are usually discharged on days 2 or 3 if the vital signs are stable, if feeding is good and daily weight loss is less than 3% of birth weight, and if the value of TCB on the day of discharge is below the 75th percentile. For the newborn infants admitted to the special care nursery or neonatal intensive-care unit, the indications of discharge include the following: (1) the underlying disease is cured or significantly improved; (2) the vital signs are stable; (3) infants who had been treated with phototherapy and/or exchange transfusion should be observed for at least 24 to 48 hours to make sure of no obvious rebound of bilirubin; (4) the TCB value on the day of discharge is below the 75th percentile.

fulltextpubmed· Body· item PMC7090695

sease is cured or significantly improved; (2) the vital signs are stable; (3) infants who had been treated with phototherapy and/or exchange transfusion should be observed for at least 24 to 48 hours to make sure of no obvious rebound of bilirubin; (4) the TCB value on the day of discharge is below the 75th percentile. Follow-up strategy The follow-up plan is made based on the gestational age of infants, days after birth, and the bilirubin level on discharge day. The time schedule of the first online follow-up is listed in Table 1. Parents should be advised to use the APP software for remote follow-up and online consultation. Doctors will give the color calibration card for transcutaneous bilirubin measurement to parents. The remote follow-up route is mainly through Internet hospitals or other qualified Internet platforms. Under the guidance of healthcare workers, parents can make an appointment in Internet hospital before infants discharged home.Table 1 Time schedule of online follow-up after discharge Age at discharge (h) Bilirubin level at discharge (percentile) Timing for the first online follow-up 48–72  < 40th 2–3 d after discharge 40th–75th 1–2 d after discharge 72–96  < 40th 3–5 d after discharge 40th–75th 2–3 d after discharge 96–120 or more  < 40th 3–5 d after discharge 40th–75th 2–3 d after discharge

fulltextpubmed· Body· item PMC7090695

Follow-up strategy The follow-up plan is made based on the gestational age of infants, days after birth, and the bilirubin level on discharge day. The time schedule of the first online follow-up is listed in Table 1. Parents should be advised to use the APP software for remote follow-up and online consultation. Doctors will give the color calibration card for transcutaneous bilirubin measurement to parents. The remote follow-up route is mainly through Internet hospitals or other qualified Internet platforms. Under the guidance of healthcare workers, parents can make an appointment in Internet hospital before infants discharged home.Table 1 Time schedule of online follow-up after discharge Age at discharge (h) Bilirubin level at discharge (percentile) Timing for the first online follow-up 48–72  < 40th 2–3 d after discharge 40th–75th 1–2 d after discharge 72–96  < 40th 3–5 d after discharge 40th–75th 2–3 d after discharge 96–120 or more  < 40th 3–5 d after discharge 40th–75th 2–3 d after discharge Remote follow-up after discharge General condition evaluation The parents shall fill in the questionnaire on the APP software, including the general conditions of the infant, feeding issues, weight changes, abnormal clinical symptoms, etc. (Table 2).Table 2 Questionnaire for online follow-up evaluation Contents General situations 1. What is baby’s temperature today? 2. The change of weight 3. How many wet diapers changing per day? 4. Less or very low crying 5. High or pitched crying 6. Color of lips (blue/purple/pale) 7. Any labored breathing? 8. Is there any abnormal movements?

fulltextpubmed· Body· item PMC7090695

Remote follow-up after discharge General condition evaluation The parents shall fill in the questionnaire on the APP software, including the general conditions of the infant, feeding issues, weight changes, abnormal clinical symptoms, etc. (Table 2).Table 2 Questionnaire for online follow-up evaluation Contents General situations 1. What is baby’s temperature today? 2. The change of weight 3. How many wet diapers changing per day? 4. Less or very low crying 5. High or pitched crying 6. Color of lips (blue/purple/pale) 7. Any labored breathing? 8. Is there any abnormal movements? Jaundice 1. TCB level (via the smartphone APP) 2. Degree of jaundice assessed by observation (Involving the head, trunk, limbs, palm) in natural lighta Feeding issues 1. Breast feeding or formula feeding? 2. The frequency of feeding per day 3. Vomiting or not aThe smartphone APP for TCB measurement is not available

fulltextpubmed· Body· item PMC7090695

8. Is there any abnormal movements? Jaundice 1. TCB level (via the smartphone APP) 2. Degree of jaundice assessed by observation (Involving the head, trunk, limbs, palm) in natural lighta Feeding issues 1. Breast feeding or formula feeding? 2. The frequency of feeding per day 3. Vomiting or not aThe smartphone APP for TCB measurement is not available Evaluation of risks of jaundice Parents can download and install the APP software on the smart phone for remote follow-up and bilirubin monitoring. Parents may practice using the software under the direction of medical staff. After downloading and installing the APP on a smartphone, parents can place a color calibration card (a modified Macbeth Color Checker card with a small hollow square area) on the skin over the sternum of the newborn, then start the APP, and take a photo of the card by smartphone camera. The image data will be transmitted to the cloud for analysis, the results of transcutaneous bilirubin level will be given automatically in several seconds and will be forwarded to the associated medical staff’s smartphone simultaneously. According to the time schedule in Table 1, parents check the TCB level by smartphone as described above. After getting the results, the neonatologists would give advice to parents based on the newborn's situation and the TCB level. If the measured TCB level is variable, parents should recheck it under good lighting condition. If an alarm value is indicated by the software, parents should take the neonates to the hospital. The frequency of bilirubin measurement can be increased at any time if parents feel their infant’s jaundice is getting more significant.

fulltextpubmed· Body· item PMC7090695

sured TCB level is variable, parents should recheck it under good lighting condition. If an alarm value is indicated by the software, parents should take the neonates to the hospital. The frequency of bilirubin measurement can be increased at any time if parents feel their infant’s jaundice is getting more significant. Vaccination recommendation The WHO vaccination guidelines did not regard neonatal jaundice as the contraindication of vaccination, and there was no clinical evidence that high bilirubin level is an effect of vaccination. However, during the period of epidemic, we suggest that routine vaccination be postponed according to the experts' consensus [11]. Out-patient clinic visiting Indications During the online follow-up, if any of the following criteria are met, the newborn infant should be taken to the hospital as soon as possible: (1) inadequate milk intake and lethargy; (2) the weight has not return to birth weight by 7–10 days of age; (3) presentation of any other symptoms, such as dyspnea, fever or hypothermia, frequent vomiting, seizure, etc.; (4) the bilirubin level > 95th percentile in the first week after birth or more than 255 μmol/L (15 mg/dL) after 7 days of age, or the increment of bilirubin level is beyond 5 mg/dL within 24 h; (5) the doctors in charge of the online follow-up suggesting need of an out-patient visit.

fulltextpubmed· Body· item PMC7090695

frequent vomiting, seizure, etc.; (4) the bilirubin level > 95th percentile in the first week after birth or more than 255 μmol/L (15 mg/dL) after 7 days of age, or the increment of bilirubin level is beyond 5 mg/dL within 24 h; (5) the doctors in charge of the online follow-up suggesting need of an out-patient visit. Prevention strategies for infants visiting the clinic During the epidemic, we should pay high attention to the prevention and control of COVID-19 infection. For each infant visiting the clinic, we should collect the epidemiological history of the infant, the families, caregivers, and visitors during the previous 14 days and we also should measure the body temperature routinely. Infants can be admitted to the special nursery if without any close contact history with an infected person including family members, caregivers, and visitors. For infants with significant hyperbilirubinemia, we recommend intervention after admission, as the out-patient daytime phototherapy will increase the risk of SARS-CoV-2 infection. If the infant, family member or caregivers are exposed to any infected person, the infant should be considered as suspected case of infection and should be admitted to a single isolation room with protection. The infant should be settled in an incubator instead of a radiant warmer.

fulltextpubmed· Body· item PMC7090695

Infants can be admitted to the special nursery if without any close contact history with an infected person including family members, caregivers, and visitors. For infants with significant hyperbilirubinemia, we recommend intervention after admission, as the out-patient daytime phototherapy will increase the risk of SARS-CoV-2 infection. If the infant, family member or caregivers are exposed to any infected person, the infant should be considered as suspected case of infection and should be admitted to a single isolation room with protection. The infant should be settled in an incubator instead of a radiant warmer. If the infant is critically ill or if the hospital has not been equipped with an isolation unit, emergency transport should be launched. The transport should be organized by the public health administrative department. The transport team should include a physician, nurse, and ambulance driver. All team members should be well trained with the knowledge and skills about COVID-19 infection prevention [11]. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions MXL and CZ contributed equally to this paper. All authors take part in drafting the paper and approved the final version. Funding: This paper was supported by Zhejiang University Special Scientific Research Fund for COVID-19 Prevention and Control. Compliance with ethical standards Ethical approval Not required. Conflict of interest The authors have no financial relationships relevance to the article to disclose.

fulltextpubmed· Body· item PMC7090771

Background In December, 2019, a cluster of pneumonia cases, who were later proven to be caused by a novel coronavirus (named as “2019-nCoV”), emerged in Wuhan City, Hubei Province, China. By January 30, 2020, 9692 confirmed cases and 15,238 suspected cases have been reported around 31 provinces and cities in China. Among the confirmed cases, 1527 were severe cases, 171 had recovered and been discharged at home, and 213 died. Twenty-eight confirmed cases aged from 1 month to 17 years had been reported in China [1]. Coronavirus (CoV) belongs to the Coronaviridae family, Nidovirales order. CoVs are divided into four genera: α-, β-, γ-, and δ-coronavirus. α- and β-coronaviruses only infect mammals, whereas γ- and δ-coronaviruses mainly infect birds, with a few infecting mammals. Human CoVs include α-coronaviruses (229E and NL63), β-coronaviruses (OC43 and HKU1), the Middle East respiratory syndrome-related coronavirus (MERS-CoV), severe acute respiratory syndrome-related coronavirus (SARS-CoV), and 2019-nCoV. The 2019-nCoV belongs to the β-coronavirus genus [2], which includes bat-SARS-like (SL)-CoVZC45, bat-SL-CoVZXC21, SARS-CoV, MERS-CoV, and 2019-nCoV. Current studies have revealed that 2019-nCoV may originate from wild animals, but the exact origin remains unclear.

fulltextpubmed· Body· item PMC7090771

syndrome-related coronavirus (SARS-CoV), and 2019-nCoV. The 2019-nCoV belongs to the β-coronavirus genus [2], which includes bat-SARS-like (SL)-CoVZC45, bat-SL-CoVZXC21, SARS-CoV, MERS-CoV, and 2019-nCoV. Current studies have revealed that 2019-nCoV may originate from wild animals, but the exact origin remains unclear. 2019-nCoV infected patients are the main infection sources. However, we also should attach importance to asymptomatic cases which may play a critical role in the transmission process. Respiratory droplets and contact are the main transmission routes [3]. Close contact with symptomatic cases and asymptomatic cases with silent infection are the main transmission routes of 2019-nCoV infection in children. People of all ages are susceptible to 2019-nCoV. The elderly and those with underlying chronic diseases are more likely to become severe cases. Thus far, all pediatric cases with laboratory-confirmed 2019-nCoV infection were mild cases, and no deaths had been reported. For standardizing the prevention and treament of 2019-nCoV infections in children, we called up an experts’ committee to formulate this consensus statement. This statement is based on the Novel Coronavirus Infection Pneumonia Diagnosis and Treatment Standards (the fourth edition) (National Health Committee) and other previous diagnosis and treatment strategies for pediatric virus infections.

fulltextpubmed· Body· item PMC7090771

hildren, we called up an experts’ committee to formulate this consensus statement. This statement is based on the Novel Coronavirus Infection Pneumonia Diagnosis and Treatment Standards (the fourth edition) (National Health Committee) and other previous diagnosis and treatment strategies for pediatric virus infections. Clinical manifestations Based on the current epidemiological data, the incubation period of 2019-nCoV infections ranges from 1 to 14 days, mostly ranging from 3 to 7 days. Current reported data of pediatric cases revealed that the age of disease onset ranged from 1.5 months to 17 years, most of whom had a close contact with infected cases or were family cluster cases [4]. Infected children might appear asymptomatic [5] or present with fever, dry cough, and fatigue, and few have upper respiratory symptoms including nasal congestion and running nose; some patients presented with gastrointestinal symptoms including abdominal discomfort, nausea, vomiting, abdominal pain, and diarrhea.

fulltextpubmed· Body· item PMC7090771

[4]. Infected children might appear asymptomatic [5] or present with fever, dry cough, and fatigue, and few have upper respiratory symptoms including nasal congestion and running nose; some patients presented with gastrointestinal symptoms including abdominal discomfort, nausea, vomiting, abdominal pain, and diarrhea. Most infected children have mild clinical manifestations. They have no fever or symptoms of pneumonia with a good prognosis. Most of them recover within 1–2 weeks after disease onset. Few may progress to lower respiratory infections. No newborns delivered by 2019-nCoV infected mothers have been detected positive; and no newborn cases have been reported yet. It should be noted that clinical manifestations in pediatric patients should be further defined after collecting more pediatric case data. Furthermore, the number of confirmed infected cases will increase after a wide use of pathogen analysis. Data from adults reveal that severe cases often develop dyspnea one week after disease onset. Severe cases may rapidly progress to acute respiratory distress syndrome (ARDS), septic shock, refractory metabolic acidosis, and coagulation dysfunction [6, 7]. Although no deaths in children have been reported up to now, the potential risk of death should be highlighted. Though clinical symptoms in pediatric patients are relatively milder compared with those in adult patients, ARDS and death cases also occurred in infected children during the SARS and MERS epidemics [8–11]. Auxiliary examinations Laboratory examination [3]

fulltextpubmed· Body· item PMC7090771

Data from adults reveal that severe cases often develop dyspnea one week after disease onset. Severe cases may rapidly progress to acute respiratory distress syndrome (ARDS), septic shock, refractory metabolic acidosis, and coagulation dysfunction [6, 7]. Although no deaths in children have been reported up to now, the potential risk of death should be highlighted. Though clinical symptoms in pediatric patients are relatively milder compared with those in adult patients, ARDS and death cases also occurred in infected children during the SARS and MERS epidemics [8–11]. Auxiliary examinations Laboratory examination [3] In the early phase of the disease, white blood cell count is normal or decreased, with decreased lymphocyte count; liver enzymes, muscle enzymes, and myohemoglobin levels are increased in some patients. Most patients display elevated C-reactive protein level and erythrocyte sedimentation rates, and normal procalcitonin levels. Severe cases show high D-dimer levels and progressively decreased blood lymphocytes counts. Samples from throat swabs (better using nasopharyngeal swab in children), sputum, lower respiratory tract secretions, stool and blood, etc. are tested positive for 2019-nCoV nucleic acids.

fulltextpubmed· Body· item PMC7090771

Most patients display elevated C-reactive protein level and erythrocyte sedimentation rates, and normal procalcitonin levels. Severe cases show high D-dimer levels and progressively decreased blood lymphocytes counts. Samples from throat swabs (better using nasopharyngeal swab in children), sputum, lower respiratory tract secretions, stool and blood, etc. are tested positive for 2019-nCoV nucleic acids. Chest imaging examination [3] Suspected cases or confirmed cases should undertake chest X-ray examination as soon as possible. Chest CT scan is required when necessary. In the early stage of disease, chest images show multiple small plaques and interstitial changes, which are obvious in the lung periphery, further deteriorate to bilateral multiple ground-glass opacity and/or infiltrating shadows. Lung consolidation may occur in severe cases. Pleural effusion is rarely seen. Diagnosis Suspected cases 2019-nCoV should be suspected in patients who meet any one of the criteria in the epidemiological history and any two of the criteria in clinical manifestations. Epidemiological history Children with a travel or residence history in Wuhan city and neighboring areas, or other areas with persistent local transmission within 14 days prior to disease onset; Children with a history of contacting patients with fever or respiratory symptoms who have a history of contact with patients from Wuhan city and neighboring areas, or other areas with persistent local transmission within 14 days prior to disease onset; Children who are related with a cluster outbreak or close contact with 2019-nCoV infected cases;

fulltextpubmed· Body· item PMC7090771

Children with a history of contacting patients with fever or respiratory symptoms who have a history of contact with patients from Wuhan city and neighboring areas, or other areas with persistent local transmission within 14 days prior to disease onset; Children who are related with a cluster outbreak or close contact with 2019-nCoV infected cases; Newborns delivered by confirmed 2019-nCoV-infected mothers. Clinical manifestations Fever, fatigue, dry cough; some pediatric patients may have low-grade fever or no fever; With above-mentioned chest imaging findings (refer to the section of Chest imaging examination); In the early phase of the disease, white blood cell count is normal or decreased, or with decreased lymphocyte count; No other pathogens are detected which can fully explain the clinical manifestations. Confirmed cases Suspected cases who meet any one of the following criteria [3]:Respiratory tract or blood samples tested positive for 2019-nCoV nucleic acid using RT-PCR; Genetic sequencing of respiratory tract or blood samples is highly homologous with the known 2019-nCoV. Clinical classifications Asymptomatic infection (silent infection) Children tested positive for 2019-nCoV, but without manifestations of clinical symptoms or abnormal chest imaging findings. Acute upper respiratory tract infection Children with only fever, cough, pharyngeal pain, nasal congestion, fatigue, headache, myalgia or discomfort, etc., and without signs of pneumonia by chest imaging or sepsis. Mild pneumonia

fulltextpubmed· Body· item PMC7090771

Children tested positive for 2019-nCoV, but without manifestations of clinical symptoms or abnormal chest imaging findings. Acute upper respiratory tract infection Children with only fever, cough, pharyngeal pain, nasal congestion, fatigue, headache, myalgia or discomfort, etc., and without signs of pneumonia by chest imaging or sepsis. Mild pneumonia Children with or without fever, respiratory symptoms such as cough; and chest imaging indicating pneumonia, but not reaching the criteria of severe pneumonia. Severe pneumonia Meeting any of the following criteria [3, 12–15]:Increased respiratory rate: ≥ 70 times/min (< 1 year), ≥ 50 times/min (≥ 1 year) (after ruling out the effects of fever and crying); Oxygen saturation < 92%; Hypoxia: assisted breathing (moans, nasal flaring, and three concave sign), cyanosis, intermittent apnea; Disturbance of consciousness: somnolence, coma, or convulsion; Food refusal or feeding difficulty, with signs of dehydration. Critical cases Those who meet any of the following criteria and require ICU care: Respiratory failure requiring mechanical ventilation; Shock; Combined with other organs failure.

fulltextpubmed· Body· item PMC7090771

Hypoxia: assisted breathing (moans, nasal flaring, and three concave sign), cyanosis, intermittent apnea; Disturbance of consciousness: somnolence, coma, or convulsion; Food refusal or feeding difficulty, with signs of dehydration. Critical cases Those who meet any of the following criteria and require ICU care: Respiratory failure requiring mechanical ventilation; Shock; Combined with other organs failure. Early identification of critical cases According to the experiences in diagnosis and treatment of community-acquired pneumonia in children, children with a history of contact with severe 2019-nCoV infected cases, or with underlying conditions (such as congenital heart disease, bronchial pulmonary hypoplasia, respiratory tract anomaly, with abnormal hemoglobin level, severe malnutrition), or with immune deficiency or immunocompromised status (under long-term use of immunosuppressants) who meet any one of the following criteria may become severe cases:Dyspnea: respiratory rate > 50 times/min for 2–12 months old; > 40 times/min for 1–5 years old; > 30 times/min in patients over 5 years old (after ruling out the effects of fever and crying); Persistent high fever for 3–5 days; Poor mental response, lethargy, disturbance of consciousness, and other changes of consciousness; Abnormally increased enzymatic indexes, such as myocardial enzymes, liver enzymes, lactate dehydrogenase; Unexplainable metabolic acidosis; Chest imaging findings indicating bilateral or multi-lobe infiltration, pleural effusion, or rapid progression of conditions during a very short period; Infants younger than 3 months;

fulltextpubmed· Body· item PMC7090771

Poor mental response, lethargy, disturbance of consciousness, and other changes of consciousness; Abnormally increased enzymatic indexes, such as myocardial enzymes, liver enzymes, lactate dehydrogenase; Unexplainable metabolic acidosis; Chest imaging findings indicating bilateral or multi-lobe infiltration, pleural effusion, or rapid progression of conditions during a very short period; Infants younger than 3 months; Extrapulmonary complications; Coinfection with other viruses and/or bacteria. Differential diagnosis [3] Differential diagnosis should be made to distinguish from influenza virus, parainfluenza virus, adenovirus, respiratory syncytial virus, rhinovirus, human metapneumovirus, SARS coronavirus, and other known viral infections, as well as mycoplasma pneumoniae and chlamydia pneumonia and bacterial pneumonia. The coinfection of 2019-nCoV with other viruses and/or bacteria should be considered in diagnosis. Treatment Treatment locations Based on their medical conditions, suspected patients should be isolated in a single room or self-isolated at home following the doctors’ advice. Confirmed cases can be admitted in the same ward. Critically cases should be admitted to ICU as soon as possible.

fulltextpubmed· Body· item PMC7090771

Differential diagnosis [3] Differential diagnosis should be made to distinguish from influenza virus, parainfluenza virus, adenovirus, respiratory syncytial virus, rhinovirus, human metapneumovirus, SARS coronavirus, and other known viral infections, as well as mycoplasma pneumoniae and chlamydia pneumonia and bacterial pneumonia. The coinfection of 2019-nCoV with other viruses and/or bacteria should be considered in diagnosis. Treatment Treatment locations Based on their medical conditions, suspected patients should be isolated in a single room or self-isolated at home following the doctors’ advice. Confirmed cases can be admitted in the same ward. Critically cases should be admitted to ICU as soon as possible. General treatment The general treatment strategies include bed rest and supportive treatment; ensuring sufficient calory and water intake; maintaining water electrolyte balance and homeostasis; monitoring vital signs and oxygen saturation; keeping respiratory tract unobstructed and inhaling oxygen when necessary; measuring blood routine, urine routine, C-reactive protein, and other blood biochemical indexes including liver and kidney function, myocardial enzyme spectrum, and coagulation function according to patients’ conditions. Blood gas analysis and timely re-examination of chest imaging should be performed when necessary.

