Browse the corpus

The evidence for the efficacy of behavioral support and several medications for smoking cessation is provided by multiple randomized controlled trials.1-7 It is important to supplement the evidence from these experimental studies with evidence from observational studies in the “real world.” In a previous study, we used cross-sectional data from an English population survey to assess the effectiveness of medication for smoking cessation combined with behavioral support in comparison with unaided quitting.8 A key issue when using nonrandomized observational data is to account for potential confounding by indication; that is, smokers who use one method of quitting may differ from smokers using another method of quitting in terms of prognostic factors. The most important confounder in this regard is cigarette dependence.

.8 A key issue when using nonrandomized observational data is to account for potential confounding by indication; that is, smokers who use one method of quitting may differ from smokers using another method of quitting in terms of prognostic factors. The most important confounder in this regard is cigarette dependence. In our earlier study,8 we used a validated measure9 involving ratings of current urges to smoke assessed at the time of the survey to adjust for potential confounding. In smokers who were abstinent at the time of the survey, these measures were assumed to serve as a valid proxy for urges to smoke at the time of the quit attempt. This assumption holds only when different methods of stopping are not differentially linked to lower or higher levels of urges in abstinent smokers. We indeed found that urges to smoke in smokers vs quitters did not differ as a function of method.8 Still, smokers who used medication and behavioral support reported higher levels of urges to smoke than did smokers who tried to quit unaided. After adjusting for this confounder, we found that smokers who use a combination of specialist behavioral support and medication in their quit attempts had almost 3 times the odds of success than did those who used neither medication nor behavioral support. We also found that smokers who bought nicotine replacement therapy (NRT) over the counter with no behavioral support had similar odds of success at stopping as did those who stop without any aid.

heir quit attempts had almost 3 times the odds of success than did those who used neither medication nor behavioral support. We also found that smokers who bought nicotine replacement therapy (NRT) over the counter with no behavioral support had similar odds of success at stopping as did those who stop without any aid. It is important to confirm these findings with longitudinal data that are used to measure urges to smoke in current smokers at baseline, before their quit attempt. We conducted a prospective cohort study using data from the Smoking Toolkit Study to achieve this. Patients and Methods The Smoking Toolkit Study is an ongoing research program designed to provide information about smoking cessation and factors that promote or inhibit it at a population level.10,11 Each month a new sample of approximately 1800 people 16 years and older completes a face-to-face computer-assisted survey, of whom approximately 450 (25%) are smokers. The general methodology has been described in full elsewhere and has been reported to result in figures for key variables such as smoking prevalence that are nationally representative.10 The specific methodology used for the present study and described herein was largely based on our previous study and has been described in a different article as well.8

scribed in full elsewhere and has been reported to result in figures for key variables such as smoking prevalence that are nationally representative.10 The specific methodology used for the present study and described herein was largely based on our previous study and has been described in a different article as well.8 Study Population For the present study, we used aggregated data from respondents to the baseline survey in the period from November 2006 (the start of the survey) to March 2012 (the latest wave of the survey for which 6-month follow-up data were available), who smoked cigarettes (including hand-rolled) or any other combustible tobacco product (eg, pipe or cigar) daily or occasionally at the time of the survey. These respondents were asked whether they were willing to be recontacted. A follow-up questionnaire was sent to consenting respondents 6 months after baseline. Participants were given £5 ($8) remuneration, and 1 reminder letter was sent. Of the 27,219 smokers at baseline, 5757 (21.2%) were followed up 6 months later. The sample followed up differed from those not followed up by being more likely to be female, older, less motivated to stop smoking, and reporting higher strengths of urges to smoke at baseline. The differences were small but statistically significant (P<.05).

at baseline, 5757 (21.2%) were followed up 6 months later. The sample followed up differed from those not followed up by being more likely to be female, older, less motivated to stop smoking, and reporting higher strengths of urges to smoke at baseline. The differences were small but statistically significant (P<.05). Respondents to the 6-month follow-up were asked “Have you made a serious attempt to stop smoking in the past 12 months? By serious attempt I mean you decided that you would try to make sure you never smoked another cigarette? Please include any attempt that you are currently making.” Those respondents who answered “Yes” were then asked “How long ago did your quit attempt start?” The response options to this question were as follows: “In the last week”; “More than a week and up to a month”; “More than 1 month and up to 2 months”; “More than 2 months and up to 3 months”; “More than 3 months and up to 6 months”; “More than 6 months and up to a year”; “Can’t remember.” We included only those respondents who made at least 1 quit attempt about 6 months ago.