fulltextpubmed· Body· item PMC7090771

; measuring blood routine, urine routine, C-reactive protein, and other blood biochemical indexes including liver and kidney function, myocardial enzyme spectrum, and coagulation function according to patients’ conditions. Blood gas analysis and timely re-examination of chest imaging should be performed when necessary. Symptomatic treatment The patients with high fever should be actively controlled. If patients’ body temperature exceeds 38.5 °C with obvious discomfort, physical cooling (warm water bath, use of antipyretic patch, etc.) or antipyretic drug treatment should be performed. Common drugs include: ibuprofen orally, 5–10 mg/kg every time; acetaminophen orally, 10–15 mg/kg every time. Keep children quiet and administrate sedatives immediately when convulsions or seizure occur. Oxygen therapy When hypoxia appears, effective oxygen therapy should be given immediately including nasal catheter, mask oxygen. Nasal high-flow oxygen therapy, and non-invasive or invasive mechanical ventilation should be undertaken when necessary.

fulltextpubmed· Body· item PMC7090771

Symptomatic treatment The patients with high fever should be actively controlled. If patients’ body temperature exceeds 38.5 °C with obvious discomfort, physical cooling (warm water bath, use of antipyretic patch, etc.) or antipyretic drug treatment should be performed. Common drugs include: ibuprofen orally, 5–10 mg/kg every time; acetaminophen orally, 10–15 mg/kg every time. Keep children quiet and administrate sedatives immediately when convulsions or seizure occur. Oxygen therapy When hypoxia appears, effective oxygen therapy should be given immediately including nasal catheter, mask oxygen. Nasal high-flow oxygen therapy, and non-invasive or invasive mechanical ventilation should be undertaken when necessary. Antiviral therapy Interferon-α [3, 16–28] Interferon-α can reduce viral load in the early stage of infection which can help to alleviate symptoms and shorten the course of disease. Based on our clinical research and experiences of using interferon-α in treating bronchiolitis, viral pneumonia, acute upper respiratory tract infection, hand foot mouth disease, SARS, and other viral infections in children, the recommended usage is as follows:Interferon-α nebulization: interferon-α 200,000–400,000 IU/kg or 2–4 μg/kg in 2 mL sterile water, nebulization two times per day for 5–7 days;

fulltextpubmed· Body· item PMC7090771

onchiolitis, viral pneumonia, acute upper respiratory tract infection, hand foot mouth disease, SARS, and other viral infections in children, the recommended usage is as follows:Interferon-α nebulization: interferon-α 200,000–400,000 IU/kg or 2–4 μg/kg in 2 mL sterile water, nebulization two times per day for 5–7 days; Interferon-α2b spray: applied for high-risk populations with a close contact with suspected 2019-nCoV infected patients or those in the early phase with only upper respiratory tract symptoms. Patients should use 1–2 sprays on each side of the nasal cavity, 8–10 sprays on the oropharynx, the dose of interferon-α2b per injection is 8000 IU, once every 1–2 hours, 8–10 sprays/day for a course of 5–7 days. Lopinavir/litonavir [3, 29, 30] Lopinavir/litonavir has been tried to apply to the treatment of adult patients with 2019-nCoV pneumonia, but its efficacy and safety remain to be determined. Usage of other agents Antibiotics [3, 12] Avoiding irrational use of antibiotics, especially in combination with broad-spectrum antibiotics. Paying close attention to the changes of conditions in children with coinfection of bacterial or fungal infection; actively collecting samples for pathogen analysis and timely or rational use of antibiotics or anti-fungal drugs. Arbidol [31], oseltamivir [32] and other anti-influenza drugs Arbidol is administrated for adults infected with 2019-nCoV; however, its efficacy and safety remain unclear. Oseltamivir and other anti-influenza agents can be applied for patients coinfected with other influenza virus.

fulltextpubmed· Body· item PMC7090771

Usage of other agents Antibiotics [3, 12] Avoiding irrational use of antibiotics, especially in combination with broad-spectrum antibiotics. Paying close attention to the changes of conditions in children with coinfection of bacterial or fungal infection; actively collecting samples for pathogen analysis and timely or rational use of antibiotics or anti-fungal drugs. Arbidol [31], oseltamivir [32] and other anti-influenza drugs Arbidol is administrated for adults infected with 2019-nCoV; however, its efficacy and safety remain unclear. Oseltamivir and other anti-influenza agents can be applied for patients coinfected with other influenza virus. Other drugs [3, 12] Glucocorticoids The use of glucocorticoids should be based on the severity of systemic inflammatory response, degree of dyspnea, with or without ARDS, and the progress status of chest imaging results. Glucocorticoids can be used in a short period (3–5 days). The recommended dose of methylprednisolone should not exceed 1–2 mg/kg/day. Immunoglobulin Immunoglobulin can be used in severe cases when indicated, but its efficacy needs further evaluation. Treatment of severe and critically ill cases [3, 12] On the basis of symptomatic treatment, we should actively prevent and treat complications, underlying diseases, secondary infection, and provide organ function support as indicated.

fulltextpubmed· Body· item PMC7090771

Immunoglobulin Immunoglobulin can be used in severe cases when indicated, but its efficacy needs further evaluation. Treatment of severe and critically ill cases [3, 12] On the basis of symptomatic treatment, we should actively prevent and treat complications, underlying diseases, secondary infection, and provide organ function support as indicated. Respiratory support Children who undergo non-invasive mechanical ventilation for 2 hours without improvements in conditions, or cannot tolerate non-invasive ventilation, with increased airway secretions, severe cough, or hemodynamic instability, should be subjected to invasive mechanical ventilation promptly. The invasive mechanical ventilation should adopt low tidal volume “lung protective ventilation strategy” to reduce ventilator related lung injury. If necessary, prone position ventilation, lung recruitment, or extracorporeal membrane oxygenation (ECMO) can be applied. Circulation support On the basis of full fluid resuscitation, improve microcirculation, use vasoactive drugs, and monitor hemodynamics if necessary. Traditional Chinese medicine This disease belongs to the epidemic disease category of Traditional Chinese Medicine and results from contracting epidemic pathogens. Different regions can refer to the following plans for dialectical treatment according to the patient’s conditions, local climate features, and physical characteristics of children. Clinical treatment period Asymptomatic infection:Therapeutic methods: strengthening the healthy and dispelling pathogenic factors;

fulltextpubmed· Body· item PMC7090771

Traditional Chinese medicine This disease belongs to the epidemic disease category of Traditional Chinese Medicine and results from contracting epidemic pathogens. Different regions can refer to the following plans for dialectical treatment according to the patient’s conditions, local climate features, and physical characteristics of children. Clinical treatment period Asymptomatic infection:Therapeutic methods: strengthening the healthy and dispelling pathogenic factors; Recommended prescription and drugs: modified Yupingfeng powder in combination with Buhuanjin Zhengqi powder composed of 9–12 g of Zhihuangqi (Prepared Astragalus), 6–9 g of Chaobaizhu (Roasted Rhizoma Atractylodis Macrocephalae), 3–9 g of Houpo (Officinal Magnolia Bark), 6–9 g of Cangzhu (Atractylodes lancea), 6–9 g of Chenpi (Pericarpium citri reticulatae), 3–6 g of Jiangbanxia (Ginger processed pinellia), 6–9 g of Huoxiang (Agastache rugosus), 6 to 9 g of Fuling (Poria cocos), and 3–6 g of Zhigancao (Prepared Liquorice Root). Old and damp tightening the lung:Clinical manifestations: aversion to cold, fever or no fever, dry cough, sore throat, nasal congestion, tiredness and fatigue, nausea and retching, loose stool, pale tongue or reddish tongue with whitish-greasy fur, floating, and soft pulse; Therapeutic methods: dispersing lung to promote pathogenic factors, detoxify, and dispel dampness;

fulltextpubmed· Body· item PMC7090771

Old and damp tightening the lung:Clinical manifestations: aversion to cold, fever or no fever, dry cough, sore throat, nasal congestion, tiredness and fatigue, nausea and retching, loose stool, pale tongue or reddish tongue with whitish-greasy fur, floating, and soft pulse; Therapeutic methods: dispersing lung to promote pathogenic factors, detoxify, and dispel dampness; Prescription ​and drugs: modified Qingqi decoction composed of 6–9 g of Cangzhu, 3–9 g of Houpo, 6–9 g of Chenpi, 6–12 g of Huoxiang, 3–9 g of Banxia, 3–9 g of Xingren, 9–15 g of Suye, 6–9 g of Jiegeng, 6–9 g of Guanzhong, 6–9 g of Fuling, 3–6 g of Shengjiang, and 3–6 g of Gancao. Plague poison obstructing lungs:Clinical manifestation: fever persists or chill and fever alternate; cough with little or yellow phlegm; shortness of breath holds back; abdominal distension constipation. The tongue is red, while the moss is yellow and greasy or yellow and dry. Slide number of arteries and veins; Therapeutic methods: detoxification, opening and closing, clearing the lungs, and dampness; Prescription and drugs: modified Xuanbai Chengqi decoction composed of 6–9 g of Huoxiang, 10 g of Cangzhu, 3–6 g of Zhimahuang, 3 -9 g of Chaoxingren, 15–30 g of Shengshigao, 10 g of Gualou, 3–6 g of Jiujun (to be added later in preparation), 6–9 g of Huangqin, 6–9 g of Fuling, 6–9 g of Danpi, 6–9 g of Shichangpu, and 3–6 g of Chuanbei.

fulltextpubmed· Body· item PMC7090771

rugs: modified Xuanbai Chengqi decoction composed of 6–9 g of Huoxiang, 10 g of Cangzhu, 3–6 g of Zhimahuang, 3 -9 g of Chaoxingren, 15–30 g of Shengshigao, 10 g of Gualou, 3–6 g of Jiujun (to be added later in preparation), 6–9 g of Huangqin, 6–9 g of Fuling, 6–9 g of Danpi, 6–9 g of Shichangpu, and 3–6 g of Chuanbei. Inner blocking causing unconsciousness and collapse:Clinical manifestation: dyspnea, lethargy, restlessness, cold and sweat in limb, dark purplish tongue, thick and slimy fur or dry fur, big floating and unstable pulse, cyanosis in fingerprints, and reaching for the Mingguan point (distal phalanx); Therapeutic methods: opening the blocking and solidification dysfunction, detoxifying, and reviving the unconscious; Prescriptions and drugs: modified Shenfu decoction plus Shengmai drink composed of 3–6 g of Renshen (radix ginseng), 6–12 g of fuzi (radix aconiti Praepareta) (to be decocted one hour first). 6–12 g of Shanzhuyu (Fructus Corni), 10 g of Maimendong (Radix ophiopogonis), and 3–6 g of Rougui (Cinnamomum cassia), to be taken with Angong Niuhuang Pill. Qi deficiency of both the lung and spleen.Clinical manifestation: feeble cough, lassitude and asthenia, spontaneous sweating, poor appetite, loose stool, pale tongue with whitish and slippery fur, thready, and weak pulse; Therapeutic methods: nourishing the lungs and strengthening the spleen, nourishing qi, and dehumidifying;

fulltextpubmed· Body· item PMC7090771

Qi deficiency of both the lung and spleen.Clinical manifestation: feeble cough, lassitude and asthenia, spontaneous sweating, poor appetite, loose stool, pale tongue with whitish and slippery fur, thready, and weak pulse; Therapeutic methods: nourishing the lungs and strengthening the spleen, nourishing qi, and dehumidifying; Prescription and drugs: modified LiuJunZi decoction composed of 15 g of Zhihuangqi (Prepared Astragalus), 10 g of Xiyangshen (American Ginseng), 10 g of Chaobaizhu (Roasted Rhizoma Atractylodis Macrocephalae), 6 g of Fabanxia (Rhizoma Pinelliae preparatum), 6 g of Chenpi (Pericarpium citri reticulatae), 3 g of Chuanbei (Tendril-leaved fritillary bulb), 15 g of Fuling (Poria cocos), 6 g of Huoxiang (Agastache rugosus), and 3 g of Sharen (Fructus amomi) (to be added in later). Psychotherapy Psychological counseling plays an important role in disease recovery. If patients (especially older children) show mood swing, fear, or psychological disorders, active psychological intervention and treatment are needed. Release and discharge criteria [3] Confirmed patients can be discharged from isolation or transferred to the corresponding departments for treatment of other diseases if all the following criteria are met:The body temperature returns to normal longer than 3 days; The respiratory symptoms improve obviously; The detection of respiratory pathogenic nucleic acid is negative for two consecutive times (the sampling interval is at least 1 day).

fulltextpubmed· Body· item PMC7090771

Release and discharge criteria [3] Confirmed patients can be discharged from isolation or transferred to the corresponding departments for treatment of other diseases if all the following criteria are met:The body temperature returns to normal longer than 3 days; The respiratory symptoms improve obviously; The detection of respiratory pathogenic nucleic acid is negative for two consecutive times (the sampling interval is at least 1 day). Suspected patients can be discharged from isolation when the detection of respiratory pathogenic nucleic acid is negative for two consecutive times (the sampling interval is at least 1 day). Prevention [33–35] Novel coronavirus infection is a new communicable disease with an emergent outbreak that affects all populations. 2019-nCoV infection has been classified as category B infectious disease legally but managed as category A infectious disease. It is paramount to implement infection control practices by infection source controlling, transmission route blocking, and susceptible population protection.

fulltextpubmed· Body· item PMC7090771

break that affects all populations. 2019-nCoV infection has been classified as category B infectious disease legally but managed as category A infectious disease. It is paramount to implement infection control practices by infection source controlling, transmission route blocking, and susceptible population protection. Controlling infection sources Patients infected with 2019-nCoV are the main infection sources. Children infected by novel coronavirus should be isolated at home or admitted to designated hospitals under the guidance of healthcare workers depending on the severity of their medical conditions. Try to provide single rooms for isolated children, and reduce the chance of contact with the co-residents. There are enormous demands for room ventilation, necessary cleaning, and disinfection work for the articles used by children. Equally crucial is the need of equipment with disposable masks and properly disposal after use when taking care of the sick. Blocking transmission routes Preventing transmission by respiratory droplets and contact: Cover mouth and nose with napkin or towel when coughing or sneezing. Wash hands for children frequently, or teach children seven-step washing technique. Try not to touch mouth, nose, or eyes before cleaning hands thoroughly after returning from public places, after covering the mouth when coughing, before eating or after using toilet; regularly disinfecting toys by heating at 56 °C for 30 min, 75% alcohol or chlorine-containing disinfectants, and ultraviolet rays.

fulltextpubmed· Body· item PMC7090771

que. Try not to touch mouth, nose, or eyes before cleaning hands thoroughly after returning from public places, after covering the mouth when coughing, before eating or after using toilet; regularly disinfecting toys by heating at 56 °C for 30 min, 75% alcohol or chlorine-containing disinfectants, and ultraviolet rays. Reduce exposure to infection: Avoid public transport at epidemic areas, and wear masks when going to crowded or poorly ventilated public places; avoid touching or eating wild animals, and going to markets selling with live animals. Children's health monitoring: Children with a history of close contacts of infected patients need to be monitored for body temperature and clinical features routinely. When presenting with suspicious symptoms, children should be taken to a designated hospital for screening. Newborns delivered by infected mothers must complete a pathogen test and be isolated in a single ward or at home according to their medical conditions. Boosting immunity Balanced diet, oral health, adequate exercise, regular rest, avoiding excessive fatigue, and boosting immunity are the powerful measures to preventing infection, as well as maintaining emotional stability and mental health. Vaccination is an effective way to prevent virus infection. The research and development of anti-virus vaccines has been carried out in China at present. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. All authors contributed equally to this paper.

fulltextpubmed· Body· item PMC7090771

Boosting immunity Balanced diet, oral health, adequate exercise, regular rest, avoiding excessive fatigue, and boosting immunity are the powerful measures to preventing infection, as well as maintaining emotional stability and mental health. Vaccination is an effective way to prevent virus infection. The research and development of anti-virus vaccines has been carried out in China at present. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. All authors contributed equally to this paper. Author contributions All authors contributed equally to this paper. Funding None. Compliance with ethical standards Conflict of interest The authors have no financial of non-financial conflict of interest relevant to this paper to disclose. Ethical approval Not required for this consensus statement.

fulltextpubmed· Body· item PMC7090852

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 Childrens Hospital, Zhejiang University School of Medicine Hangzhou 28470580 31 10.1007/s12519-017-0031-8 Review Article Etiology and clinical features of viral bronchiolitis in infancy Fretzayas Andrew +302105831299+302105832229afretz@med.uoa.gr Moustaki Maria 0000 0001 2155 0800grid.5216.03rd Department of Pediatrics, “Attikon” University Hospital, Athens University, School of Medicine, 1 Rimini str, Haidari, 12462 Athens, Greece 4 5 2017 2017 13 4 293 299 7 6 2016 18 11 2016 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2017This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Bronchiolitis is a common lower respiratory tract infection in infancy. The aim of this review is to present the clinical profile of viral bronchiolitis, the different culprit viruses and the disease severity in relation to the viral etiology. Data sources Databases including PubMed and Google Scholar were searched for articles about the clinical features of bronchiolitis and its viral etiology. The most relevant articles to the scope of this review were analyzed.

fulltextpubmed· Body· item PMC7090852

28470580 31 10.1007/s12519-017-0031-8 Review Article Etiology and clinical features of viral bronchiolitis in infancy Fretzayas Andrew +302105831299+302105832229afretz@med.uoa.gr Moustaki Maria 0000 0001 2155 0800grid.5216.03rd Department of Pediatrics, “Attikon” University Hospital, Athens University, School of Medicine, 1 Rimini str, Haidari, 12462 Athens, Greece 4 5 2017 2017 13 4 293 299 7 6 2016 18 11 2016 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2017This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Bronchiolitis is a common lower respiratory tract infection in infancy. The aim of this review is to present the clinical profile of viral bronchiolitis, the different culprit viruses and the disease severity in relation to the viral etiology. Data sources Databases including PubMed and Google Scholar were searched for articles about the clinical features of bronchiolitis and its viral etiology. The most relevant articles to the scope of this review were analyzed. Results Currently there are two main definitions for bronchiolitis which are not identical, the European definition and the American one. The most common viral pathogen that causes bronchiolitis is respiratory syncytial virus which was identified in 1955; now many other viruses have been implicated in the etiology of bronchiolitis such as rhinovirus, adenovirus, metapneumovirus, and bocavirus. Several studies have attempted to investigate the correlation of bronchiolitis severity with the type of detected virus or viruses. However, the results were not consitent.

fulltextpubmed· Body· item PMC7090852

1955; now many other viruses have been implicated in the etiology of bronchiolitis such as rhinovirus, adenovirus, metapneumovirus, and bocavirus. Several studies have attempted to investigate the correlation of bronchiolitis severity with the type of detected virus or viruses. However, the results were not consitent. Conclusions For the time being, the diagnosis of bronchiolitis remains clinical. The isolation of the responsible respiratory pathogens does not seem to confer to the prognosis of the disease severity. Key words clinical featuresetiologyviral bronchiolitisissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag GmbH Germany 2017

fulltextpubmed· Body· item PMC7090857

The 2019-nCoV epidemic has become a major challenging public health problem in China. For standardizing the diagnosis and treatment strategies of 2019-nCoV pneumonia, National Health Commission of the People’s Republic of China has released the Diagnosis and Treatment Standards of 2019-nCoV pneumonia, and updated the standards to the 4th edition based on the status of epidemic and accumulated experiences in clinical practice now [1]. Children comprise a special population whose immune response system is distinct from adults. Therefore, pediatric patients infected with 2019-nCoV have their own clinical features and therapeutic responses. Herein, we formulate this recommendation for diagnosis and treatment of 2019-nCoV infection in children which is of paramount importance for clinical practice [2].

fulltextpubmed· Body· item PMC7090857

e response system is distinct from adults. Therefore, pediatric patients infected with 2019-nCoV have their own clinical features and therapeutic responses. Herein, we formulate this recommendation for diagnosis and treatment of 2019-nCoV infection in children which is of paramount importance for clinical practice [2]. As of this report date, more than 20 pediatric cases have been reported in China. Zhejiang Province has the biggest number of pediatric cases (10), because of earlier and wider application of 2019-nCoV nucleic acid detection of clinical samples. All the ten pediatric patients, of age from 112 days to 17 years, are mild cases, and only three showed pneumonia. Based on the current data in pediatric cases, this recommendation focuses on pediatric respiratory infections caused by 2019-nCoV, not pneumonia only. To make it more helpful for first-line clinicians to judge patients’ conditions, this recommendation is detailed in physical examinations, systemic symptoms, and clinical classifications, particularly in the definition of severe and critical cases. Since most pediatric cases are family clusters, a history of close contact with confirmed or suspected 2019-nCoV within 2 weeks prior to disease onset should be paid more attention to. Meanwhile, considering the probability of vertical mother-to-child transmission, “newborns delivered by mothers with suspected or confirmed 2019-nCoV infection” is also considered as one epidemiological evidence. We highlight the principles of early identification, early isolation, early diagnosis, and early treatment in managing pediatric cases. As to treatment, rational medication is highlighted for mild cases. For critical cases, more invasive technique such as ECMO support can be used if indicated.

fulltextpubmed· Body· item PMC7090857

epidemiological evidence. We highlight the principles of early identification, early isolation, early diagnosis, and early treatment in managing pediatric cases. As to treatment, rational medication is highlighted for mild cases. For critical cases, more invasive technique such as ECMO support can be used if indicated. The current recommendation highlights the different clinical characteristics of pediatric patients, and provides optimized, detailed and applicable standards for clinical practice. Due to the limited pediatric cases and experiences, this recommendation is formulated mainly based on the standards and experiences in adult patients. With further case data collection and accumulated experiences in managing pediatric cases infected by 2019-nCoV, this recommendation will be updated and improved. With stringent prevention and control strategies, we believe we can win the fight against this epidemic. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

fulltextpubmed· Body· item PMC7090877

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 SP Children’s Hospital, Zhejiang University School of Medicine Heidelberg 23389332 397 10.1007/s12519-013-0397-1 Original Article Common WU polyomavirus infection in a Beijing population indicated by surveillance for serum IgG antibody against capsid protein VP2 Zhang Ni-Na Zhao Lin-Qing Qian Yuan 86-10-8561055086-10-85610550yqianbjc@263.net Zhu Ru-Nan Deng Jie Wang Fang Sun Yu Liu Li-Ying grid.418633.b0000000417717032Laboratory of Virology, Capital Institute of Pediatrics, 2 Yabao Road, Beijing, 100020 China 7 2 2013 2013 9 1 48 52 15 11 2011 10 5 2012 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2013This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background WU polyomavirus (WU virus) was identified as a novel polyomavirus in 2007 from specimens of pediatric patients with acute respiratory infection (ARI). A lack of permissive cell lines has limited investigations into WU virus pathogenesis and prevalence.

fulltextpubmed· Body· item PMC7090877

ation (WHO) declaration of COVID-19 as a global pandemic.Background WU polyomavirus (WU virus) was identified as a novel polyomavirus in 2007 from specimens of pediatric patients with acute respiratory infection (ARI). A lack of permissive cell lines has limited investigations into WU virus pathogenesis and prevalence. Methods The encoding region of the capsid protein VP2 gene was amplified from a WU virus DNA-positive clinical specimen and expressed as a recombinant Histagged protein in Escherichia coli BL21 (DE3). The expressed VP2 was identified by expected molecular weight and immunoreactivity with anti-His monoclonal antibody in Western blotting assay. Serum samples collected from 455 individuals of all ages in Beijing without symptoms of ARI were tested for IgG antibodies against the affinity-purified recombinant VP2 protein by Western blotting to investigate the prevalence of natural WU virus infection. In addition, serum samples from four ARI pediatric patients, whose nasopharyngeal aspirates were positive for WU virus DNA and negative for all other respiratory-related viruses, were tested for IgM antibody against the recombinant VP2. Results Of the 455 serum samples, 238 reacted with the recombinant VP2, yielding an overall positive rate of 52.3% for IgG against VP2 of WU virus. The positive rate was the highest in serum samples from infants and children between 1 to 4 years of age. One of four ARI pediatric patients was positive for IgM against WU virus VP2, implicating WU virus as the causative disease agent.

fulltextpubmed· Body· item PMC7090877

nt VP2, yielding an overall positive rate of 52.3% for IgG against VP2 of WU virus. The positive rate was the highest in serum samples from infants and children between 1 to 4 years of age. One of four ARI pediatric patients was positive for IgM against WU virus VP2, implicating WU virus as the causative disease agent. Conclusions The high prevalence of IgG against WU polyomavirus in Beijing-based study population indicates that WU virus infection is common in Beijing. WU virus may be responsible for some pediatric ARI cases, and primary infection of this virus may occur mostly in childhood. Key words antibodyinfectionvirusWU polyomavirusissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2013

fulltextpubmed· Body· item PMC7091079

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 Childrens Hospital, Zhejiang University School of Medicine Hangzhou 28120235 2 10.1007/s12519-017-0002-0 Original Article Identifying key genes associated with Hirschsprung’s disease based on bioinformatics analysis of RNA-sequencing data Pan Wei-Kang 1 Zhang Ya-Fei 2 Yu Hui 1 Gao Ya +86-2987679373+86-2987679373ygao@mail.xjtu.edu.cn 1 Zheng Bai-Jun 1 Li Peng 1 Xie Chong 1 Ge Xin 1 1 grid.452672.0Department of Pediatric Surgery, The Second Affiliated Hospital of Xi’an Jiaotong University, Xi’an, 710004 China 2 Department of Endoscopy, Shaanxi Nuclear Industry 215 Hospital, Xianyang, 712000 China 25 1 2017 2017 13 3 267 273 23 3 2016 25 8 2016 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2017This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Hirschsprung’s disease (HSCR) is a type of megacolon induced by deficiency or dysfunction of ganglion cells in the distal intestine and is associated with developmental disorders of the enteric nervous system. To explore the mechanisms of HSCR, we analyzed the RNA-sequencing data of the expansion and the narrow segments of colon tissues separated from children with HSCR.

fulltextpubmed· Body· item PMC7091079

induced by deficiency or dysfunction of ganglion cells in the distal intestine and is associated with developmental disorders of the enteric nervous system. To explore the mechanisms of HSCR, we analyzed the RNA-sequencing data of the expansion and the narrow segments of colon tissues separated from children with HSCR. Methods RNA-sequencing of the expansion segments and the narrow segments of colon tissues isolated from children with HSCR was performed. After differentially expressed genes (DEGs) were identified using the edgeR package in R, functional and pathway enrichment analyses of DEGs were carried out using DAVID software. To further screen the key genes, protein-protein interaction (PPI) network and module analyses were conducted separately using Cytoscape software. Results A total of 117 DEGs were identified in the expansion segment samples, including 47 up-regulated and 70 down-regulated genes. Functional enrichment analysis suggested that FOS and DUSP1 were implicated in response to endogenous stimulus. In the PPI network analysis, FOS (degree=20), EGR1 (degree=16), ATF3 (degree=9), NOS1 (degree=8), CCL5 (degree=8), DUSP1 (degree=7), CXCL3 (degree=6), VIP (degree=6), FOSB (degree=5), and NOS2 (degree=4) had higher degrees, which could interact with other genes. In addition, two significant modules (module 1 and module 2) were identified from the PPI network. Conclusions Several genes (including FOS, EGR1, ATF3, NOS1, CCL5, DUSP1, CXCL3, VIP, FOSB, and NOS2) might be involved in the development of HSCR through their effect on the nervous system.

fulltextpubmed· Body· item PMC7091079

Results A total of 117 DEGs were identified in the expansion segment samples, including 47 up-regulated and 70 down-regulated genes. Functional enrichment analysis suggested that FOS and DUSP1 were implicated in response to endogenous stimulus. In the PPI network analysis, FOS (degree=20), EGR1 (degree=16), ATF3 (degree=9), NOS1 (degree=8), CCL5 (degree=8), DUSP1 (degree=7), CXCL3 (degree=6), VIP (degree=6), FOSB (degree=5), and NOS2 (degree=4) had higher degrees, which could interact with other genes. In addition, two significant modules (module 1 and module 2) were identified from the PPI network. Conclusions Several genes (including FOS, EGR1, ATF3, NOS1, CCL5, DUSP1, CXCL3, VIP, FOSB, and NOS2) might be involved in the development of HSCR through their effect on the nervous system. Keywords differentially expressed genesfunctional and pathway enrichment analysisHirschsprung’s diseaseprotein-protein interaction networkissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag GmbH Germany 2017

fulltextpubmed· Body· item PMC7091143

Introduction Human bocavirus (HBoV), a new virus belonging to the Parvoviridae family, was first identified in 2005 in respiratory samples of children suffering from viral respiratory infections of unknown etiology [1]. Several studies tried to investigate the role of HBoV, reporting a detection rate ranging from 3.1% [1] to 23.1% [2] in children with acute respiratory tract infections. Sometimes, HBoV was considered responsible for a severe clinical presentation in children with acute respiratory disease [3]; however, other studies reported no differences between HBoV and other viruses in the clinical course of respiratory infections [4]. HBoV is often detected from respiratory samples together with other viruses [5–7], which has been described as a prolonged and intermittent shedding even in asymptomatic patients [3]. In addition, nowadays, the virus does not fulfill the criteria for etiologic association of virus with prevalent disease [8]. As a result, its role of a respiratory pathogen has not been completely accepted yet [9]. To increase our knowledge on the clinical spectrum of HBoV in children with respiratory disease, we aimed to describe the clinical and serological characteristics of children hospitalized for acute respiratory tract infection, whose nasal aspirate or bronchoalveolar lavage (BAL) tested HBoV positive and to investigate whether there is a difference between single infection and co-infection of HBoV.

fulltextpubmed· Body· item PMC7091143

iratory disease, we aimed to describe the clinical and serological characteristics of children hospitalized for acute respiratory tract infection, whose nasal aspirate or bronchoalveolar lavage (BAL) tested HBoV positive and to investigate whether there is a difference between single infection and co-infection of HBoV. Methods Patients We retrospectively reviewed clinical records of 60 children (31 males, median age of 6.2 months, range 0.6–70.9) hospitalized for acute respiratory infection in the Pediatric Emergency Department at “Sapienza” University Rome from 2010 to July 2016, in which HBoV was detected from nasal aspirate or BAL. The clinical records included demographic and clinical information [such as age, gender, breastfeeding history, family smoking habit, family history for asthma and atopic diseases, laboratory data including blood neutrophil count, blood lymphocyte count, blood eosinophil count, C- reactive protein (CRP) and the days of hospitalization], chest X-ray records, and the clinical severity score ranging from 0 to 8 that was assigned to each infant on admission in the hospital according to arterial oxygen saturation on room air, presence of retractions, ability to feeding as used in an our previous manuscript [10], and respiratory rate modified according to age as reported for the clinical respiratory score [11].

fulltextpubmed· Body· item PMC7091143

nging from 0 to 8 that was assigned to each infant on admission in the hospital according to arterial oxygen saturation on room air, presence of retractions, ability to feeding as used in an our previous manuscript [10], and respiratory rate modified according to age as reported for the clinical respiratory score [11]. We classified children into five groups according to clinical, epidemiological, serological, and radiological findings as having:bronchiolitis: clinically defined as the first episode of acute lower respiratory tract infection in infants up to 12 months of age, characterized by the acute onset of cough, tachypnea, retraction, and diffuse crackles on chest auscultation [12]; preschool wheezing: children aged less than 6 years with lower respiratory tract infection, and wheeze on chest auscultation; upper respiratory tract infection (URTI), including children with rhinorrhoea and/or cough, without abnormal findings on chest auscultation; whooping cough, characterized by the presence of cough lasting more than 14 days and at least one of the symptoms of paroxysmal cough, whoop, or post-tussive vomiting with positive laboratory findings for Bordetella pertussis [13]; pneumonia, defined as the presence of fever, acute respiratory symptoms, and evidence of a new lung consolidation [14].

fulltextpubmed· Body· item PMC7091143

whooping cough, characterized by the presence of cough lasting more than 14 days and at least one of the symptoms of paroxysmal cough, whoop, or post-tussive vomiting with positive laboratory findings for Bordetella pertussis [13]; pneumonia, defined as the presence of fever, acute respiratory symptoms, and evidence of a new lung consolidation [14]. HBoV was detected using a reverse transcriptase-PCR (RT-PCR) specific for 14 respiratory viruses including respiratory syncytial virus (RSV), influenza virus (IV) A and B, human coronavirus (HCoV) OC43, 229E, NL-63 and HUK1, adenovirus (AdV), rhinovirus (RV), parainfluenza virus (PiV) 1–3, and human metapneumovirus (MPV) and HBoV, as previously described [15, 16]. The study was approved by the Ethical Committee of Hospital (no.2377/02.02.2012). Researchers adhered to the postulates of the Declaration of Helsinki and an informed consent has been obtained for all patients enrolled. Statistical analysis Categorical variables were expressed as numbers and percentages and continuous variables values as median and range or as average and standard deviation. A χ2 test was performed to compare proportion. The normality of data distribution was tested using the Kolmogorov–Smirnov test. A non-parametric median test (Mann–Whithney U test) was performed for the analysis of continuous variables not normally distributed. Two-side P values < 0.05 were considered as statistically significant. Statistical analysis was performed using the SPSS software (version 23.0; SPSS Inc., Chicago, Illinois, USA).

fulltextpubmed· Body· item PMC7091143

test. A non-parametric median test (Mann–Whithney U test) was performed for the analysis of continuous variables not normally distributed. Two-side P values < 0.05 were considered as statistically significant. Statistical analysis was performed using the SPSS software (version 23.0; SPSS Inc., Chicago, Illinois, USA). Results Among the 60 children hospitalized for acute respiratory infection, RT-PCR detected HBoV alone in 29 (48.3%) cases and in 31 cases (51.7%) with other viruses. The most frequent co-infections were with RSV and RV (Fig. 1a). Monthly distribution of HBoV showed that 53% of the patients were concentrated in December and January, with no difference between single and co-infection (Fig. 1b).Fig. 1 a Absolute numbers of human bocavirus co-detected viruses; b monthly distribution of human bocavirus infections. Abbreviation, respiratory syncytial virus (RSV), rhinovirus (RV), human metapneumovirus (MPV), parainfluenza virus (PiV)

fulltextpubmed· Body· item PMC7091143

ember and January, with no difference between single and co-infection (Fig. 1b).Fig. 1 a Absolute numbers of human bocavirus co-detected viruses; b monthly distribution of human bocavirus infections. Abbreviation, respiratory syncytial virus (RSV), rhinovirus (RV), human metapneumovirus (MPV), parainfluenza virus (PiV) Among the 60 children in whom HBoV was detected, 34 (56.6%) were hospitalized for bronchiolitis, 19 (31.7%) for wheezing, 3 (5%) for pneumonia, 2 (3.3%) for an upper respiratory tract infection (URTI), and 2 (3.3%) for whooping cough. Clinical, serological, and radiological characteristic, according to diagnosis, are shown in Table 1. HBoV was detected alone in 13 infants with bronchiolitis (38.2%), 11 children with an acute episode of wheezing (57.9%), all the patients with pneumonia and in half with URTI.Table 1 Clinical, serological, and radiological characteristic of children hospitalized for respiratory tract infection with human bocavirus divided by diagnosis

fulltextpubmed· Body· item PMC7091143

d alone in 13 infants with bronchiolitis (38.2%), 11 children with an acute episode of wheezing (57.9%), all the patients with pneumonia and in half with URTI.Table 1 Clinical, serological, and radiological characteristic of children hospitalized for respiratory tract infection with human bocavirus divided by diagnosis Variables Bronchiolitis (n = 34) Wheezing (n = 19) URTI (n = 2) Pneumonia (n = 3) Whooping cough (n = 2) Clinical severity score 4.03 ± 2.35 5.58 ± 1.95 1 3 2.5 Clinical severity score ≥ 6 8 (23.5%) 10 (52.6%) 0 0 0 Fever 44.1% 50.0% 0% 100% 0% Food intake reduction 67.7% 63.1% 100% 0% 100% Food intake reduction < 75% 12 (35.3%) 10 (52.6) 0 0 0 Total white blood cell count (n/mm3) 11,986 ± 4400 13,365 ± 5969 24,050 18,790 26,240 Lymphocytes (n/mm3) 5292 ± 2949 2357 ± 994 3150 4736 9115 Neutrophils (n/mm3) 4667 ± 3272 9536 ± 5664 20,250 12,078 1960 Eosinophils (n/mm3) 89 ± 161 232 ± 356 120 70 470 C-RP (mg/dL) 1.7 ± 3.2 1.1 ± 1.1 0.57 0.85 0.03 Chest X-ray Consolidation 15/22 (68.2) 10/19 (52.6%) NA 100% NA Air trapping 8/22 (36.4%) 10/19 (52.6) NA 1 (33.3) NA PICU admission 3 (8.8%) 6 (31.6%) 0 0 0 Sodium (mmol/L) 139 (133–145) 139.5 (135–141) 148 139 (137–139) 137 GOT (U/L) 49.12 ± 41.06 35.47 ± 7.06 41 30.33 ± 8.74 31 GPT (U/L) 35.94 ± 15.72 18.33 ± 5.83 16 18.67 ± 9.82 19 C-RP C-reactive protein, PICU Paediatric Intensive Care Unit, GOT glutamic oxaloacetic transaminase, GPT glutamic pyruvate transaminase, NA not available

fulltextpubmed· Body· item PMC7091143

L) 139 (133–145) 139.5 (135–141) 148 139 (137–139) 137 GOT (U/L) 49.12 ± 41.06 35.47 ± 7.06 41 30.33 ± 8.74 31 GPT (U/L) 35.94 ± 15.72 18.33 ± 5.83 16 18.67 ± 9.82 19 C-RP C-reactive protein, PICU Paediatric Intensive Care Unit, GOT glutamic oxaloacetic transaminase, GPT glutamic pyruvate transaminase, NA not available In children with whooping cough (diagnosed on the basis of B. pertussis detection), HBoV was in co-infection with other viruses in half of the cases (Fig. 2).Fig. 2 Frequencies of multiple viruses (dark grey) and single virus (light grey) detection divided according to diagnosis

fulltextpubmed· Body· item PMC7091143

L) 139 (133–145) 139.5 (135–141) 148 139 (137–139) 137 GOT (U/L) 49.12 ± 41.06 35.47 ± 7.06 41 30.33 ± 8.74 31 GPT (U/L) 35.94 ± 15.72 18.33 ± 5.83 16 18.67 ± 9.82 19 C-RP C-reactive protein, PICU Paediatric Intensive Care Unit, GOT glutamic oxaloacetic transaminase, GPT glutamic pyruvate transaminase, NA not available In children with whooping cough (diagnosed on the basis of B. pertussis detection), HBoV was in co-infection with other viruses in half of the cases (Fig. 2).Fig. 2 Frequencies of multiple viruses (dark grey) and single virus (light grey) detection divided according to diagnosis Seven children (11.6%) (median age of 11.1 months; range 0.63–44.7) were admitted to the Pediatric Intensive Care Unit (PICU) because of respiratory failure. Among these three children hospitalized for an acute episode of wheezing, HBoV was detected alone; on the contrary, in the four infants with bronchiolitis, HBoV was detected together with RSV. In one child with an acute episode of wheezing, HBoV was detected alone from the BAL. No difference was observed in terms of age, positive family history for atopy and/or asthma, clinical presentation (fever, dyspnea, and food intake reduction) consolidation on chest X-ray, and laboratory findings (CRP, white blood cells count, and lymphocyte count) in children with HBoV detected alone vs. children with multiple viral detection. Children with co-detection were more frequently male (P = 0.019, by Chi-square test) (Table 2).Table 2 Clinical, epidemiological, and serological characteristic of children hospitalized for respiratory tract infection with human bocavirus in single vs. co-detection

fulltextpubmed· Body· item PMC7091143

cted alone vs. children with multiple viral detection. Children with co-detection were more frequently male (P = 0.019, by Chi-square test) (Table 2).Table 2 Clinical, epidemiological, and serological characteristic of children hospitalized for respiratory tract infection with human bocavirus in single vs. co-detection Variables Single detection (n = 29) Co-detection (n = 31) P value Sex (male) 10 (34.5) 21 (67.7%) 0.019* Age (mon) median (range) 7.47 (0.7–57.6) 3.63 (0.6–70.9) 0.102 Birthweight (kg) median (range) 3.0 (0.6–4.1) 3.0 (1.8–3.8) 0.684 Breastfeeding (mon) median (range) 1 (0–24) 1 (0–8) 0.839 Breastfeeding 19/28 (67.9) 19/26 (73.1) 0.675 Exposure to smoke 17/27 (63) 14/27 (51.9) 0.409 Maternal smoke during pregnancy 8/27 (29.6) 3/27 (11.1) 0.091 Family history of asthma 9/27 (33.3) 7/28 (25.0) 0.496 Family history of atopy 9/27 (33.3) 9/28 (32.1) 0.925 Fever 14 (50) 13 (41.9) 0.535 Clinical severity score median (range) 4 (0–8) 5 (0–8) 0.308 Days of hospitalization median (range) 4 (2–30) 5 (1–12) 0.367 Admission to PICU 4 (13.8%) 5 (16.1%) 1 Total white blood cell count (n/mm3) median (range) 12,895 (5010–22,980) 10,830 (5460–36,910) 0.511 Neutrophils (n/mm3) median (range) 6683 (1001–18,100) 3457 (1079–21,110) 0.168 Lymphocytes (n/mm3) median (range) 3755 (1310–11,859) 3888 (1090–12,040) 0.511 Eosinophils (n/mm3) median (range) 75 (0–470) 66 (0–1460) 0.824 Eosinophils > 300/mm3 4/26 (15.4) 5/26 (17.2) 1 C-RP (mg/dL) median (range) 0.73 (0.03–13.9) 0.8 (0.01–16.98) 0.609 Chest X-ray Air trapping 10/22 (45.5) 19/22 (40.9) 0.761 Consolidation 12/22 (54.5) 16/22 (72.7) 0.210 C-RP C-reactive protein, PICU Paediatric Intensive Care Unit. *P value by χ2 test

fulltextpubmed· Body· item PMC7091143

) 66 (0–1460) 0.824 Eosinophils > 300/mm3 4/26 (15.4) 5/26 (17.2) 1 C-RP (mg/dL) median (range) 0.73 (0.03–13.9) 0.8 (0.01–16.98) 0.609 Chest X-ray Air trapping 10/22 (45.5) 19/22 (40.9) 0.761 Consolidation 12/22 (54.5) 16/22 (72.7) 0.210 C-RP C-reactive protein, PICU Paediatric Intensive Care Unit. *P value by χ2 test Among the children with multiple viral detection, RSV was the most frequently detected virus (61.3%), in which 18 were diagnosed as having bronchiolitis and one upper respiratory tract infection. Infants with HBoV–RSV co-detection appeared more often in male (P = 0.013), younger (P = 0.01, by non-parametric median test), and had a lower blood neutrophils count (P = 0.032) compared with children with HBoV detected alone (Table 3).Table 3 Clinical, epidemiological, and serological findings of children hospitalized for respiratory tract infection with human bocavirus in single vs. human bocavirus and respiratory syncytial virus

fulltextpubmed· Body· item PMC7091143

ian test), and had a lower blood neutrophils count (P = 0.032) compared with children with HBoV detected alone (Table 3).Table 3 Clinical, epidemiological, and serological findings of children hospitalized for respiratory tract infection with human bocavirus in single vs. human bocavirus and respiratory syncytial virus Variables HBoV (n = 29) RSV + HBoV (n = 18) P value Sex (male) 10 (34.5) 13 (72.7%) 0.013* Age (mon) median (range) 7.5 (0.7–57.6) 2.9 (0.6–11.1) 0.001† Birthweight (kg) median (range) 3.0 (0.6–4.1) 3.0 (1.8–3.8) 0.514 Breastfeeding (mon) median (range) 1 (0–24) 1 (0–5) 0.669 Breastfeeding 19/28 (67.9) 12/16 (75.0) 0.617 Exposure to smoke 17/27 (63) 10/18 (51.9) 0.619 Maternal smoke during pregnancy 8/27 (29.6) 2/18 (11.1) 0.143 Family history of asthma 9/27 (33.3) 5/18 (27.8) 0.693 Family history of atopy 9/27 (33.3) 5/18 (27.8) 0.693 Fever 14 (50) 7 (38.9) 0.460 Clinical severity score median (range) 5 (1–8) 4 (0–8) 0.331 Admission to PICU 4 (13.8%) 3 (16.7%) 1 Days of hospitalization median (range) 4 (2–30) 5 (1–12) 0.128 Total white blood cell count (n/mm3) median (range) 12,895 (5010–22,980) 10,805 (5460–22,600) 0.086 Neutrophils (n/mm3) median (range) 6683 (1001–18,100) 2961 (1079–11,179) 0.032† Lymphocytes (n/mm3) median (range) 3755 (1310–11,859) 4388 (1455–11,707) 0.145 Eosinophils (n/mm3) median (range) 75 (0–470) 25 (0–500) 0.438 Eosinophils > 300/mm3 4/26 (15.4) 2 (11.1) 1 C-RP (mg/dL) median (range) 0.73 (0.03–13.9) 0.7 (0.01–17.0) 0.613 Chest X-ray Air trapping 10/22 (45.5) 5/14 (35.7) 0.563 Consolidation 12/22 (54.5) 11/14 (78.6) 0.143 C-RP C-reactive protein, PICU pediatric intensive care unit. *P value by χ2 test; †P value by Mann–Whitney U test and non-parametric median test

fulltextpubmed· Body· item PMC7091143

1.1) 1 C-RP (mg/dL) median (range) 0.73 (0.03–13.9) 0.7 (0.01–17.0) 0.613 Chest X-ray Air trapping 10/22 (45.5) 5/14 (35.7) 0.563 Consolidation 12/22 (54.5) 11/14 (78.6) 0.143 C-RP C-reactive protein, PICU pediatric intensive care unit. *P value by χ2 test; †P value by Mann–Whitney U test and non-parametric median test When considering only infants with bronchiolitis from RSV to HBoV co-detection, they had a higher clinical severity score (3.5 vs. 2, P = 0.037) than children with bronchiolitis from HBoV alone and they were more frequently male (15 vs. 6, P = 0.034). No differences were observed in family history of asthma and/or atopic diseases, breastfeeding, fever, length of hospital stay, CRP, white blood cells count, eosinophils, and lymphocyte count between infants with bronchiolitis from HBoV to HBoV–RSV. Discussion Our study revealed that HBoV could be detected alone or together with other viruses in nasal aspirates and BAL of children hospitalized for acute respiratory tract infection, in 51.7% as a co-detection, with a peak during the winter season.