the last week”; “More than a week and up to a month”; “More than 1 month and up to 2 months”; “More than 2 months and up to 3 months”; “More than 3 months and up to 6 months”; “More than 6 months and up to a year”; “Can’t remember.” We included only those respondents who made at least 1 quit attempt about 6 months ago. Measurement of Effect: Use of Smoking Cessation Treatments The use of smoking cessation treatments was assessed only for the most recent quit attempt and included the following: (1) NRT on prescription, bupropion, or varenicline in combination with specialist behavioral support (ie, one-to-one or group behavioral support delivered by a National Health Service [NHS] Stop Smoking Service); (2) NRT on prescription, bupropion, or varenicline in combination with brief advice (delivered by the prescribing health care professional); (3) NRT bought over the counter without any behavioral support; (4) none of these. The behavioral support delivered by an NHS Stop Smoking Service generally involves at least 6 sessions with the client (before the quit date, on the quit date itself, and 4 weekly follow-up sessions), with a total potential contact time of at least 1.5 hours.12

counter without any behavioral support; (4) none of these. The behavioral support delivered by an NHS Stop Smoking Service generally involves at least 6 sessions with the client (before the quit date, on the quit date itself, and 4 weekly follow-up sessions), with a total potential contact time of at least 1.5 hours.12 Measurement of Outcome: Self-Reported Nonsmoking Our primary outcome was self-reported nonsmoking up to the time of the 6-month follow-up measurement. Respondents were asked “How long did your most recent serious quit attempt last before you went back to smoking?” Those responding “I am still not smoking” were defined as nonsmokers. Previous research has found that self-reported abstinence in surveys of this kind is not subject to the kind of biases observed in clinical trials in which there is social pressure to claim abstinence.13,14

empt last before you went back to smoking?” Those responding “I am still not smoking” were defined as nonsmokers. Previous research has found that self-reported abstinence in surveys of this kind is not subject to the kind of biases observed in clinical trials in which there is social pressure to claim abstinence.13,14 Measurement of Potential Confounders We measured variables potentially associated with the use of smoking cessation treatments and that may also have an effect on the outcome. These potential confounders were chosen a priori. The most important factor was cigarette dependence for which we used 2 questions assessed at baseline. First, time spent with urges to smoke was assessed by asking “How much of the time have you felt the urge to smoke in the past 24 hours? Not at all (coded 1), a little of the time (2), some of the time (3), a lot of the time (4), almost all of the time (5), all of the time (6).” Second, strength of urges to smoke was assessed by asking “In general, how strong have the urges to smoke been?: slight (1), moderate (2), strong (3), very strong (4), extremely strong (5).” This question was coded “0” for smokers who responded “Not at all” to the previous question. These 2 ratings have been found in this population to be a better measure of dependence (more closely associated with relapse after a quit attempt) than other measures.9 Demographic characteristics we took into account were age, sex, and social grade (measured on an ordinal scale: AB = managerial and professional occupations; C1 = intermediate occupations; C2 = small employers and own account workers; D = lower supervisory and technical occupations; and E = semi-routine and routine occupations, never workers, and long-term unemployed). With regard to the most recent quit attempt measured at 6-month follow-up, we asked the time since this quit attempt was initiated, the number of quit attempts before this attempt that occurred since baseline, and whether respondents cut down first or stopped abruptly without cutting down.