fulltextpubmed· Body· item PMC7091143

When considering only infants with bronchiolitis from RSV to HBoV co-detection, they had a higher clinical severity score (3.5 vs. 2, P = 0.037) than children with bronchiolitis from HBoV alone and they were more frequently male (15 vs. 6, P = 0.034). No differences were observed in family history of asthma and/or atopic diseases, breastfeeding, fever, length of hospital stay, CRP, white blood cells count, eosinophils, and lymphocyte count between infants with bronchiolitis from HBoV to HBoV–RSV. Discussion Our study revealed that HBoV could be detected alone or together with other viruses in nasal aspirates and BAL of children hospitalized for acute respiratory tract infection, in 51.7% as a co-detection, with a peak during the winter season. The frequency of HBoV co-detection is in line with Zhou et al. (52%) and Ljubin-Sternak et al. [2, 17], higher than the one found by Sun et al. [18] and only a bit lower than other studies [5, 7, 19]. In infants hospitalized for an acute respiratory infection, Calvo et al. in one study detected HBoV in combination with other viruses in 64.6% of children and in another study in 75% of the patients [5, 19]. Ghietto et al. confirmed a high rate of HBoV co-detection (78.1%) [7], as well as de Leon et al. (95%) [4] and Martin et al. (72%) [3]. The high rate of co-detection raises doubts on causal relationship of HBoV with respiratory infection, considering its prolonged persistence in the airways likewise. Several authors found the virus in different type of cells [20] and in respiratory samples of healthy volunteers [21]. In addition, we found 3% of HBoV detection among 21 controls without respiratory symptoms in our previous study [16]. The cause–effect relationship seems hard to be approved, but a possible help can rely on HBoV detection from the airways samples during the acute infection together with seroconversion of the anti-HBoV antibody titers [22].

fulltextpubmed· Body· item PMC7091143

3% of HBoV detection among 21 controls without respiratory symptoms in our previous study [16]. The cause–effect relationship seems hard to be approved, but a possible help can rely on HBoV detection from the airways samples during the acute infection together with seroconversion of the anti-HBoV antibody titers [22]. In our series, bronchiolitis was the largest group, and the most frequently HBoV co-detected virus was RSV. In a previous study from our group [9], we found that in infants with bronchiolitis, the RSV–HBoV co-detection was associated with higher severity and longer hospital stay than infants with bronchiolitis caused by RSV or RV or HBoV alone. Our study found that the co-detection of HBoV with RSV was associated with younger age, male sex, and lower neutrophils peripheral count, compared to HBoV detection alone. Considering only infants hospitalized for bronchiolitis, we confirmed our previous findings that the RSV–HBoV co-detection was associated with higher severity of the disease. Other studies confirmed the higher clinical severity presentation of RSV–HBoV co-infection in infants with respiratory infection [18].

fulltextpubmed· Body· item PMC7091143

ion alone. Considering only infants hospitalized for bronchiolitis, we confirmed our previous findings that the RSV–HBoV co-detection was associated with higher severity of the disease. Other studies confirmed the higher clinical severity presentation of RSV–HBoV co-infection in infants with respiratory infection [18]. A HBoV co-detection was registered in 42.1% patients with an acute episode of wheezing. Viral trigger in preschool wheeze is nowadays universally recognized, both for episodic and multiple trigger of wheezing [23]. Association of HBoV in respiratory samples and wheezing has been largely described in children [4–6, 17]. Calvo et al. found [19] infections caused by HBoV were clinically similar to those by RV, except for a higher necessity of oxygen support in the cases of HBoV. In our series, two out of the 19 infants (10.5%) hospitalized for wheezing had a severe clinical presentation and required admission to the PICU. HBoV was detected alone in severe cases and in all cases of pneumonia, suggesting that HBoV might play the role of a pathogen in patient with severe lower respiratory tract infection.

fulltextpubmed· Body· item PMC7091143

ries, two out of the 19 infants (10.5%) hospitalized for wheezing had a severe clinical presentation and required admission to the PICU. HBoV was detected alone in severe cases and in all cases of pneumonia, suggesting that HBoV might play the role of a pathogen in patient with severe lower respiratory tract infection. HBoV had a peak during winter season (December–January), which was similar to the peak of RSV in our country, with no difference between single and co-infection. This trend reflected the distribution of bronchiolitis in our country [24], and it was in line with the previous studies [1, 25]. However, the peak months were in contrast with the data reported by Silva et al., in which HBoV infections occurred more frequently during spring and autumn seasons [26]. Probably, the controversies about the seasonal distribution for HBoV arised from the different population enrolled in the different studies and also from the different geographic areas. Our retrospective study had several limitations. First, the study lacked healthy controls; second, viral load was not performed on nasal samples, and finally, serological antibodies of HBoV were not assessed.

fulltextpubmed· Body· item PMC7091143

HBoV had a peak during winter season (December–January), which was similar to the peak of RSV in our country, with no difference between single and co-infection. This trend reflected the distribution of bronchiolitis in our country [24], and it was in line with the previous studies [1, 25]. However, the peak months were in contrast with the data reported by Silva et al., in which HBoV infections occurred more frequently during spring and autumn seasons [26]. Probably, the controversies about the seasonal distribution for HBoV arised from the different population enrolled in the different studies and also from the different geographic areas. Our retrospective study had several limitations. First, the study lacked healthy controls; second, viral load was not performed on nasal samples, and finally, serological antibodies of HBoV were not assessed. In conclusion, our study demonstrates that HBoV can be detected in children with acute respiratory tract infection both as single agent and as a co-infection, without any differences regarding the clinical presentation. However, the cause–effect relationship between HBoV detection and respiratory infections cannot be achieved, yet based on our data and further studies are needed to clarify if HBoV can play a pathogenetic role in respiratory diseases of children. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

fulltextpubmed· Body· item PMC7091143

In conclusion, our study demonstrates that HBoV can be detected in children with acute respiratory tract infection both as single agent and as a co-infection, without any differences regarding the clinical presentation. However, the cause–effect relationship between HBoV detection and respiratory infections cannot be achieved, yet based on our data and further studies are needed to clarify if HBoV can play a pathogenetic role in respiratory diseases of children. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author’s contribution LP and RN: conception and design of the study; FM, CS, and AP: critical revision of the article for important intellectual content; AF and GDM: patients’ enrollment. FM, CS, and AP: critical revision of the article for important intellectual content; AF and GDM: patients’ enrollment. Funding None. Compliance with ethical standards Ethical approval This study was approved by Policlinico Umberto I Ethic Committee (no. 2377/02.02.2012). Conflict of interest The authors declare that they have no conflict of interest.

fulltextpubmed· Body· item PMC7091166

Background Since December 2019, an epidemic caused by novel coronavirus (2019-nCoV) infection has occurred unexpectedly in China. At present, 2019-nCoV infection has been a legal class B infectious disease of the Law of the People’s Republic of China on the Prevention and Treatment of Infectious Diseases, and managed as a class A infectious disease for infection prevention and control practices. As of 8 pm, 31 January, more than 20 pediatric cases have been reported in China. Of these cases, ten were identified in Zhejiang Province, with an age of onset ranging from 112 days to 17 years. Following latest National recommendations for diagnosis and treatment of respiratory infections caused by 2019-nCoV (the 4th edition) and current status of clinical practice in Zhejiang Province, recommendations for the diagnosis and treatment of respiratory infection caused by 2019-nCoV for children were drafted out by the National Clinical Research Center for Child Health, National Children’s Regional Medical Center, Children's Hospital, Zhejiang University School of Medicine to further standardize the protocol of respiratory infection in children caused by 2019-nCoV.

fulltextpubmed· Body· item PMC7091166

ry infection caused by 2019-nCoV for children were drafted out by the National Clinical Research Center for Child Health, National Children’s Regional Medical Center, Children's Hospital, Zhejiang University School of Medicine to further standardize the protocol of respiratory infection in children caused by 2019-nCoV. Etiology 2019-nCoV is a novel human coronavirus in addition to coronavirus 229E, NL63, OC43, HKU1, Middle East respiratory syndrome-related coronavirus (MERSr-CoV) and severe acute respiratory syndrome-related coronavirus (SARS-CoV). 2019-nCoV is enveloped single-stranded plus stranded RNA virus with a diameter of 60–140 nm, spherical or elliptical in shape and pleomorphic [1]. It has been reported that the consistency of whole genome-wide nucleotide sequences of 2019-nCoV with SARS-like coronavirus in bats (bat-SL-CoVZC45) ranges from 86.9 [1] to 89% [2]. The nucleotide sequence of spines protein on the envelope of the virus is also highly consistent with that of bat-SL-CoVZC45 (84%) and SARS-CoV (78%). The physicochemical property of 2019-nCoV has not been clarified clearly yet. It is thought that 2019-nCoV is sensitive to ultraviolet radiation and heating. For example, according to researches on SARS-CoV and MERS-COV, the virus can be inactivated by heating at 56 °C for 30 minutes and by using lipid solvents such as 75% ethanol, chlorine-containing disinfectant, peroxyacetic acid and chloroform, but not by chlorhexidine, according to the researches on SARS-CoV and MERS-CoV.

fulltextpubmed· Body· item PMC7091166

example, according to researches on SARS-CoV and MERS-COV, the virus can be inactivated by heating at 56 °C for 30 minutes and by using lipid solvents such as 75% ethanol, chlorine-containing disinfectant, peroxyacetic acid and chloroform, but not by chlorhexidine, according to the researches on SARS-CoV and MERS-CoV. Epidemiology Infection sources The main sources of the infection are patients infected by 2019-nCoV with or without clinical symptoms [2]. In addition, patients in the incubation period may also have potency to transmit the virus based on the case evidence. Transmission route The novel virus is spread through respiratory droplets when patients cough, talk loudly or sneeze. Close contact is also a source of transmission (e.g., contact with the mouth, nose or eye conjunctiva through contaminated hand). Whether transmission can occur through mother–infant vertically or breast milk has not been established yet. Susceptible population There are general susceptibilities in all groups, with the elderly and people with basic diseases more likely to become severe cases. Children may have mild clinical symptoms after infection [3]. Clinical characteristics Clinical presentations The incubation period of 2019-nCoV infections ranges from 2 to 14 days, though most often rangs from 3 to 7 days [3].

fulltextpubmed· Body· item PMC7091166

Susceptible population There are general susceptibilities in all groups, with the elderly and people with basic diseases more likely to become severe cases. Children may have mild clinical symptoms after infection [3]. Clinical characteristics Clinical presentations The incubation period of 2019-nCoV infections ranges from 2 to 14 days, though most often rangs from 3 to 7 days [3]. At the onset of the disease, infected children mainly present with fever, fatigue and cough, which may be accompanied by nasal congestion, runny nose, expectoration, diarrhea, headache, etc. Most of the children had low to moderate fever, even no fever. Dyspnea, cyanosis and other symptoms can occur as the condition progresses usually after 1 week of the disease, accompanied by systemic toxic symptoms, such as malaise or restlessness, poor feeding, bad appetite and less activity. The condition of some children may progress rapidly and may develop into respiratory failure that cannot be corrected by conventional oxygen (nasal catheter, mask) within 1–3 days. In these severe cases, even septic shock, metabolic acidosis and irreversible bleeding and coagulation dysfunction may occur.

fulltextpubmed· Body· item PMC7091166

ess activity. The condition of some children may progress rapidly and may develop into respiratory failure that cannot be corrected by conventional oxygen (nasal catheter, mask) within 1–3 days. In these severe cases, even septic shock, metabolic acidosis and irreversible bleeding and coagulation dysfunction may occur. Rapid respiration rate and moist rales on auscultation usually indicate pneumonia. The criteria for rapid respiratory rate are as follows: ≥ 60 times/min for less than 2 months old; ≥ 50 times/min for 2–12 months old, ≥ 40 times/min for 1–5 years old, ≥ 30 times/min for > 5 years old (after ruling out the effects of fever and crying). With the aggravation of the disease, respiratory distress, nasal flaring, suprasternal, intercostal and subcostal retractions, grunting and cyanosis may occur. Maternal hypoxemia caused by severe infection can lead to intrauterine asphyxia, premature delivery and other risks. Neonates, especially preterm infants, who are more likely to present with insidious and non-specific symptoms need more close observation. According to the current conditions of the reported cases, the children mainly belong to family cluster cases. Most of them have good prognosis, and in mild cases recover 1–2 weeks after disease onset. No deaths in children have been reported up to now. Laboratory examinations [3] Routine blood test White blood cell count is usually normal or reduced, with decreased lymphocyte count; progressive lymphocytopenia in severe cases. C-reactive protein (CRP) normal or increased.

fulltextpubmed· Body· item PMC7091166

According to the current conditions of the reported cases, the children mainly belong to family cluster cases. Most of them have good prognosis, and in mild cases recover 1–2 weeks after disease onset. No deaths in children have been reported up to now. Laboratory examinations [3] Routine blood test White blood cell count is usually normal or reduced, with decreased lymphocyte count; progressive lymphocytopenia in severe cases. C-reactive protein (CRP) normal or increased. Procalcitonin (PCT) Normal in most cases. The level of PCT > 0.5 ng/mL indicates the co-infection with bacteria. Others Elevation of liver enzymes, muscle enzymes and myoglobin, and increased level of D-dimer might be seen in severe cases. Etiologic detection Nucleic acid testing is the main method of laboratory diagnosis. 2019-nCoV nucleic acid can be detected by RT-PCR or by viral gene sequencing of throat swabs, sputum, stool or blood samples. Other methods 2019-nCoV particles can be isolated from human respiratory epithelial cells through virus culture [4, 5], but this experiment cannot be carried out in general laboratories. Virus antigen or serological antibody testing kits are not available at present. Imaging features [3] Chest X-ray examination In the early stage of pneumonia cases, chest images show multiple small patchy shadows and interstitial changes [4], remarkable in the lung periphery [2]. Severe cases can further develop to bilateral multiple ground-glass opacity, infiltrating shadows, and pulmonary consolidation, with infrequent pleural effusion.

fulltextpubmed· Body· item PMC7091166

ion In the early stage of pneumonia cases, chest images show multiple small patchy shadows and interstitial changes [4], remarkable in the lung periphery [2]. Severe cases can further develop to bilateral multiple ground-glass opacity, infiltrating shadows, and pulmonary consolidation, with infrequent pleural effusion. Chest CT scan Pulmonary lesions are shown more clearly by CT, including ground-glass opacity and segmental consolidation in bilateral lungs, especially in the lung periphery. In children with severe infection, multiple lobar lesions may be present in both lungs. Diagnostic criteria Suspected cases Patients should be suspected of 2019-nCoV infection who if they meet any one of the criteria in the epidemiological history and any two of the criteria in clinical manifestations. Epidemiological history Children with a travel or residence history in Wuhan City and neighboring areas, or other areas with persistent local transmission within 14 days prior to disease onset. Children with a history of contacting patients with fever or respiratory symptoms who have a travel or residence history in Wuhan City and neighboring areas, or in other areas with persistent local transmission within 14 days prior to disease onset. Children with a history of contacting confirmed or suspected cases infected with 2019-nCoV within 14 days prior to disease onset. Children who are related with a cluster outbreak: in addition to this patient, there are other patients with fever or respiratory symptoms, including suspected or confirmed cases infected with 2019-nCoV.

fulltextpubmed· Body· item PMC7091166

Children with a history of contacting confirmed or suspected cases infected with 2019-nCoV within 14 days prior to disease onset. Children who are related with a cluster outbreak: in addition to this patient, there are other patients with fever or respiratory symptoms, including suspected or confirmed cases infected with 2019-nCoV. Newborns delivered by suspected or confirmed 2019-nCoV-infected mothers. Clinical presentations Fever, fatigue, dry cough; some pediatric patients may have no fever. Patients with the above-mentioned chest imaging findings (refer to the section of imaging features); In the early phase of the disease, white blood cell counts are normal or decreased, or with decreased lymphocyte count. Confirmed cases Suspected cases who meet any one of the following criteria:Throat swab, sputum, stool, or blood samples tested positive for 2019-nCoV nucleic acid using RT-PCR; Genetic sequencing of throat swab, sputum, stool, or blood samples being highly homologous with the known 2019-nCoV; 2019-nCoV granules being isolated by culture from throat swab, sputum, stool, or blood samples.

fulltextpubmed· Body· item PMC7091166

Confirmed cases Suspected cases who meet any one of the following criteria:Throat swab, sputum, stool, or blood samples tested positive for 2019-nCoV nucleic acid using RT-PCR; Genetic sequencing of throat swab, sputum, stool, or blood samples being highly homologous with the known 2019-nCoV; 2019-nCoV granules being isolated by culture from throat swab, sputum, stool, or blood samples. It is necessary to strengthen the awareness of the early identification of the disease. In clinic, screening was conducted mainly according to the epidemiological history and fever or respiratory symptoms, and pathogen examination should be carried out on time. Furthermore, effective isolation measures and appropriate treatment need to be provided promptly. Even if the common respiratory pathogen tests are positive, children who have a history of close contact with 2019-nCoV-infected cases also are recommended for timely 2019-nCoV pathogen testing. Clinical classifications Mild type This type of patient includes those with asymptomatic infection, upper respiratory infection (URI) and mild pneumonia. Symptoms include fever, cough, sore throat, fatigue, headache or myalgia. Some patients show pneumonia signs on chest imaging. These patients do not have any of the severe or critical symptoms and complications described below. Severe pneumonia Disease progresses to meet any of the following conditions [6]:Significantly increased respiration rate: RR ≥ 70/min (≤ 1 year), RR ≥ 50/min (> 1 year).

fulltextpubmed· Body· item PMC7091166

Clinical classifications Mild type This type of patient includes those with asymptomatic infection, upper respiratory infection (URI) and mild pneumonia. Symptoms include fever, cough, sore throat, fatigue, headache or myalgia. Some patients show pneumonia signs on chest imaging. These patients do not have any of the severe or critical symptoms and complications described below. Severe pneumonia Disease progresses to meet any of the following conditions [6]:Significantly increased respiration rate: RR ≥ 70/min (≤ 1 year), RR ≥ 50/min (> 1 year). Hypoxia: SpO2 ≤ 93% (< 90% in premature infants) or nasal flaring, suprasternal, intercostal and subcostal retractions, grunting and cyanosis, apnea, etc. Blood gas analysis: PaO2 < 60 mmHg, PaCO2 > 50 mmHg. Consciousness disorders: restlessness, lethargy, coma, convulsion, etc. Poor feeding, bad appetite, and even dehydration. Other manifestations: coagulation disorders (prolonged prothrombin time and elevated level of d-dimer), myocardial damage (increased level of myocardial enzyme, electrocardiogram ST-T changes, cardiomegaly and cardiac insufficiency in severe cases), gastrointestinal dysfunction, raised level of liver enzyme and rhabdomyolysis. Critical cases Disease progresses rapidly along with organ failure with any of the following conditions:Respiratory failure which requires mechanical ventilation Patients present with acute respiratory distress syndrome (ARDS) and are featured by refractory hypoxemia, which cannot be alleviated by conventional oxygen therapy, such as nasal catheter or mask oxygen supplement.