s, and long-term unemployed). With regard to the most recent quit attempt measured at 6-month follow-up, we asked the time since this quit attempt was initiated, the number of quit attempts before this attempt that occurred since baseline, and whether respondents cut down first or stopped abruptly without cutting down. Data Analyses Simple associations between potential confounders and use of the smoking cessation treatments were assessed by using analysis of variance for continuous variables and Pearson’s χ2 test for categorical variables. The Games-Howell procedure was used for post hoc multiple comparisons of the continuous variables between pairs of treatment groups. For our primary analysis, we used a multiple logistic regression model in which we regressed the outcome measure (self-reported nonsmoking at 6-month follow-up compared with smoking) on the effect measure (use of each of the 3 smoking cessation treatments compared with no use of such treatments), adjusted for the above-mentioned confounders and year of the survey. In addition to the model from this primary analysis (“fully adjusted model”), we constructed a simple model including only the effect measure (“unadjusted model”) and a model that included the effect measure, year of the survey, and all confounders except for the 2 measures of tobacco dependence (“partially adjusted model”) to show the extent of confounding effects of tobacco dependence.

odel”), we constructed a simple model including only the effect measure (“unadjusted model”) and a model that included the effect measure, year of the survey, and all confounders except for the 2 measures of tobacco dependence (“partially adjusted model”) to show the extent of confounding effects of tobacco dependence. In a sensitivity analysis, we excluded respondents who had used telephone counseling for smoking cessation during their most recent quit attempt; very few smokers in England use this form of treatment, and so it is not possible to assess its association with abstinence. In the primary analysis, these smokers were conservatively counted in the “no-treatment” group unless they had also used medication, whereas in the sensitivity analysis, they were excluded from the analysis. All analyses were performed with complete cases. Respondents with missing data on 1 or more of the confounding variables were excluded (0.3% of the eligible sample).

In a sensitivity analysis, we excluded respondents who had used telephone counseling for smoking cessation during their most recent quit attempt; very few smokers in England use this form of treatment, and so it is not possible to assess its association with abstinence. In the primary analysis, these smokers were conservatively counted in the “no-treatment” group unless they had also used medication, whereas in the sensitivity analysis, they were excluded from the analysis. All analyses were performed with complete cases. Respondents with missing data on 1 or more of the confounding variables were excluded (0.3% of the eligible sample). Results The study population consisted of 1560 respondents with complete baseline and 6-month follow-up data who made at least 1 quit attempt between the 2 time points. Demographic and smoking-related characteristics are summarized in Table 1. The percentage of usage of smoking cessation treatments during the last quit attempt was 4.8% (n=75) for prescription medication combined with specialist behavioral support, 20.8% (n=324) for prescription medication combined with brief advice, 29.9% (n=467) for NRT bought over the counter, and 44.5% (n=694) for using none of these treatments. A total of 399 respondents (25.6%) had used some form of prescription medication during their most recent quit attempt; most of them had used NRT on prescription (56.9%, n=227), followed by varenicline (35.1%, n=140) and bupropion (6.0%, n=24). The remaining 2.0% (n=8) of respondents had used some combination of these medications.

99 respondents (25.6%) had used some form of prescription medication during their most recent quit attempt; most of them had used NRT on prescription (56.9%, n=227), followed by varenicline (35.1%, n=140) and bupropion (6.0%, n=24). The remaining 2.0% (n=8) of respondents had used some combination of these medications. A total of 1201 respondents (77.0%) smoked, and 359 (23.0%) reported not smoking at the 6-month follow-up. The unadjusted abstinence rates were 38.7% (n=29) for users of medication on prescription combined with specialist behavioral support, 27.8% (n=90) for users of prescription medication combined with brief advice, 15.4% (n=72) for users of NRT bought over the counter, and 24.2% (n=168) for those using none of these treatments. The use of treatments was associated with age, time since last quit attempt started, number of quit attempts before the most recent one, the 2 measures of dependence (time spent with and strength of urges to smoke), and social grade (Table 2). The post hoc comparisons established that users of medication (on prescription or over the counter) reported higher levels of dependence than did respondents who had tried to quit unaided.