fulltextpubmed· Body· item PMC7091166

n failure with any of the following conditions:Respiratory failure which requires mechanical ventilation Patients present with acute respiratory distress syndrome (ARDS) and are featured by refractory hypoxemia, which cannot be alleviated by conventional oxygen therapy, such as nasal catheter or mask oxygen supplement. Septic shock In addition to severe pulmonary infection, 2019-nCoV can cause damage and dysfunction of other organs. When dysfunction of extrapulmonary system such as circulation, blood and digestive system occurs, the possibility of sepsis and septic shock should be considered and the mortality rate increases significantly. Accompanied by other organ failure that needs ICU monitoring and treatment. Differential diagnosis Other viral respiratory infections Viruses such as SARS virus, influenza virus, parainfluenza virus, adenovirus, respiratory syncytial virus and metapneumovirus can cause viral respiratory infections. Patients commonly present with fever, cough and dyspnea, and interstitial pneumonia in some cases. Most of the cases have normal or decreased white blood cell counts, while severely infected children show reduced level of lymphocyte count. Similar to 2019-nCoV, all of these viruses can transmit through respiratory tract or direct contact, which is characterized by clustering onset. Epidemiological exposure history plays an important role in differential diagnosis, which is mainly confirmed by laboratory examinations.

fulltextpubmed· Body· item PMC7091166

ow reduced level of lymphocyte count. Similar to 2019-nCoV, all of these viruses can transmit through respiratory tract or direct contact, which is characterized by clustering onset. Epidemiological exposure history plays an important role in differential diagnosis, which is mainly confirmed by laboratory examinations. Bacterial pneumonia Patients with bacterial pneumonia mostly display high fever and toxic appearance. In the early stage of the disease, cough is not obvious but moist rale can be heard. Chest image may show small patchy shadows, or segmental or even lobar consolidation. Blood routine examination shows increased white blood cell count with neutrophil predominating, as well as elevated CRP. Noninvasive pneumonia is usually accompanied by obvious cough. Antibiotics are effective. Blood or deep sputum culture is helpful for diagnosis of bacterial pneumonia. Mycoplasmal pneumonia Mycoplasmal pneumonia may occur in any season and in schools and child-care institutions with small epidemic. Patients are predominantly school-age children, but the number of younger children is increasing. They usually start with high fever and cough. Chest images may reveal manifestations including reticular shadows and small patchy or large consolidation. Blood routine examination shows that the white blood cell count is normal or increased and CRP is slightly elevated. Nucleic acid detection of airway secretion and serum mycoplasma-specific IgM determination are helpful for differential diagnosis.

fulltextpubmed· Body· item PMC7091166

ons including reticular shadows and small patchy or large consolidation. Blood routine examination shows that the white blood cell count is normal or increased and CRP is slightly elevated. Nucleic acid detection of airway secretion and serum mycoplasma-specific IgM determination are helpful for differential diagnosis. It should be noted that patients with 2019-nCoV infection can have co-infection or superimposed infection with other viruses or bacteria simultaneously. Management principles The four principles of “early identification”, “early isolation”, “early diagnosis”, and “early treatment” should be emphasized. Strict isolation strategies Medical isolation is supposed to be carried out once the suspected cases are identified. The confirmed cases should be admitted to the designated hospitals. Mild cases Avoid using broad-spectrum antibiotics and corticosteroids. Severe and critical case Antibiotics, corticosteroids, bronchoalveolar lavage, mechanical ventilation, and other more invasive intervention, such as blood purification and extracorporeal membrane oxygenation (EMCO) should be applied cautiously, based on cost–benefit evaluation. Multidisciplinary cooperation Monitoring patient’s conditions closely and adjusting the therapeutic protocols timely through multidisciplinary cooperation are of great significance. Treatments Medical isolation Suspected case should be isolated in a single room, while confirmed cases can be arranged in the same room.

fulltextpubmed· Body· item PMC7091166

Severe and critical case Antibiotics, corticosteroids, bronchoalveolar lavage, mechanical ventilation, and other more invasive intervention, such as blood purification and extracorporeal membrane oxygenation (EMCO) should be applied cautiously, based on cost–benefit evaluation. Multidisciplinary cooperation Monitoring patient’s conditions closely and adjusting the therapeutic protocols timely through multidisciplinary cooperation are of great significance. Treatments Medical isolation Suspected case should be isolated in a single room, while confirmed cases can be arranged in the same room. Assessment During the course of treatment, pay close attention to the changes in children's conditions, regularly monitor vital signs, SpO2, etc., and identify the severe and critical cases as early as possible. General treatments The general strategies include bed rest and supportive treatments; ensuring sufficient calorie and water intake; maintaining water electrolyte balance and homeostasis, and strengthening psychotherapy for elder children when necessary. Antiviral therapy There are no effective antiviral drugs for children at present. Interferon-α2b nebulization can be applied, and the recommended usage is as follows:Interferon-α2b nebulization 100,000–200,000 IU/kg for mild cases, and 200,000–400,000 IU/kg for severe cases, two times/day for 5–7 days.

fulltextpubmed· Body· item PMC7091166

General treatments The general strategies include bed rest and supportive treatments; ensuring sufficient calorie and water intake; maintaining water electrolyte balance and homeostasis, and strengthening psychotherapy for elder children when necessary. Antiviral therapy There are no effective antiviral drugs for children at present. Interferon-α2b nebulization can be applied, and the recommended usage is as follows:Interferon-α2b nebulization 100,000–200,000 IU/kg for mild cases, and 200,000–400,000 IU/kg for severe cases, two times/day for 5–7 days. Lopinavir/litonavir (200 mg/50 mg) The recommended doses: weight 7–15 kg, 12 mg/3 mg/kg; weight 15–40 kg, 10 mg/2.5 mg/kg; weight > 40 kg, 400 mg/100 mg as adult each time, twice a day for 1–2 weeks [3, 7, 8]. However, the efficacy, treatment course and safety of the above drugs remain to be determined. Antibiotics application Irrational use of antibiotics should be avoided. Bacteriological monitoring should be strengthened. If there is evidence of secondary bacterial infection, appropriate antibiotics should be used timely. Immunomodulating therapy Corticosteroids should be avoided in common type of infection. However, it can be considered in the following situations:With rapidly deteriorating chest imaging and occurence of ARDS. With obvious toxic symptoms, encephalitis or encephalopathy, hemophagocytic syndrome and other serious complications. With septic shock. With obvious wheezing symptoms. Intravenous methylprednisolone (1–2 mg/kg/day) is recommended for 3–5 days, but not for long-term use [3, 5, 9–11].

fulltextpubmed· Body· item PMC7091166

idified high-flow nasal cannula (HHHFNC), non-invasive ventilation such as continuous positive airway pressure (CPAP), or non-invasive high-frequency ventilation can be used. If improvement is not possible, mechanical ventilation with endotracheal intubation and a protective lung ventilation strategy should be adopted. Blood purification Continuous blood purification should be considered in cases of multiple organ failure (especially acute kidney injury), or capacity overload and life-threatening imbalance of water, electrolyte, and acid–base. The therapeutic model may include continuous veno-venous hemofiltration (CVVH), continuous veno-venous hemodiafiltration (CVVHDF), or heterozygosis. If combined with liver failure, plasma exchange is feasible. Extracorporeal membrane oxygenation (ECMO) ECMO therapy should be considered when mechanical ventilation, blood purification, and other means are ineffective, and cardiopulmonary failure occurs which is difficult to correct.ECMO indications [14]. PaO2/FiO2 < 50 mmHg or oxygen index (OI) > 40 for more than 6 h, or severe respiratory acidosis (pH < 7.15). High mean airway pressure (MAP) during mechanical ventilation, or severe air leakage and other severe complications. Circulation function cannot be improved with conventional treatment, or large amounts of vasoactive drugs are required to maintain basal blood pressure, or lactic acid levels continuously rise.

fulltextpubmed· Body· item PMC7091166

PaO2/FiO2 < 50 mmHg or oxygen index (OI) > 40 for more than 6 h, or severe respiratory acidosis (pH < 7.15). High mean airway pressure (MAP) during mechanical ventilation, or severe air leakage and other severe complications. Circulation function cannot be improved with conventional treatment, or large amounts of vasoactive drugs are required to maintain basal blood pressure, or lactic acid levels continuously rise. Contraindication [14] ECMO should be contraindicated or used with caution if the duration of mechanical ventilation is more than 2 weeks, or if serious brain failure or bleeding tendency occurs. Discharge criteria Children with body temperature back to normal for at least 3 days, significant improvement in respiratory symptoms,and completion of two consecutive negative tests of respiratory pathogenic nucleic acid (sampling interval of at least 1 day) can be discharged. If necessary, home isolation for 14 days is suggested after discharge. Principle of transportation Special vehicles should be used to transfer infected patients. Strict protection for staff of transportation and disinfection for the vehicle are of vital importance. Enforcing close to the lines of notification of the project for transportation of pneumonia cases infected with novel coronavirus (trial version) published by the National Health Commission of People’s Republic of China is required.

fulltextpubmed· Body· item PMC7091166

n for staff of transportation and disinfection for the vehicle are of vital importance. Enforcing close to the lines of notification of the project for transportation of pneumonia cases infected with novel coronavirus (trial version) published by the National Health Commission of People’s Republic of China is required. Infection control in hospital Strict implementation of standard prevention Medical personnel are supposed to have good personal protection, hand hygiene, ward management, environmental ventilation, object surface cleaning and disinfection, medical waste management and other hospital infection control work, based on the standard prevention protocol, to minimize nosocomial infection. Personal protective equipment All medical personnel are required to wear surgical masks during medical activities. Pre-check triage: wearing medical overalls, caps, and surgical masks.

fulltextpubmed· Body· item PMC7091166

Infection control in hospital Strict implementation of standard prevention Medical personnel are supposed to have good personal protection, hand hygiene, ward management, environmental ventilation, object surface cleaning and disinfection, medical waste management and other hospital infection control work, based on the standard prevention protocol, to minimize nosocomial infection. Personal protective equipment All medical personnel are required to wear surgical masks during medical activities. Pre-check triage: wearing medical overalls, caps, and surgical masks. Fever clinic, respiratory clinic, emergency department, infectious diseases department, and isolation ward: equipped with medical overalls, caps, disposable isolation clothing, surgical masks, and goggles or face shield for daily medical activities and ward rounds; fit with goggles or face shield is stressed when collecting respiratory samples; using latex gloves in addition when contacting with blood, body fluid, secreta, or excreta; wearing surgical masks, goggles or face shield, latex gloves, medical protective clothing (disposable impermeable isolation clothing can be added), and respiratory hood when necessary, to prevent aerosol or splash during operations of endotracheal intubation, bronchoscopy, airway nursing, and sputum suction. Medical personnel should wear and remove personal protective equipment in strict accordance with the on–off procedure, rather than leaving ward with the contaminated equipment, so as to avoid cross-contamination in different zones.

fulltextpubmed· Body· item PMC7091166

Fever clinic, respiratory clinic, emergency department, infectious diseases department, and isolation ward: equipped with medical overalls, caps, disposable isolation clothing, surgical masks, and goggles or face shield for daily medical activities and ward rounds; fit with goggles or face shield is stressed when collecting respiratory samples; using latex gloves in addition when contacting with blood, body fluid, secreta, or excreta; wearing surgical masks, goggles or face shield, latex gloves, medical protective clothing (disposable impermeable isolation clothing can be added), and respiratory hood when necessary, to prevent aerosol or splash during operations of endotracheal intubation, bronchoscopy, airway nursing, and sputum suction. Medical personnel should wear and remove personal protective equipment in strict accordance with the on–off procedure, rather than leaving ward with the contaminated equipment, so as to avoid cross-contamination in different zones. Patients and their accompanying family members are required to wear surgical masks. Additional notes Channels for medical personnel and patients in the isolation ward should be separated and equipped with medical personnel channel buffer zone. Wearing gloves cannot replace hand hygiene. Perform strict visiting regulations for pediatric patients admitted in isolation, and ask visitors to have personal protection according to relevant regulations when necessary. Optimize medical procedures to reduce the frequency of medical personnel’s contact with patients.

fulltextpubmed· Body· item PMC7091166

Channels for medical personnel and patients in the isolation ward should be separated and equipped with medical personnel channel buffer zone. Wearing gloves cannot replace hand hygiene. Perform strict visiting regulations for pediatric patients admitted in isolation, and ask visitors to have personal protection according to relevant regulations when necessary. Optimize medical procedures to reduce the frequency of medical personnel’s contact with patients. Attention should be paid to the strict elimination and disinfection of the patient's secretions and excretions. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions All authors drafted part of the manuscript and approved the final version. Funding None. Compliance with ethical standards Ethical approval None. Conflict of interest All authors declared no conflict of interest related to this paper.

fulltextpubmed· Body· item PMC7091212

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 Childrens Hospital, Zhejiang University School of Medicine Hangzhou 26684315 69 10.1007/s12519-015-0069-4 Original Article Detection of respiratory viruses and bacteria in children using a twenty-two target reverse-transcription real-time PCR (RT-qPCR) panel Ellis Chelsey 1 Misir Amita 1 Hui Charles 1 Jabbour Mona 1 Barrowman Nicholas 1 Langill Jonathan 1 Bowes Jennifer 1 Slinger Robert 613-737-7600613-738-4832slinger@cheo.on.ca 12 1 grid.28046.380000000121822255Children’s Hospital of Eastern Ontario, Children’s Hospital of Eastern Ontario Research Institute, University of Ottawa, Ottawa, Canada 2 grid.28046.380000000121822255Children’s Hospital of Eastern Ontario, University of Ottawa, 401 Smyth Rd, Ottawa, ON K1H 8L1 Canada 18 12 2015 2016 12 2 183 189 28 5 2014 12 1 2015 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2015This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Rapid detection of the wide range of viruses and bacteria that cause respiratory infection in children is important for patient care and antibiotic stewardship. We therefore designed and evaluated a ready-to-use 22 target respiratory infection reverse-transcription real-time polymerase chain reaction (RT-qPCR) panel to determine if this would improve detection of these agents at our pediatric hospital.

fulltextpubmed· Body· item PMC7091212

ction in children is important for patient care and antibiotic stewardship. We therefore designed and evaluated a ready-to-use 22 target respiratory infection reverse-transcription real-time polymerase chain reaction (RT-qPCR) panel to determine if this would improve detection of these agents at our pediatric hospital. Methods RT-qPCR assays for twenty-two target organisms were dried-down in individual wells of 96 well plates and saved at room temperature. Targets included 18 respiratory viruses and 4 bacteria. After automated nucleic acid extraction of nasopharyngeal aspirate (NPA) samples, rapid qPCR was performed. RT-qPCR results were compared with those obtained by the testing methods used at our hospital laboratories. Results One hundred fifty-nine pediatric NPA samples were tested with the RT-qPCR panel. One or more respiratory pathogens were detected in 132/159 (83%) samples. This was significantly higher than the detection rate of standard methods (94/159, 59%) (P<0.001). This difference was mainly due to improved RT-qPCR detection of rhinoviruses, parainfluenza viruses, bocavirus, and coronaviruses. The panel internal control assay performance remained stable at room temperature storage over a two-month testing period.

fulltextpubmed· Body· item PMC7091212

han the detection rate of standard methods (94/159, 59%) (P<0.001). This difference was mainly due to improved RT-qPCR detection of rhinoviruses, parainfluenza viruses, bocavirus, and coronaviruses. The panel internal control assay performance remained stable at room temperature storage over a two-month testing period. Conclusion The RT-qPCR panel was able to identify pathogens in a high proportion of respiratory samples. The panel detected more positive specimens than the methods in use at our hospital. The pre-made panel format was easy to use and rapid, with results available in approximately 90 minutes. We now plan to determine if use of this panel improves patient care and antibiotic stewardship. Keywords bacterial infectionspediatricpolymerase chain reactionrespiratory infectious diseasesviral infectionsissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2016

fulltextpubmed· Body· item PMC7091225

Introduction The outbreak of coronavirus disease 2019 (COVID-19, previously known as 2019-nCoV) caused by SARS-CoV-2 infection in Wuhan City, China, has spread around the world [1]. As of 24 February, more than 77,262 confirmed patients have been reported in China, and several patients have been confirmed in 29 countries. Among the confirmed patients in china, 9915 were severe patients and 2592 died [2]. In addition, most of those who died had underlying health conditions such as hypertension, diabetes or cardiovascular disease which compromised their immune system [3]. Previous studies have shown that patients with COVID-19 present with fever, dry cough, dyspnea, fatigue and lymphopenia. SARS-CoV-2 is more likely to infect elderly adult men; and those with chronic comorbidities are at higher risk of severe acute respiratory syndrome and even death in severe patients [4–6]. Infected children have relatively milder clinical symptoms compared with infected adults [7], and no deaths have been reported in the pediatric population up to now. Mildly affected pediatric patients have been reported with an age of onset ranging from 17 days to 17 years [8]. However, specific information characterizing severely affected pediatric patients remains unknown.

fulltextpubmed· Body· item PMC7091225

s compared with infected adults [7], and no deaths have been reported in the pediatric population up to now. Mildly affected pediatric patients have been reported with an age of onset ranging from 17 days to 17 years [8]. However, specific information characterizing severely affected pediatric patients remains unknown. For better understanding of the clinical features of severe pediatric patients with COVID-19 and for improving the diagnosis and treatment, we aimed to describe epidemiological and clinical features, imaging data, laboratory findings, clinical treatments and outcomes of severely or critically ill pediatric patients with COVID-19 in Wuhan City, China. Methods Patients We included eight severely or critically ill patients with COVID-19 who were treated at the Intensive Care Unit (ICU), Wuhan Children’s Hospital from January 24 to February 24. COVID-19 was confirmed in all patients by positive results of real-time reverse transcription-polymerase chain reaction (RT-PCR) assay for nasopharyngeal swab specimens. Clinical staging of the patients was classified according to “Interim Guidance for Diagnosis and Treatment of Coronavirus Disease 2019 (the 6th edition)” released by National Health Commission [9]. Severe COVID-19 was defined when the pediatric patients met any of the following criteria: (1) increased respiratory rate: ≥ 30 times/min; (2) oxygen saturation < 93% under a resting state, and (3) arterial partial pressure of oxygen (PaO2)/oxygen concentration (FiO2) ≤ 300 mmHg (1 mmHg = 0.133 kPa).

fulltextpubmed· Body· item PMC7091225

Methods Patients We included eight severely or critically ill patients with COVID-19 who were treated at the Intensive Care Unit (ICU), Wuhan Children’s Hospital from January 24 to February 24. COVID-19 was confirmed in all patients by positive results of real-time reverse transcription-polymerase chain reaction (RT-PCR) assay for nasopharyngeal swab specimens. Clinical staging of the patients was classified according to “Interim Guidance for Diagnosis and Treatment of Coronavirus Disease 2019 (the 6th edition)” released by National Health Commission [9]. Severe COVID-19 was defined when the pediatric patients met any of the following criteria: (1) increased respiratory rate: ≥ 30 times/min; (2) oxygen saturation < 93% under a resting state, and (3) arterial partial pressure of oxygen (PaO2)/oxygen concentration (FiO2) ≤ 300 mmHg (1 mmHg = 0.133 kPa). Critically ill COVID-19 was defined when the pediatric patients met any of the following criteria: (1) respiratory failure which requires mechanical ventilation; (2) septic shock, and (3) accompanied by other organ failure that needs ICU monitoring and treatment.

fulltextpubmed· Body· item PMC7091225

Severe COVID-19 was defined when the pediatric patients met any of the following criteria: (1) increased respiratory rate: ≥ 30 times/min; (2) oxygen saturation < 93% under a resting state, and (3) arterial partial pressure of oxygen (PaO2)/oxygen concentration (FiO2) ≤ 300 mmHg (1 mmHg = 0.133 kPa). Critically ill COVID-19 was defined when the pediatric patients met any of the following criteria: (1) respiratory failure which requires mechanical ventilation; (2) septic shock, and (3) accompanied by other organ failure that needs ICU monitoring and treatment. Data collection Demographic information and clinical characteristics including exposure history, anamnesis, signs and symptoms, chest computed tomographic (CT) scan or X-ray results, complications, treatments, clinical outcomes, and laboratory findings of each patient were obtained from the Electronic Medical Record System of Wuhan Children’s Hospital. The dates of patients’ disease onset and hospital admission, incubation period, days from illness onset to diagnosis confirmation, disease duration, as well as history of familial cluster were recorded.

fulltextpubmed· Body· item PMC7091225

ratory findings of each patient were obtained from the Electronic Medical Record System of Wuhan Children’s Hospital. The dates of patients’ disease onset and hospital admission, incubation period, days from illness onset to diagnosis confirmation, disease duration, as well as history of familial cluster were recorded. Laboratory tests were conducted upon admission, including a complete blood count (leucocytes, neutrophils, lymphocytes, thrombocyte, hemoglobin), serum biochemistry (C-reactive protein, procalcitonin, lactate dehydrogenase, aspartate aminotransferase, alanine aminotransferase, total bilirubin, creatine kinase, creatinine and D-dimer), TBNK test (CD16 + CD56 + CD3 +, CD4 + T, CD8 + T and Th/Ts), cytokine detection assays (IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ) and identification of other respiratory pathogens such as influenza A virus (H1N1, H3N2, H7N9), influenza B virus, respiratory syncytial virus, parainfluenza virus and adenovirus.

fulltextpubmed· Body· item PMC7091225

D-dimer), TBNK test (CD16 + CD56 + CD3 +, CD4 + T, CD8 + T and Th/Ts), cytokine detection assays (IL-2, IL-4, IL-6, IL-10, TNF-α and IFN-γ) and identification of other respiratory pathogens such as influenza A virus (H1N1, H3N2, H7N9), influenza B virus, respiratory syncytial virus, parainfluenza virus and adenovirus. Results Demographic and baseline characteristics Eight pediatric patients with COVID-19 treated in ICU were included in this study. Among them, three were critically ill patients, and five severely ill. Six were males and two females. The age ranged from 2 months to 15 years (Table 1). Five patients were family-clustered cases and had a close contact history with confirmed or suspected COVID-19 patients; one was infected during hospitalization. The transmission way was still unclear in two patients. The incubation period of four patients ranged from 5 to 10 days. Duration from illness onset to disease confirmation of seven patients ranged from 3 to 15 days. One patient (patient 8) who had a close contact history with infected patients was confirmed by RT-PCR test before symptoms appeared. Disease duration of all patients was over 10 days, and over 20 days in critically ill patients. All children were reported to be living in Wuhan during the outbreak period of COVID-19.Table 1 Demographics, baseline characteristics and symptoms of eight pediatric patients with coronavirus disease 2019 (COVID-19)

fulltextpubmed· Body· item PMC7091225

peared. Disease duration of all patients was over 10 days, and over 20 days in critically ill patients. All children were reported to be living in Wuhan during the outbreak period of COVID-19.Table 1 Demographics, baseline characteristics and symptoms of eight pediatric patients with coronavirus disease 2019 (COVID-19) Variables Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7 Patient 8 Characteristics Age 8 y 10 mon 1 y, 1 mon 2 mon 2 y, 1 mon 15 y 13 y, 11 mon 13 y, 5 mon Sex Male Female Male Male Male Female Male Male Exposure history Close contact with COVID-19 patient Close contact with suspected COVID-19 patient Close contact with COVID-19 patient Close contact with COVID-19 patient Close contact with COVID-19 patient Anamnesis Acute lymphocytic leukemia Lacrimal sac dredge Pharyngitis Incubation period (d) NA 7 NA 10 NA NA 5 5 Days from illness onset to diagnosis confirmation (d) 12 3 15 6 9 12 5 0 Disease duration (d) 28+ 20+ 24 20 16 19 12 9+ Familial cluster Yes Yes Yes Yes Yes Severely/critically ill Critically ill Critically ill Critically ill Severe Severe Severe Severe Severe Symptoms Fever Yes Yes Yes Yes Yes Yes Cough Yes Yes Yes Yes Yes Yes Fatigue/myalgia Yes Headache Yes Expectoration Yes Yes Yes Yes Nausea/vomiting Yes Yes Yes Yes Diarrhea Yes Yes Yes Constipation Yes Polypnea Yes Yes Yes Yes Yes Yes Yes Yes Lung auscultation Rales Crackles Crackles Rales Crackles Rales Rales Rales Chest CT/X-ray Unilateral pneumonia Yes Yes Bilateral pneumonia Yes Yes Yes Yes Yes Yes Imaging changes Multiple patch-like shadows, GGO, "white lung" appearance Multiple patch-like shadows, pleural effusion, GGO Multiple patch-like shadows, GGO Multiple patch-like shadows Multiple patch-like Multiple patch-like shadows, GGO GGO Multiple mottling, GGO Complications Intussusception, toxic encephalopathy, status epilepticus, DIC, septic shock, MODS Septic shock, MODS, Kidney stone, Hydronephrosis, Cardiac insufficiency, Coagulopathy Hypoglobulinemia Gastroenteritis NA not available, COVID-19 coronavirus disease 2019, CT computed tomography, DIC disseminated intravascular coagulation, GGO ground-glass opacity, MODS multi-organ dysfunction syndrome

fulltextpubmed· Body· item PMC7091225

ptic shock, MODS Septic shock, MODS, Kidney stone, Hydronephrosis, Cardiac insufficiency, Coagulopathy Hypoglobulinemia Gastroenteritis NA not available, COVID-19 coronavirus disease 2019, CT computed tomography, DIC disseminated intravascular coagulation, GGO ground-glass opacity, MODS multi-organ dysfunction syndrome Clinical characteristics and chest imaging results In the severe pediatric patients, the most common symptom was polypnea (8/8), followed by fever (6/8), cough (6/8), expectoration (4/8), nausea/vomiting (4/8), diarrhea (3/8), fatigue/myalgia (1/8), headache (1/8) and constipation (1/8) (Table 1). Lung auscultation revealed rales in the left or right lower lobe in five patients (5/8) and crackles in the others (3/8). All patients had remarkable abnormalities in chest (CT) scanning or X-ray (Table 1). Six patients had bilateral pneumonia and two unilateral pneumonia. Imaging changes included multiple patch-like shadows (7/8), ground-glass opacity (GGO) (6/8), pleural effusion (1/8) and "white lung-like" change (1/8). The followings were imaging results of three typical patients.

fulltextpubmed· Body· item PMC7091225

est (CT) scanning or X-ray (Table 1). Six patients had bilateral pneumonia and two unilateral pneumonia. Imaging changes included multiple patch-like shadows (7/8), ground-glass opacity (GGO) (6/8), pleural effusion (1/8) and "white lung-like" change (1/8). The followings were imaging results of three typical patients. Patient 1 was an 8-year-old boy, who was infected with COVID-19 when under blood transfusion for treating acute lymphoblastic leukemia during hospitalization. Chest CT demonstrated multiple patch-like shadows (January 31) and high density shadows and GGO (February 13). His condition deteriorated and chest X-rays demonstrated decreased brightness of the lung and "white lung" appearance on February 23 (Fig. 1).Fig. 1 Chest x-rays and chest CTs of patient 1. a Multiple patch-like shadows (Jan. 31). b High density shadows and ground-glass opacity (Feb.13). c Brightness of lung decreased and "white lung-like" changes appeared (Feb. 23) Patient 2 was a 10-month-old infant, who had a close contact with a critically ill COVID-19 patient (her mother). Chest CT demonstrated small dense shadows and pleural effusion on February 4, GGO and consolidation shadow on February 9, and lesions deteriorated on February 12. Chest X-rays obviously improved until February 22 (Fig. 2).Fig. 2 Chest X-rays and chest CTs of patient 2. a Small dense shadows and pleural effusion (Feb. 4). b Ground-glass opacity and consolidation shadow (Feb. 9). c Lesions progress (Feb.12). d Chest X-rays obviously improved

fulltextpubmed· Body· item PMC7091225

nd lesions deteriorated on February 12. Chest X-rays obviously improved until February 22 (Fig. 2).Fig. 2 Chest X-rays and chest CTs of patient 2. a Small dense shadows and pleural effusion (Feb. 4). b Ground-glass opacity and consolidation shadow (Feb. 9). c Lesions progress (Feb.12). d Chest X-rays obviously improved Patient 6 was a 15-year-old girl, who had a close contact with a confirmed COVID-19 patient. Chest CT demonstrated multiple patch-like shadows and GGO bilateral both lungs (February 14), which was obviously improved on February 18 (Fig. 3).Fig. 3 Chest CTs of patient 6. a Multiple patch-like shadows and ground-glass opacity in both lungs (Feb. 8). b Lesions obviously improved (Feb. 14) Septic shock and multiple organ dysfunction syndrome (MODS) were the most common complications in critically ill patients. Patient 2 was complicated with septic shock, MODS, intussusception, toxic encephalopathy, status epilepticus and disseminated intravascular coagulation (DIC). Patient 3 was complicated with septic shock, MODS, kidney stone, hydronephrosis, cardiac insufficiency and coagulopathy. Patients 4 and 5 were complicated with hypoglobulinemia and gastroenteritis.

fulltextpubmed· Body· item PMC7091225

c shock, MODS, intussusception, toxic encephalopathy, status epilepticus and disseminated intravascular coagulation (DIC). Patient 3 was complicated with septic shock, MODS, kidney stone, hydronephrosis, cardiac insufficiency and coagulopathy. Patients 4 and 5 were complicated with hypoglobulinemia and gastroenteritis. Laboratory assessments COVID-19 was confirmed in all patients by RT-PCR. In this cohort (except patient 1 who had acute lymphocytic leukemia), leucocytes, neutrophils, lymphocytes, thrombocyte and hemoglobin counts were all normal or mildly increased (Table 2). Neutrophils, lymphocytes and hemoglobin were decreased in patient 1. Patient 1 was also infected with Influenza A virus. Increased C-reactive protein, procalcitonin and lactate dehydrogenase were found in five patients (5/8), and increased alanine aminotransferase (ALT) in four (4/8). Total bilirubin level in all patients was normal. Creatine kinase level decreased in one patient and increased in two; patient 2 had a far higher bilirubin level (20,702 U/L) than normal (normal range: 30–170 U/L). Creatinine level decreased in three patients and increased in two patients. Two patients (2/5) had high D-dimer level. TBNK lymphocyte subset analysis revealed decreased percentage of CD16 + CD56 + lymphocytes (4/8) and Th/Ts (1/8), and increased percentage of CD3 + (2/8), CD4 + (4/8) and CD8 + (1/8) lymphocytes. Cytokine detection assays showed increased levels of IL-6 (2/8), IL-10 (5/8) and IFN-γ (2/8).Table 2 Laboratory test results of eight pediatric patients with coronavirus disease 2019 (COVID-19)

fulltextpubmed· Body· item PMC7091225

+ CD56 + lymphocytes (4/8) and Th/Ts (1/8), and increased percentage of CD3 + (2/8), CD4 + (4/8) and CD8 + (1/8) lymphocytes. Cytokine detection assays showed increased levels of IL-6 (2/8), IL-10 (5/8) and IFN-γ (2/8).Table 2 Laboratory test results of eight pediatric patients with coronavirus disease 2019 (COVID-19) Variables Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7 Patient 8 Leucocytes (× 109/L; normal range 3.85–10) 1.65 14.95 9.19 8.32 8.8 10.6 3.85 7.6 Neutrophils (× 109/L; normal range 1.08–5.8) 0.78 11.63 5.7 1.27 3.5 5.9 1.9 3.8 Lymphocytes (× 109/L; normal range 1.15–4) 0.69 1.96 2.7 6.41 3.6 4.04 1.7 2.8 Thrombocyte (× 109/L; normal range 100–320) 140 68 145 666 247 515 154 250 Hemoglobin (g/L; normal range 110–150) 83 90 103 111 123 150 159 136 C-reactive protein (mg/L; normal range 0–3) 6.48 57.9 103 0.75 27.02 1 9.9 0.5 Procalcitonin (ng/mL; normal range 0–0.05) 0.18 17.16 0.05 0.08 0.11 0.04 0.09 0.05 Lactate dehydrogenase (U/L; normal range 175–322) 394 888 282 891 471 370 209 187 Aspartate aminotransferase (U/L; normal range 21–72) 37 27 33 41 16 14 14 16 Alanine aminotransferase (U/L; normal range 15–46) 58 66 36 100 55 9 16 8 Total bilirubin (µmol/L; normal range 3–22) 11.8 20.4 16.5 12.4 5.3 7.8 8.1 8.1 Creatine kinase (U/L; normal range 30–170) 15 20,702 33 148 262 106 72 77 Creatinine (μmol/L; normal range 27–62) 27.1 43.4 21.3 15 24.8 64.5 58 72.1 D-dimer (mg/L FEU; normal range 0–0.55) 0.47 40.34 3.07 0.23 0.44 Other viruses Influenza A virus TBNK test CD16+CD56+ (%; normal range 7.92–33.99) 5.80 1.36 2.30 18.06 5.97 5.08 10.00 10.12 CD3 +  (%; normal range 38.56–70.06) 92.60 58.78 65.80 61.85 66.68 70.22 71.30 62.22 CD4 + T (%; normal range 14.21–36.99) 33.39 37.85 39.38 21.54 39.42 40.24 29.66 30.34 CD8 + T (%; normal range 13.24–38.53) 58.15 20.17 24.01 24.30 24.60 26.47 37.73 30.29 Th/Ts (normal range 0.96–2.05) 0.57 1.88 1.64 0.89 1.6 1.52 0.79 1 Cytokine detection assays IL-2 (pg/mL; normal range 0–11.4) 2.61 1.61 1.57 2.08 1.36 3.96 1.71 IL-4 (pg/mL; normal range 0–12.9) 3.42 2.45 2.63 2.98 2.13 6.24 4.88 IL-6 (pg/mL; normal range 0–20.9) 639.98 117.88 5.44 17.47 2.92 11.05 7.37 IL-10 (pg/mL; normal range 0–5.9) 9.24 17.42 6.94 8.84 2.5 6.25 3.31 TNF-α (pg/mL; normal range 0–5.9) 5.01 2.9 1.41 1.97 0.85 5.7 4.35 IFN-γ (pg/mL; normal range 0–17.3) 10.06 4.36 36.79 20.59 1.12 7.19 4.62

fulltextpubmed· Body· item PMC7091225

) 3.42 2.45 2.63 2.98 2.13 6.24 4.88 IL-6 (pg/mL; normal range 0–20.9) 639.98 117.88 5.44 17.47 2.92 11.05 7.37 IL-10 (pg/mL; normal range 0–5.9) 9.24 17.42 6.94 8.84 2.5 6.25 3.31 TNF-α (pg/mL; normal range 0–5.9) 5.01 2.9 1.41 1.97 0.85 5.7 4.35 IFN-γ (pg/mL; normal range 0–17.3) 10.06 4.36 36.79 20.59 1.12 7.19 4.62 Clinical treatment and outcomes Treatments of COVID-19 remained focusing on symptomatic and respiratory supports (Table 3). Among the eight patients, six (6/8) received high-flow oxygen therapy and two critically ill (2/8) patients received mechanical ventilation. All patients received antiviral treatments (virazole, oseltamivir and interferon). Antibiotics, traditional Chinese medicine, intravenous glucocorticoids and immunoglobulin were also used dependent on patients’ conditions. Symptomatic treatments were given for treating complications in patient 2 and 3. Up to February 24, 2020, three patients (patients 1, 2 and 8) remained in ICU (including two critically ill patients); the others recovered and were discharged home.Table 3 Clinical treatments and outcomes of eight pediatric patients with coronavirus disease 2019 (COVID-19)

fulltextpubmed· Body· item PMC7091225

or treating complications in patient 2 and 3. Up to February 24, 2020, three patients (patients 1, 2 and 8) remained in ICU (including two critically ill patients); the others recovered and were discharged home.Table 3 Clinical treatments and outcomes of eight pediatric patients with coronavirus disease 2019 (COVID-19) Variables Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 Patient 7 Patient 8 Oxygen therapy Yes Yes Yes Yes Yes Yes Mechanical ventilation (invasive) Yes Yes Antibiotic treatment Yes Yes Yes Yes Yes Antiviral treatment Yes Yes Yes Yes Yes Yes Yes Yes Glucocorticoids Yes Yes Yes Yes Yes Intravenous immunoglobulin therapy Yes Yes Yes Yes Other treatments Traditional Chinese medicine Enterostomy, hemopurification, transfusions of red blood cell, plasma and thrombocyte Plasmapheresis Traditional Chinese medicine Traditional Chinese medicine Traditional Chinese medicine Clinical outcome Remained in ICU Remained in ICU Discharged Discharged Discharged Discharged Discharged Remained in ICU ICU intensive care unit

fulltextpubmed· Body· item PMC7091225

, hemopurification, transfusions of red blood cell, plasma and thrombocyte Plasmapheresis Traditional Chinese medicine Traditional Chinese medicine Traditional Chinese medicine Clinical outcome Remained in ICU Remained in ICU Discharged Discharged Discharged Discharged Discharged Remained in ICU ICU intensive care unit Discussion Since December, 2019, COVID-19 caused by SARS-CoV-2 infection has spread rapidly around China and the world [5, 10–12]. SARS-CoV-2 is a coronavirus that belongs to the β-coronavirus cluster, which can cause the third known zoonotic coronavirus disease after severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) [13]. It has been reported that SARS-CoV-2 uses the same cell entry receptor (ACE2) to infect humans, as SARS-CoV, but the clinical features of COVID-19 seem to be more variable [3]. The number of COVID-19 patients currently exceeds SARS and MERS; however, most patients are infected mildly, and the overall case-fatality rate (CFR) was 2.3% (1023 deaths among 44,672 confirmed patients) [14], much lower than that of SARS (10%) and MERS (37%) [3, 15, 16].

fulltextpubmed· Body· item PMC7091225

ures of COVID-19 seem to be more variable [3]. The number of COVID-19 patients currently exceeds SARS and MERS; however, most patients are infected mildly, and the overall case-fatality rate (CFR) was 2.3% (1023 deaths among 44,672 confirmed patients) [14], much lower than that of SARS (10%) and MERS (37%) [3, 15, 16]. In the early reports, all of the patients were adults (middle-aged and elderly) in Wuhan [5]. On entering the outbreak stage and improvement of pathogen detection, pediatric patients (even newborns) have been reported increasingly [17, 18]. According to the latest report from the Chinese Center for Disease Control and Prevention (CCDC), 965 confirmed patients under age 19 years (2.16%, 965/44,672) were reported nationwide [14]; no deaths have occurred in the group aged 9 years and younger, as of February 11. Children have special immune response system which is distinct from adults [19]; therefore, pediatric patients with COVID-19 have their own clinical features and therapeutic responses [20]. To our knowledge, this is the first report on pediatric patients with severe COVID-19.

fulltextpubmed· Body· item PMC7091225

ged 9 years and younger, as of February 11. Children have special immune response system which is distinct from adults [19]; therefore, pediatric patients with COVID-19 have their own clinical features and therapeutic responses [20]. To our knowledge, this is the first report on pediatric patients with severe COVID-19. The patients age ranged from 2 months to 15 years, and mostly were males (75%). Males seemed to be more susceptible to SARS-CoV-2 infection, which was similar to previous reports [5, 21–23]. Five patients (62.5%) were infected due to close contacts with family members confirmed with COVID-19; therefore, family daily prevention is an important way to prevent COVID-19. Disease duration is relative to the severity of the disease. Severely affected patients had a disease duration of over 10 days, but critically ill patients had a duration of over 20 days (two remained in ICU after over 20 days of treatment).

fulltextpubmed· Body· item PMC7091225

9; therefore, family daily prevention is an important way to prevent COVID-19. Disease duration is relative to the severity of the disease. Severely affected patients had a disease duration of over 10 days, but critically ill patients had a duration of over 20 days (two remained in ICU after over 20 days of treatment). In our cohort, the most common symptoms were polypnea (100%), fever (75%), cough (75%), expectoration (50%) and nausea/vomiting (50%). Fatigue/myalgia and headache, commonly described in adults, were rarely described in children. The reason may be that these symptoms are difficult to be described by young children. Half of our patients were infants or young children, who were unable to speak or speak clearly. So more data on clinical features of pediatric patients need to be studied. The ratio of patients with fever in this cohort of severe patients was lower than that of critically ill adult patients. Among the 52 critically ill adult patients reported by Yang et al. [22], common symptoms were fever (98%), cough (77%) and dyspnoea (63.5%). Nevertheless, the ratio of patients with fever in this series was higher than those children not treated in ICU. Among the 34 infected children (most are mild patients) reported by Wang et al. [24], fever (50%) and cough (38%) were the most common symptoms. According to our results, polypnea should be highlighted in severe pediatric patients, even without fever.

fulltextpubmed· Body· item PMC7091225

er in this series was higher than those children not treated in ICU. Among the 34 infected children (most are mild patients) reported by Wang et al. [24], fever (50%) and cough (38%) were the most common symptoms. According to our results, polypnea should be highlighted in severe pediatric patients, even without fever. Infected patients who develop acute respiratory distress syndrome (ARDS) may present with characteristic pulmonary ground-glass changes on imaging [4, 6, 12, 25]. The CT images of our patients mainly showed multiple patch-like shadows and ground glass opacity, consistent with previous reports. Chest X-rays of patient 1 who remains in ICU demonstrate decreased brightness of the lung and "white lung-like" changes. This patient is still under intensive treatment and close monitoring. Septic shock and MODS were common complications in critically ill patients. Multi-organ involvements were found in critically ill patients including the nervous, blood, urinary and cardiac systems. Complications were relatively mild in severe patients in our cohort, such as hypoglobulinemia and gastroenteritis.

fulltextpubmed· Body· item PMC7091225

Infected patients who develop acute respiratory distress syndrome (ARDS) may present with characteristic pulmonary ground-glass changes on imaging [4, 6, 12, 25]. The CT images of our patients mainly showed multiple patch-like shadows and ground glass opacity, consistent with previous reports. Chest X-rays of patient 1 who remains in ICU demonstrate decreased brightness of the lung and "white lung-like" changes. This patient is still under intensive treatment and close monitoring. Septic shock and MODS were common complications in critically ill patients. Multi-organ involvements were found in critically ill patients including the nervous, blood, urinary and cardiac systems. Complications were relatively mild in severe patients in our cohort, such as hypoglobulinemia and gastroenteritis. The treatment modalities of COVID-19 infection were mainly symptomatic and respiratory supporting. High-flow oxygen therapy, invasive ventilation and antiviral treatments (virazole, oseltamivir and interferon) were given to the patients. Antibiotic therapy, traditional Chinese medicine, intravenous glucocorticoid and immunoglobulin therapies were also used according to the patients’ conditions. Up to February 24, 2020, three patients remained in ICU (including two critically ill patients), the others recovered and were discharged without death. The overall case fatality rate of severe pediatric patients is far lower than those of adults (49.0%, 1023/2087) [14], which indicates a better clinical outcome in pediatric patients.

fulltextpubmed· Body· item PMC7091225

4, 2020, three patients remained in ICU (including two critically ill patients), the others recovered and were discharged without death. The overall case fatality rate of severe pediatric patients is far lower than those of adults (49.0%, 1023/2087) [14], which indicates a better clinical outcome in pediatric patients. Leucocytes, neutrophils, lymphocytes, thrombocyte and hemoglobin counts were normal or mildly increased in severe patients. Among critically ill patients, patient 1 with acute lymphocytic leukemia, undergoing blood transfusion, showed low level of neutrophils, lymphocytes and hemoglobin; patient 2 with serious complications (septic shock, DIC, MODS) showed high level of leucocytes and neutrophils and low level of thrombocyte and hemoglobin. Blood purification and transfusion were performed to improve symptoms. Elevated C-reactive protein, lactate dehydrogenase, procalcitonin, ALT and D-dimer were also discovered in the cohort. The level of creatine kinase was significantly high in patient 2, which required high attention.

fulltextpubmed· Body· item PMC7091225

el of thrombocyte and hemoglobin. Blood purification and transfusion were performed to improve symptoms. Elevated C-reactive protein, lactate dehydrogenase, procalcitonin, ALT and D-dimer were also discovered in the cohort. The level of creatine kinase was significantly high in patient 2, which required high attention. Coronaviruses of COVID-19, SARS and MERS can induce excessive and aberrant non-effective host immune responses that are associated with severe lung pathology. The lung injury is more pronounced in critically ill patients, associated with a cytokine storm, which is characterized by increased plasma concentrations of pro-inflammatory cytokines (IL-1β, IL-6, IL-12, TNF, IFN-γ) and anti-inflammatory cytokines (IL-4, IL-10, IL-13, TGF-β) [5, 6, 26–29]. In our cohort, decreased CD16 + CD56+ lymphocytes and increased IL-6, IL-10 and IFN-γ were observed. The levels of IL-6 and IL-10 were significantly increased in two critically ill patients, who remained in ICU with disease durations of over 20 days. More abnormalities in cytokine spectrum were seen in critically ill patients than in severe patients. Huang et al. [5] also found that COVID-19 patients in ICU had higher plasma levels of IL-2, IL-7, IL-10, GSCF, IP10, MCP1, MIP1A, and TNF-α, compared with non-ICU patients. Conversely, severe SARS patients had very low levels of IL-10 [30]. Different inflammatory responses were found between SARS and COVID-19, so more researches are needed. In addition, the level of CD4 increased, which indicating overactivation of the immune system leading to fatal immune disorders.

fulltextpubmed· Body· item PMC7091225

ith non-ICU patients. Conversely, severe SARS patients had very low levels of IL-10 [30]. Different inflammatory responses were found between SARS and COVID-19, so more researches are needed. In addition, the level of CD4 increased, which indicating overactivation of the immune system leading to fatal immune disorders. In conclusion, for severe or critically ill pediatric patients who survive intensive care, a number of specific laboratory abnormalities and aberrant and excessive immune responses may lead to long-term lung damage and severe health complications. Therefore, early identification of the specific features of severe pediatric patients and timely treatment are of crucial importance. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements We would like to thank the parents and children for participating in the study. We thank the doctors and nursing staff of Intensive Care Unit for their detailed assessments and dedicated care of these young patients. Author contributions DS and HL contributed equally to this paper. DS, HL, XXL, HX and JR collected and analyzed data and drafted the first manuscript. F-RZ and Z-SL designed the project and revised the manuscript. All authors have read and approved the final version of the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Ethics Committee of Wuhan Children’s Hospital. Informed consents for publication have been obtained from parents or guardians of patients.

fulltextpubmed· Body· item PMC7091225

Author contributions DS and HL contributed equally to this paper. DS, HL, XXL, HX and JR collected and analyzed data and drafted the first manuscript. F-RZ and Z-SL designed the project and revised the manuscript. All authors have read and approved the final version of the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Ethics Committee of Wuhan Children’s Hospital. Informed consents for publication have been obtained from parents or guardians of patients. Conflict of interest All the authors have no conflicts of interest.

fulltextpubmed· Body· item PMC7091265

The viral pneumonia in Wuhan City, China has spread around China. The virus has been proven to be a novel coronavirus (named as “2019-nCoV”) by World Health Organization (WHO). 2019-nCoV belongs to beta-coronavirus genera. On January 30, 2020, WHO re-evaluated the potential effects of 2019-nCoV infection in global public health, and declared this epidemic as a “Public Health Emergency of International Concern (PHEIC)”. Current epidemic status According to the updated information in National Health Commission of China, by January 30, 2020, a total of 9692 confirmed patients and 15,238 suspected patients have been reported around 31 provinces and cities in China. Among the confirmed patients, 1527 are severe patients, 171 have recovered and been discharged home, and 213 died. Twenty-eight pediatric patients have been reported [1]. Close contact with 2019-nCoV-infected patients is the main transmission route in children. Although the number of reported pediatric patients is limited, we should attach importance to prevention, diagnosis and treatment in children. People of all ages are susceptible to 2019-nCoV infection; children have special respiratory tract structure characteristics, immature immune system and susceptibility to respiratory virus infections. Considering these characteristics, and with further wide-use of pathogen tests, the number of pediatric patients will increase. Based on the collected data, infected children have relatively milder clinical symptomsthan infected adults; and no deaths have been reported in pediatric patients.

fulltextpubmed· Body· item PMC7091265

spiratory virus infections. Considering these characteristics, and with further wide-use of pathogen tests, the number of pediatric patients will increase. Based on the collected data, infected children have relatively milder clinical symptomsthan infected adults; and no deaths have been reported in pediatric patients. Clinical features of infected pediatric patients The age of onset ranged from 1 month to 17 years in the 28 confirmed pediatric patients. All were family clusters or with a close contact history. The clinical features are variable in pediatric patients. Several patients displayed no obvious clinical symptoms at diagnosis, and they were found by screening because of close contacts with confirmed patients; and further chest imaging suggested pneumonia. Several gradually presented with fever, fatigue, dry cough, accompanied by other upper respiratory symptoms including nasal congestion, runny nose, and seldom gastrointestinal symptoms such as nausea, vomiting and diarrhea. Laboratory examination in pediatric patients showed that blood routine was often normal, and C-reactive protein was normal or transiently elevated. Lung imaging examination revealed mild increase of lung markings or ground-glass opacity or pneumonia.

fulltextpubmed· Body· item PMC7091265

ldom gastrointestinal symptoms such as nausea, vomiting and diarrhea. Laboratory examination in pediatric patients showed that blood routine was often normal, and C-reactive protein was normal or transiently elevated. Lung imaging examination revealed mild increase of lung markings or ground-glass opacity or pneumonia. Most pediatric patients had mild symptoms, without fever or pneumonia. They had good prognosis and recovered within 1–2 weeks after disease onset. Only a few patients had lower respiratory tract infections. Although no severe cases or deaths have been reported in the pediatric population up to now, the potential risk of death should be highlighted. During severe acute respiratory syndrome (SARS) and the Middle East respiratory syndrome (MERS) epidemics, ARDS and death also occur in pediatric cases [2–4]. The current clinical features are defined only based on the 28 pediatric patients. Clinical features in pediatric patients will be further defined with increased number of confirmed patients. We should attach importance to differential diagnosis with other viral infections in pediatric patients. Winter and Spring are peak seasons of other viral infections such as influenza, respiratory syncytial virus. While screening 2019-nCoV, clinicians should also consider common viruses for differential diagnosis and identifying co-infections.

fulltextpubmed· Body· item PMC7091265

ce to differential diagnosis with other viral infections in pediatric patients. Winter and Spring are peak seasons of other viral infections such as influenza, respiratory syncytial virus. While screening 2019-nCoV, clinicians should also consider common viruses for differential diagnosis and identifying co-infections. Interferon for treatment of 2019-nCoV infection in children: efficacious or inefficacious? Interferon (IFN) is a group of low-molecular glycoproteins with similar structure and function, which is produced by host cells through antiviral response when the body is infected by virus. IFN is the first-line innate immune defense of the body against viral infection. Based on different gene and protein structures, IFN is divided into IFN-α, IFN-β, and so on. Interferon mainly plays antiviral effects through two ways: (1) inducing production of antiviral effector proteins, thereby inhibiting viral replication in the cells to protect normal cells from viral invasion; (2) activating cellular immunity by promoting proliferation and activation of cytotoxic T lymphocytes (CTL), activating natural killer (NK) cells and macrophages to clear the virus. The body’s endogenous IFN deficiency or insufficiency may lead to reduced antiviral activity. Children are susceptible to viral infections because of their immature immune function and relatively low levels of specific humoral and cellular immunity and IFN secretion.

fulltextpubmed· Body· item PMC7091265

iller (NK) cells and macrophages to clear the virus. The body’s endogenous IFN deficiency or insufficiency may lead to reduced antiviral activity. Children are susceptible to viral infections because of their immature immune function and relatively low levels of specific humoral and cellular immunity and IFN secretion. In 1973, Merigan et al. [5] from the British Medical Research Center firstly confirmed that IFN could prevent and treat respiratory virus infections. Thereafter, many researches have been carried out to approve the findings. Multi-center clinical studies in children from China [6–9] have also revealed that IFN-α atomization can reduce the viral load, alleviate symptoms and shorten disease duration in treating viral infections including bronchiolitis, viral pneumonia, acute upper respiratory tract infection and hand, foot and mouth disease. Our team also found that topical use of recombinant human IFN-α2b spray in the mouth and nose can alleviate symptoms and shorten disease course of upper respiratory tract infections in children [10].

fulltextpubmed· Body· item PMC7091265

ions including bronchiolitis, viral pneumonia, acute upper respiratory tract infection and hand, foot and mouth disease. Our team also found that topical use of recombinant human IFN-α2b spray in the mouth and nose can alleviate symptoms and shorten disease course of upper respiratory tract infections in children [10]. During the SARS outbreak in 2003, an animal study revealed that recombinant human IFN-α2b spray can prevent SARS-CoV infection in Rhesus monkey model by inhibiting virus infection and replication [11]. Further population study revealed that recombinant human IFN-α2b spray can effectively reduce the infection rate of respiratory syncytial virus, influenza virus, adenovirus and SARS-CoV [12, 13]. The Novel Coronavirus Infection Pneumonia Diagnosis and Treatment Standards (the fourth edition) and Diagnosis, treatment and prevention of 2019 novel coronavirus infection in children: experts’ consensus statement also listed IFN-α atomization as a choice of treatment for 2019-nCoV pneumonia [14]. In summary, the efficacy and safety of interferon in the treatment of children with 2019-nCoV need to be further confirmed.

fulltextpubmed· Body· item PMC7091265

During the SARS outbreak in 2003, an animal study revealed that recombinant human IFN-α2b spray can prevent SARS-CoV infection in Rhesus monkey model by inhibiting virus infection and replication [11]. Further population study revealed that recombinant human IFN-α2b spray can effectively reduce the infection rate of respiratory syncytial virus, influenza virus, adenovirus and SARS-CoV [12, 13]. The Novel Coronavirus Infection Pneumonia Diagnosis and Treatment Standards (the fourth edition) and Diagnosis, treatment and prevention of 2019 novel coronavirus infection in children: experts’ consensus statement also listed IFN-α atomization as a choice of treatment for 2019-nCoV pneumonia [14]. In summary, the efficacy and safety of interferon in the treatment of children with 2019-nCoV need to be further confirmed. Initiating studies on clinical features of 2019-nCoV-infected pediatric patients Current number of infected pediatric patients is low. However, for better understanding of 2019-nCoV infection in children and improving the level of diagnosis and treatment, National Respiratory Diseases Clinical Research Center and Respiratory Diseases Group of Chinese Pediatric Association initiated a study on clinical features of 2019-nCoV-infected pediatric patients. This study will be helpful for early recognition, early diagnosis and early treatment of infected children.

fulltextpubmed· Body· item PMC7091265

d treatment, National Respiratory Diseases Clinical Research Center and Respiratory Diseases Group of Chinese Pediatric Association initiated a study on clinical features of 2019-nCoV-infected pediatric patients. This study will be helpful for early recognition, early diagnosis and early treatment of infected children. The Chinese government is taking strong measures to mobilize the whole society to fight against the epidemic. We are fully confident to win the battle against the epidemic. Pediatricians in China will stay in line with the Chinese government make all-out efforts to prevent and control the epidemic and protect children’s lives and health. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions SKL and YYH drafted the manuscript and approved the final version. Funding None. Conpliance with ethical standards Ethical approval Not required for this editorial. Conflict of interest The authors declared no conflict of interest related to this article.

fulltextpubmed· Body· item PMC7091281

Introduction Since the outbreak of the coronovirus disease 2019 (COVID-19) in Wuhan City, China, a total of 82,488 confirmed cases have been reported globally as of February 27, 2020 [1]. Of these cases, 78,824 were from China and 3664 were from 46 other countries [1]. Among the confirmed cases, 2788 died in China and 57 died in other countries [1]. The novel coronavirus has been named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), whereas the disease associated with it is referred to as COVID-19 [2]. A series of recent published articles have reported the epidemiological and clinical characteristics of the hospitalized patients in Wuhan with COVID-19 [3–5]. Most patients reported in the literature were adults, and adult patients commonly presented as pneumonia with abnormal findings on chest CT [3–6]. Elderly men with comorbidities were more likely to exacerbate with severe and even fatal respiratory diseases such as acute respiratory distress syndrome (ARDS) [3–5]. The Chinese Center for Disease Control and Prevention reported 72,314 COVID-19 patients as of February 11, 2020. Among the 44,672 confirmed cases, 416 cases were aged 0–10 years [7]. However, literature reports on pediatric patients are limited [8, 9]. Herein, we report two children with confirmed COVID-19 from two family clusters. This paper will help pediatricians early recognize pedaitric cases with COVID-19.

fulltextpubmed· Body· item PMC7091281

ebruary 11, 2020. Among the 44,672 confirmed cases, 416 cases were aged 0–10 years [7]. However, literature reports on pediatric patients are limited [8, 9]. Herein, we report two children with confirmed COVID-19 from two family clusters. This paper will help pediatricians early recognize pedaitric cases with COVID-19. Methods We retrospectively reviewed two pediatric patients confirmed with COVID-19. Epidemiological features, physical examinations, laboratory studies and clinical outcome were described. We also collected data of their family members including clinical manifestations and laboratory examinations. Oropharyngeal swab tests were collected for detecting SARS-CoV-2, and chest CT examinations were done for the two pediatric patients and their family members. Results Case 1 A 15-year-old boy presented with a 1-day history of fever and was admitted to our hospital on January 25, 2020. He was previously healthy. History inquiry revealed that he had a travel history to Wuhan City (the epicenter of COVID-19 outbreak) with his parents one week ago. In Wuhan City, the boy’s entire family had dinner with several friends, and one of these friends was confirmed with COVID-19 three days later.

fulltextpubmed· Body· item PMC7091281

uary 25, 2020. He was previously healthy. History inquiry revealed that he had a travel history to Wuhan City (the epicenter of COVID-19 outbreak) with his parents one week ago. In Wuhan City, the boy’s entire family had dinner with several friends, and one of these friends was confirmed with COVID-19 three days later. Upon admission, his body temperature was 37.9 °C (100.2°F), and he only had pharyngeal congestion. Breath sounds of both lungs were normal at auscultation. Laboratory studies showed elevated white blood cell count (11.82 × 109/L; normal range, 4–10 × 109/L), with 67.3% neutrophils and 25.7% lymphocytes, and elevated C-reactive protein level (34.64 mg/L; normal range, 0–10 mg/L). The oropharyngeal swab tested positive for SARS-CoV-2. No other pathogens were found. Unenhanced chest CT results were normal (Fig. 1a).Fig. 1 a Unenhanced CT images of Case 1 showing normal results; b Unenhanced CT images of Case 1’s father showing bilateral pneumonia with ground-glass opacities especially in the left lung His family members displayed similar symptoms. His father had a low fever of 37.8 °C for one day, with no cough or other discomforts. His mother had a mild cough for one week without fever. His father's chest CT showed bilateral pneumonia with ground-glass opacities especially in the left lung (Fig. 1b), and his mother's chest CT was normal. They both tested positive for SARS-CoV-2. Symptomatic treatment was given to the patient, and symptoms disappeared after treatment for two days.

fulltextpubmed· Body· item PMC7091281

His family members displayed similar symptoms. His father had a low fever of 37.8 °C for one day, with no cough or other discomforts. His mother had a mild cough for one week without fever. His father's chest CT showed bilateral pneumonia with ground-glass opacities especially in the left lung (Fig. 1b), and his mother's chest CT was normal. They both tested positive for SARS-CoV-2. Symptomatic treatment was given to the patient, and symptoms disappeared after treatment for two days. Case 2 A 9-year-old boy was admitted to the hospital because of a history of mild diarrhea for two days on February 3, 2020. He was previously healthy. He did not experience fever or cough. History inquiry showed that he had traveled with his family to Xiaogan City, China (the subcenter of COVID-19 outbreak neighboring Wuhan City in Hubei Province) 10 days ago. Both the physical and laboratory examinations of the boy were unremarkable. White blood cell count was normal of 6.6 × 109/L, with 34.1% neutrophils and 52% lymphocytes. C-reactive protein was also normal (3.49 mg/L; normal range, 0–10 mg/L). Unenhanced chest CT results were normal (Fig. 2a). The oropharyngeal swab tested positive for SARS-CoV-2.Fig. 2 a Unenhanced CT images of Case 2 showing normal results; b Unenhanced CT images of Case 2’s mother of C showing multiple peripheral ground-glass opacities in bilateral lungs

fulltextpubmed· Body· item PMC7091281

49 mg/L; normal range, 0–10 mg/L). Unenhanced chest CT results were normal (Fig. 2a). The oropharyngeal swab tested positive for SARS-CoV-2.Fig. 2 a Unenhanced CT images of Case 2 showing normal results; b Unenhanced CT images of Case 2’s mother of C showing multiple peripheral ground-glass opacities in bilateral lungs His mother presented with fever and cough two days earlier than the boy. Although her oropharyngeal swab tests for SARS-CoV-2 were negative during two consecutive times, she was still suspected with COVID-19 because she had a travel history and multiple peripheral ground-glass opacities in both lungs on chest CT (Fig. 2b). The boy’s father had a mild cough for four days, and his two-year-old sister had a transient low fever for two days. Chest CT results of the father and sister were normal, and oropharyngeal swab tests were negative for SARS-CoV-2. Oral probiotic was given to the boy, and his symptoms disappeared after two days of treatment.

fulltextpubmed· Body· item PMC7091281

His mother presented with fever and cough two days earlier than the boy. Although her oropharyngeal swab tests for SARS-CoV-2 were negative during two consecutive times, she was still suspected with COVID-19 because she had a travel history and multiple peripheral ground-glass opacities in both lungs on chest CT (Fig. 2b). The boy’s father had a mild cough for four days, and his two-year-old sister had a transient low fever for two days. Chest CT results of the father and sister were normal, and oropharyngeal swab tests were negative for SARS-CoV-2. Oral probiotic was given to the boy, and his symptoms disappeared after two days of treatment. Discussion The two pediatric patients in this series were family cluster cases. Both families had a travel history to Hubei Province, the epicenter of this outbreak. The two patients had different clinical presentations; however, both tested positive for SARS-CoV-2. Case 1 presented as an upper respiratory tract infection, and Case 2 presented with mild diarrhea only. Compared with their parents and to previous reported adults with COVID-19, the two cases in our study showed relatively mild clinical manifestations and recovered soon. Their chest CTs were normal. The clinical features in these two patients are different from previous reports in pediatric cases. A report of a family cluster demonstrated an asymptomatic child (aged 10 years) had radiological ground-glass lung opacities and positive SARS-CoV-2 test [8]. And another report demonstrated an infected case with very severe pneumonia [9]. These reports showed that children infected with SARS-CoV-2 may have variable symptoms, which may be partly related to the previous health status and interval from onset to consultation and comorbidities. Experts recently have formulated a recommendation for the diagnosis and treatment of COVID-19 in children, which is of paramount important for clinical practice [10, 11]. Owing to the limited number of pediatric cases and experiences, these recommendations or guidelines were based mainly on standards and experiences with adult patients [10]. Additional data from pediatric cases need to be collected to further recognize the clinical features of COVID-19 in children.

fulltextpubmed· Body· item PMC7091281

al practice [10, 11]. Owing to the limited number of pediatric cases and experiences, these recommendations or guidelines were based mainly on standards and experiences with adult patients [10]. Additional data from pediatric cases need to be collected to further recognize the clinical features of COVID-19 in children. In conclusion, pediatric patients with COVID-19 are mostly from family cluster with clear travel histories to Hubei Province, the epicenter of the outbreak. Close contact in the family is the main transmission way of infection in children. Pediatric patients may present as asymptomatic or only with mild symptoms of respiratory or gastrointestinal system with normal chest CT images, and thus easily be missed. Our study highlights the importance that pediatricians be vigilant in treating patients with a travel history to areas of the epidemic, or with family cluster, to ensure an early diagnosis, early quarantine and early treatment. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions LNJ and SC are the principle investigators of this manuscript. LNJ drafted the manuscript. YJW and XJL conducted the data collection. XDM, MGL and RMJ analyzed the data. All authors have approved submission of the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Institution Review Board (IRB) of Beijing Tsinghua Changgung Hospital. Written consents were obtained from the parents of the patients for publication.

fulltextpubmed· Body· item PMC7091281

Author contributions LNJ and SC are the principle investigators of this manuscript. LNJ drafted the manuscript. YJW and XJL conducted the data collection. XDM, MGL and RMJ analyzed the data. All authors have approved submission of the manuscript. Funding None. Compliance with ethical standards Ethical approval This study was approved by the Institution Review Board (IRB) of Beijing Tsinghua Changgung Hospital. Written consents were obtained from the parents of the patients for publication. Conflict of interest No financial benefits have been received or will be received from any party related directly or indirectly to the subject of this article.

fulltextpubmed· Body· item PMC7091469

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 SP Children’s Hospital, Zhejiang University School of Medicine Heidelberg 20143214 9 10.1007/s12519-010-0009-2 Original Article Human bocavirus in children with respiratory tract infection in Shanghai: a retrospective study Zeng Mei +86-21-64931133zengmeigao@yahoo.com.cn 12 Zhu Qi-Rong 1 Wang Xiao-Hong 1 Yu Hui 1 Shen Jun 1 1 grid.411333.70000000404072968Department of Infectious Diseases, Children’s Hospital of Fudan University, Shanghai, 201102 China 2 grid.411333.70000000404072968Department of Infectious Diseases, Children’s Hospital of Fudan University, 399 Wanyuan Road, Shanghai, 201102 China 9 2 2010 2010 6 1 65 70 23 12 2008 9 3 2009 © Children's Hospital, Zhejiang University School of Medicine and Springer Berlin Heidelberg 2010This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Human bocavirus (HBoV) was first reported in 2005. The worldwide presence of HBoV in children with acute respiratory tract infection (ARTI) has been confirmed. This study aimed to understand the prevalence and clinical features of HBoV in children with ARTI in Shanghai and explore the causative implication of HBoV in ARTI.

fulltextpubmed· Body· item PMC7091469

n bocavirus (HBoV) was first reported in 2005. The worldwide presence of HBoV in children with acute respiratory tract infection (ARTI) has been confirmed. This study aimed to understand the prevalence and clinical features of HBoV in children with ARTI in Shanghai and explore the causative implication of HBoV in ARTI. Methods We retrospectively reviewed the medical records of 349 hospitalized children with ARTI between November 2006 and January 2007. From these children, 351 nasopharyngeal aspirate samples were collected; 325 of the samples were obtained from those with community-acquired ARTI and 26 from those with hospital-acquired ARTI. All samples were routinely screened for seven common respiratory viruses by immunofluorescence and further tested for HBoV by polymerase chain reaction.

fulltextpubmed· Body· item PMC7091469

nasopharyngeal aspirate samples were collected; 325 of the samples were obtained from those with community-acquired ARTI and 26 from those with hospital-acquired ARTI. All samples were routinely screened for seven common respiratory viruses by immunofluorescence and further tested for HBoV by polymerase chain reaction. Results HBoV was detected in 16 (4.6%) of the 351 samples, and it was the second most commonly detected virus after respiratory syncytial virus. Three (19%) HBoV-positive samples were dual infection with respiratory syncytial virus or parainfluenza virus type 3. Of the 325 children with community-acquired ARTI, HBoV was identified to be positive in 11 (3.4%), of whom 6 were diagnosed with pneumonia with patchy or interstitial infiltrates in the lung indicated by chest radiography, 3 with bronchitis, and 2 with bronchial asthma exacerbation with attendant lung infection. Out of the 26 children with nosocomial ARTI, 5 (19.2%) had bronchitis which was found to be HBoV positive without co-detection of other viruses. The HBoV-positive children were aged 1.7 months to 43 months and their mean age was 13.7 months. Sixteen (100%) children had cough, 11 (68.8%) had wheezing, and 10 (62.5%) had fever. Conclusions HBoV was circulating in Shanghai during the study period, and which was detected frequently in children with ARTI. HBoV was found to be associated with community-acquired ARTI and may play a pathogenic role in nosocomial ARTI.

fulltextpubmed· Body· item PMC7091469

Results HBoV was detected in 16 (4.6%) of the 351 samples, and it was the second most commonly detected virus after respiratory syncytial virus. Three (19%) HBoV-positive samples were dual infection with respiratory syncytial virus or parainfluenza virus type 3. Of the 325 children with community-acquired ARTI, HBoV was identified to be positive in 11 (3.4%), of whom 6 were diagnosed with pneumonia with patchy or interstitial infiltrates in the lung indicated by chest radiography, 3 with bronchitis, and 2 with bronchial asthma exacerbation with attendant lung infection. Out of the 26 children with nosocomial ARTI, 5 (19.2%) had bronchitis which was found to be HBoV positive without co-detection of other viruses. The HBoV-positive children were aged 1.7 months to 43 months and their mean age was 13.7 months. Sixteen (100%) children had cough, 11 (68.8%) had wheezing, and 10 (62.5%) had fever. Conclusions HBoV was circulating in Shanghai during the study period, and which was detected frequently in children with ARTI. HBoV was found to be associated with community-acquired ARTI and may play a pathogenic role in nosocomial ARTI. Key words acute respiratory tract infectionchildrencommunity-acquired infectionhospital-acquired infectionhuman bocavirusissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer Berlin Heidelberg 2010

fulltextpubmed· Body· item PMC7100427

An epidemic of coronavirus disease 2019 (COVID-19) has spread rapidly throughout China and the world since 2019.As of March 3rd 2020, China had reported a total of 80,304 cases of COVID-19, including 2,946 deaths. Outside China, there are now 10,566 cases in 72 countries and 166 deaths. Of the deaths reported so far, most of them have been elderly men [1–4]. Adults are more likely to be infected with novel coronavirus (SARS-CoV-2) than children; and symptoms are relatively milder in pediatric patients than in adult patients. The same conditions occurred during the SARS and MERS outbreaks. It is still not clear why children seem to be escaping the worst effects of the coronavirus infection [5–7]. Unlike adults, who can actively protect themselves, children are less likely to protect themselves by avoiding touching things or covering their faces when they cough or sneeze [8]. If children with underlying health conditions (such as leukemia, tumor or other immune deficiencies) are infected with COVID-19, the severity of conditions and difficulty of treatments may be unpredictable [9]. In addition, whether the virus will exist for a long time remains to be verified. If SARS-CoV-2 acts like many other viruses (that is, remains long-lived relative to the lifespan of humans), antiviral treatments will face a great challenge, especially in pediatric patients.

fulltextpubmed· Body· item PMC7100427

culty of treatments may be unpredictable [9]. In addition, whether the virus will exist for a long time remains to be verified. If SARS-CoV-2 acts like many other viruses (that is, remains long-lived relative to the lifespan of humans), antiviral treatments will face a great challenge, especially in pediatric patients. The treatment guidelines are very cautious about recommending antiviral drugs for children. Almost all guidelines highlight that there are no effective antiviral drugs for children at present. The Interim Guidance for Diagnosis and Treatment of COVID-19 infection (the Sixth version) issued by the National Health Commission of China is only available for adults in the field of antiviral treatments. The recommended antiviral drugs are interferon-α (IFN-α), lopinavir/ritonavir, ribavirin, chloroquine diphosphate and arbidol [2] which have been used in the treatment of COVID-19 in adults. Based on the available evidences, IFN-α nebulization can be used in children, and it has shown good safety profiles under most circumstances. However, children are particularly sensitive to the accumulation of chloroquine phosphate in the body, which could possibly induce severe retinopathy, ototoxicity and cardiotoxicity. On the other hand, it lacks data on the safety of using lopinavir/ritonavir and abidor for children under 2 years of age. In the absence of adequate evidence for efficacy and safety, experts have not reached on an agreement on using ribavirin in the pediatric population. Guidelines for diagnosis and treatment of COVID-19 in children (Second Edition) recommend the use of IFN-α, lopinavir/ritonavir and ribavirin in children, without specifying age limitation [10]. The recommended dosage of ribavirin infusion varies in different medical literatures. Some suggest intravenous infusion of ribavirin administered at a dose of 10 mg/kg every time (maximum 500 mg every time), 2–3 times daily [10], whereas others recommend 10–15 mg/kg per day, divided into 2–3 times daily [11].

fulltextpubmed· Body· item PMC7100427

ion [10]. The recommended dosage of ribavirin infusion varies in different medical literatures. Some suggest intravenous infusion of ribavirin administered at a dose of 10 mg/kg every time (maximum 500 mg every time), 2–3 times daily [10], whereas others recommend 10–15 mg/kg per day, divided into 2–3 times daily [11]. At present, the efficacy and safety, appropriate dosage, course of treatment and mechanism of action for children's anti-coronavirus drugs need to be studied, and that special attention should be paid to the particular adverse reactions and drug interactions in children [10–13]. Based on the current epidemiological survey, the ages of the confirmed COVID-19 cases in children range from days to 17 years old. These children may have no clinical manifestations, such as fever, fatigue, dry cough, abdominal discomfort, nausea, vomiting, abdominal pain, diarrhea and other gastrointestinal symptoms, etc. A case of a 1.5-month-old infant diagnosed with COVID-19 experienced frequent vomiting [1, 2, 4, 14–18]. The clinical characteristics of COVID-19 in children are different from those in adults, and it is likely that differences also exist between children at different ages.

fulltextpubmed· Body· item PMC7100427

hea and other gastrointestinal symptoms, etc. A case of a 1.5-month-old infant diagnosed with COVID-19 experienced frequent vomiting [1, 2, 4, 14–18]. The clinical characteristics of COVID-19 in children are different from those in adults, and it is likely that differences also exist between children at different ages. It is unknown whether the disease process, treatment response and exposure response relationship of children with COVID-19 are like those of adults. According to the guidelines for clinical trials of pediatric drugs, it is not suitable to perform extrapolation on drug efficacy from adults to children. And children are not little adults. So comprehensive and systematic drug safety and efficacy clinical trials in pediatric population should be planned and conducted as early as possible once the clinical trial data of preliminary safety and potential benefits for adults have been acquired [19].

fulltextpubmed· Body· item PMC7100427

from adults to children. And children are not little adults. So comprehensive and systematic drug safety and efficacy clinical trials in pediatric population should be planned and conducted as early as possible once the clinical trial data of preliminary safety and potential benefits for adults have been acquired [19]. At present, more than 200 clinical trials for COVID-19 treatment have been carried out in medical institutions all over China. The drugs and the therapies include anti-AIDS drugs, influenza medications, glucocorticoid, traditional Chinese medicines/injections, stem cell transplantation, etc. However, drug clinical trials for COVID-19 children are very limited. As of February 28, 2020, one registered drug clinical trial of traditional Chinese medicine for the prevention of COVID-19 infection in children was found in the China Clinical Trial Registry Center; another clinical trial of darunavir and cobicistat for treatment of COVID-19 in children has been registered in ClinicalTrials.gov. The designs of the two clinical trials are not so scientific with unclear age range defined in the inclusion criteria. Although the proportion of infected children in the pediatric population to the whole population is relatively low, children are still at high risk of infection and should not be neglected. We should take precautions beforehand to carry out the clinical trials of pediatric drugs for the treatment of COVID-19.

fulltextpubmed· Body· item PMC7100427

At present, more than 200 clinical trials for COVID-19 treatment have been carried out in medical institutions all over China. The drugs and the therapies include anti-AIDS drugs, influenza medications, glucocorticoid, traditional Chinese medicines/injections, stem cell transplantation, etc. However, drug clinical trials for COVID-19 children are very limited. As of February 28, 2020, one registered drug clinical trial of traditional Chinese medicine for the prevention of COVID-19 infection in children was found in the China Clinical Trial Registry Center; another clinical trial of darunavir and cobicistat for treatment of COVID-19 in children has been registered in ClinicalTrials.gov. The designs of the two clinical trials are not so scientific with unclear age range defined in the inclusion criteria. Although the proportion of infected children in the pediatric population to the whole population is relatively low, children are still at high risk of infection and should not be neglected. We should take precautions beforehand to carry out the clinical trials of pediatric drugs for the treatment of COVID-19. It should be emphasized that the ethical principles of pediatric clinical research must be followed before conducting pediatric clinical trials. Experimental drugs should be selected first from the drugs that have already been on the market and have been used in children. All clinical trials designed for pediatric population should follow the principle of "minimum sample size, and minimum pain" as much as possible [20, 21].

fulltextpubmed· Body· item PMC7100427

conducting pediatric clinical trials. Experimental drugs should be selected first from the drugs that have already been on the market and have been used in children. All clinical trials designed for pediatric population should follow the principle of "minimum sample size, and minimum pain" as much as possible [20, 21]. In conclusion, SARS-CoV-2 infected "COVID-19" is a new and pandemic disease. There are differences in clinical manifestations between children and adults. It is very necessary for the government, industries and institutes to prepare well in the early stage and to conduct clinical trials to evaluate the safety and efficacy of pediatric medications on the infected children. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Author contributions All authors contributed to the initial discussion. NSQ wrote the first draft; FQB, SXY and SQ contributed papers and guidance to initial submission. After review and request for more information, SQ updated the document; all authors made final recommendations and edits.All authors approved the final version of the manuscript. Funding No funding was secured for this study. Compliance with ethical standards Ethical approval Not required for this paper. Conflict of interest The authors have no conflicts of interest to disclose.

fulltextpubmed· Body· item PMC7101527

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 SP Children’s Hospital, Zhejiang University School of Medicine Heidelberg 22886197 364 10.1007/s12519-012-0364-2 Original Article Findings in children severely infected with a novel influenza A virus of swine origin: pulmonary imaging Xu Wei Liu Chun-Feng +8602423692117+8602483955509xuw@sj-hospital.org Zhao Ying Li Jiu-Jun Wang Li-Jie Wen Guang-Fu Liu Zhe grid.412467.2Department of Pediatrics, Shengjing Hospital of China Medical University, No. 36 Sanhao Street, Heping District, Shenyang, 110004 Liaoning, China 12 8 2012 2012 8 3 240 246 18 7 2011 22 12 2011 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2012This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background This article reviews the chest radiography of children with severe infection caused by a novel influenza A (H1N1) virus of swine origin (S-OIV). We analyzed the role of their pulmonary images in predicting the severity and diagnosis of the disease.

fulltextpubmed· Body· item PMC7101527

anization (WHO) declaration of COVID-19 as a global pandemic.Background This article reviews the chest radiography of children with severe infection caused by a novel influenza A (H1N1) virus of swine origin (S-OIV). We analyzed the role of their pulmonary images in predicting the severity and diagnosis of the disease. Methods Among 97 patients with confirmed novel H1N1 infection, 42 patients treated with mechanical ventilation formed group 1, and the remaining 55 patients constituted group 2. The initial and subsequent radiograhic findings in groups 1 and 2 were compared with respect to the pattern, distribution, and extent of the abnormality. Results In group 1, 24 patients presented with three or more lung zone diseases, whereas only 5 patients in group 2 demonstrated these findings (P<0.001). A pneumomediastinum or pneumothorax was observed in 24/42 patients in group 1 and in 18/55 patients in group 2 (P=0.019). Twelve patients in group 1 and 5 in group 2 developed a ground-glass opacity cyst with a honeycomb appearance (P=0.007). Conclusions The most common radiographic and computed tomography findings in children who were severely infected with S-OIV included unilateral or bilateral ground-glass opacities with or without associated focal or multifocal areas of consolidation. Children with bilateral involvement or with greater opacity on the chest radiographs were more likely to worsen and require the mechanical ventilation.

fulltextpubmed· Body· item PMC7101527

ren who were severely infected with S-OIV included unilateral or bilateral ground-glass opacities with or without associated focal or multifocal areas of consolidation. Children with bilateral involvement or with greater opacity on the chest radiographs were more likely to worsen and require the mechanical ventilation. Key words chest radiographychildrenH1N1infectious diseasespneumoniaissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2012

fulltextpubmed· Body· item PMC7102092

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 Springer-Verlag Berlin/Heidelberg 18661762 18 10.1007/s12519-008-0018-6 Original Article Macrophage activation syndrome in 13 children with systemic-onset juvenile idiopathic arthritis Zeng Hua-Song huasongz@gmail.com 1 Xiong Xiao-Yan 1 Wei Yan-Dan 1 Wang Hong-Wei 2 Luo Xiao-Ping 2 1 grid.413428.80000000417578466Department of Allergy, Immunology and Rheumatology, Guangzhou Children’s Hospital, Guangzhou, 510120 China 2 grid.33199.310000000403687223Pediatric Department, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430030 China 16 7 2008 2008 4 2 97 101 30 8 2007 21 2 2008 © Springer 2008This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Macrophage activation syndrome (MAS) is a severe, potentially life-threatening condition induced by chronic rheumatic diseases, especially systemic-onset juvenile idiopathic arthritis (SoJIA) in childhood. This study aimed to analyze the clinical and laboratory characteristics of systemic-onset juvenile idiopathic arthritis (SoJIA) with macrophage activation syndrome (MAS) in 13 patients. Methods Clinical and laboratory data of 13 SoJIA patients with MAS treated in our hospital from January 2003 to October 2007 were analyzed.

fulltextpubmed· Body· item PMC7102092

18661762 18 10.1007/s12519-008-0018-6 Original Article Macrophage activation syndrome in 13 children with systemic-onset juvenile idiopathic arthritis Zeng Hua-Song huasongz@gmail.com 1 Xiong Xiao-Yan 1 Wei Yan-Dan 1 Wang Hong-Wei 2 Luo Xiao-Ping 2 1 grid.413428.80000000417578466Department of Allergy, Immunology and Rheumatology, Guangzhou Children’s Hospital, Guangzhou, 510120 China 2 grid.33199.310000000403687223Pediatric Department, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430030 China 16 7 2008 2008 4 2 97 101 30 8 2007 21 2 2008 © Springer 2008This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background Macrophage activation syndrome (MAS) is a severe, potentially life-threatening condition induced by chronic rheumatic diseases, especially systemic-onset juvenile idiopathic arthritis (SoJIA) in childhood. This study aimed to analyze the clinical and laboratory characteristics of systemic-onset juvenile idiopathic arthritis (SoJIA) with macrophage activation syndrome (MAS) in 13 patients. Methods Clinical and laboratory data of 13 SoJIA patients with MAS treated in our hospital from January 2003 to October 2007 were analyzed. Results In the 13 patients, 9 were boys and 4 girls aged from 5 months to 12 years. Clinical manifestations were of no typical characteristics including persistent fever, anemia, arthritis, hepatosplenomegaly, lymph-adenopathy, dysfunction of the liver, abnormal fat metabolism, and hemophagocytic cells in the bone marrow. Two patients experienced acute respiratory distress syndrome, two had mutiorgan failure, and three died. The perforin A91V (NCBI:SNP rs35947132) gene in 6 patients was normal. Glucocorticoid and immunoimpressive therapy were effective in all patients and plasmapheresis used in one severe patient was also effective.

fulltextpubmed· Body· item PMC7102092

ow. Two patients experienced acute respiratory distress syndrome, two had mutiorgan failure, and three died. The perforin A91V (NCBI:SNP rs35947132) gene in 6 patients was normal. Glucocorticoid and immunoimpressive therapy were effective in all patients and plasmapheresis used in one severe patient was also effective. Conclusions MAS is a serious complication of JIA, especially systemic-onset juvenile idiopathic arthritis. It is essentially important to recognize and treat MAS earlier in order to lower the mortality. Key words juvenile idiopathic arthritismacrophage activation syndromeissue-copyright-statement© Springer 2008

fulltextpubmed· Body· item PMC7102189

World J Pediatr World J Pediatr World Journal of Pediatrics 1708-8569 1867-0687 SP Children’s Hospital, Zhejiang University School of Medicine Heidelberg 23151859 376 10.1007/s12519-012-0376-y Original Article Clinical and epidemiological characteristics of 2009 pandemic influenza A in hospitalized pediatric patients of the Saurashtra region, India Chudasama Rajesh K. +91 94284 52080+91 281 2455810dranakonda@yahoo.comdranakonda@gmail.com 13 Patel Umed V. 2 Verma Pramod B. 2 Agarwal Prerna 2 Bhalodiya Shital 2 Dholakiya Devangi 2 1 grid.416198.3Department of Community Medicine, M P Shah Medical College, Jamnagar, Gujarat India 2 Department of Community Medicine, P D U Medical College, Rajkot, Gujarat, India 3 Vandana Embroidary, Mato Shree Complex, Sardar Nagar Main Road, Rajkot, 360 001 Gujarat India 15 11 2012 2012 8 4 321 327 6 7 2011 28 9 2011 © Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2012This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Background The first case of 2009 pandemic influenza A or H1N1 virus infection in India was reported in May 2009 and in the Saurashtra region in August 2009. We describe the two waves clinicoepidemiological characteristics of children who were hospitalized with 2009 influenza A infection in the Saurashtra region.

fulltextpubmed· Body· item PMC7102189

demic.Background The first case of 2009 pandemic influenza A or H1N1 virus infection in India was reported in May 2009 and in the Saurashtra region in August 2009. We describe the two waves clinicoepidemiological characteristics of children who were hospitalized with 2009 influenza A infection in the Saurashtra region. Methods From September 2009 to February 2011, we treated 117 children infected with 2009 influenza A virus who were admitted in different hospitals in Rajkot city. Real-time reverse transcriptase polymerase chain reaction (RT-PCR) test was used to confirm infection, and the clinico-epidemiological features of the disease were closely monitored. Results In the 117 patients, with a median age of 2 years, 59.8% were male. The median time from onset of the disease to influenza A diagnosis was 5 days, and that from onset of the disease to hospitalization was 7 days. The admitted patients took oseltamivir, but only 11.1% of them took it within 2 days after onset of the disease. More than one fourth (29.1%) of the admitted patients died. The most common symptoms of the patients were cough (98.3%), fever (94.0%), sore throat and shortness of breathing. Pneumonia was detected by chest radiography in 80.2% of the patients. Conclusions In children with infection-related illness, the survival rate was about 71% after oseltamivir treatment. The median time for virus detection with real-time RT-PCR is 5 days. Early diagnosis and treatment may reduce the severity of the disease.

fulltextpubmed· Body· item PMC7102189

Results In the 117 patients, with a median age of 2 years, 59.8% were male. The median time from onset of the disease to influenza A diagnosis was 5 days, and that from onset of the disease to hospitalization was 7 days. The admitted patients took oseltamivir, but only 11.1% of them took it within 2 days after onset of the disease. More than one fourth (29.1%) of the admitted patients died. The most common symptoms of the patients were cough (98.3%), fever (94.0%), sore throat and shortness of breathing. Pneumonia was detected by chest radiography in 80.2% of the patients. Conclusions In children with infection-related illness, the survival rate was about 71% after oseltamivir treatment. The median time for virus detection with real-time RT-PCR is 5 days. Early diagnosis and treatment may reduce the severity of the disease. Key words antiviral drugclinical featuresepidemiologyinfluenza Aintensive careissue-copyright-statement© Children's Hospital, Zhejiang University School of Medicine and Springer-Verlag Berlin Heidelberg 2012