ore the most recent one, the 2 measures of dependence (time spent with and strength of urges to smoke), and social grade (Table 2). The post hoc comparisons established that users of medication (on prescription or over the counter) reported higher levels of dependence than did respondents who had tried to quit unaided. Table 3 reveals that the fully adjusted odds of nonsmoking in users of prescription medication in combination with specialist behavioral support were 2.58 times higher (95% CI, 1.48-4.52) than in the no-treatment group. The odds were 1.67 times higher (95% CI, 0.94-2.98) than in the group that used prescription medication combined with brief advice, but this difference was not statistically significant (figures not shown in the table). In the latter group, the odds were 1.55 times higher (95% CI, 1.11-2.16) than in the no-treatment group. The use of NRT bought over the counter was associated with lower odds of abstinence (odds ratio, 0.68; 95% CI, 0.49-0.94). In the partially adjusted model, the odds ratios for the 2 groups that used prescription medication were slightly lower than in the fully adjusted model, whereas the odds ratio for the group that used NRT bought over the counter was slightly more extreme. A total of 24 respondents (1.5%) reported having used telephone counseling during their most recent quit attempt. Excluding these respondents from the primary analysis changed the odds ratios of the fully adjusted model only minimally.

Table 3 reveals that the fully adjusted odds of nonsmoking in users of prescription medication in combination with specialist behavioral support were 2.58 times higher (95% CI, 1.48-4.52) than in the no-treatment group. The odds were 1.67 times higher (95% CI, 0.94-2.98) than in the group that used prescription medication combined with brief advice, but this difference was not statistically significant (figures not shown in the table). In the latter group, the odds were 1.55 times higher (95% CI, 1.11-2.16) than in the no-treatment group. The use of NRT bought over the counter was associated with lower odds of abstinence (odds ratio, 0.68; 95% CI, 0.49-0.94). In the partially adjusted model, the odds ratios for the 2 groups that used prescription medication were slightly lower than in the fully adjusted model, whereas the odds ratio for the group that used NRT bought over the counter was slightly more extreme. A total of 24 respondents (1.5%) reported having used telephone counseling during their most recent quit attempt. Excluding these respondents from the primary analysis changed the odds ratios of the fully adjusted model only minimally. Discussion This prospective cohort study found that the use of prescription medication in combination with specialist behavioral support provided by an NHS Stop Smoking Service was associated with the highest success of attempts to quit smoking. The use of prescription medication with limited behavioral support by the prescribing health care professional was also associated with higher success than was unaided quitting, whereas the use of NRT bought over the counter was associated with lower success.

ciated with the highest success of attempts to quit smoking. The use of prescription medication with limited behavioral support by the prescribing health care professional was also associated with higher success than was unaided quitting, whereas the use of NRT bought over the counter was associated with lower success. Comparison With Findings From Randomized Controlled Trials Our estimated effectiveness of adding specialist behavioral support provided by an NHS Stop Smoking Service to prescription medication (adjusted odds ratio, 1.67) is similar to that from a meta-analysis performed for the US guidelines.15 Also, our estimated effectiveness of prescription medication combined with limited behavioral support by the prescribing health care professional compared with unaided quitting (adjusted odds ratio, 1.55) is similar to that from meta-analyses of randomized placebo-controlled trials.4-6 However, our adjusted odds ratio of 0.68 in users of NRT bought over the counter compared with that in those who used neither medication nor behavioral support (indicating a reduced likelihood of quitting in users of NRT bought over the counter) conflicts with a meta-analysis that reported a pooled odds ratio of 2.5 for active NRT bought over the counter vs placebo.16 This discrepancy seems unlikely to relate to the difference in study designs or unmeasured confounding because our prospective cohort design yielded similar results as experimental designs with regard to the use of prescription medication and behavioral support, as noted above. Therefore, the most likely explanation for the low success rate of NRT bought over the counter in our study is inappropriate usage and low adherence in the real world.17,18 Experimental studies cannot mimic the usual environment in which over-the-counter medication is used because trial participants are instructed on how to use the medication, and their adherence to this medication is monitored and promoted during the trial.

is inappropriate usage and low adherence in the real world.17,18 Experimental studies cannot mimic the usual environment in which over-the-counter medication is used because trial participants are instructed on how to use the medication, and their adherence to this medication is monitored and promoted during the trial. For example, the authors from the largest placebo controlled trial of NRT bought over the counter, which contributed to the above-mentioned meta-analysis, acknowledged that “complete reproducibility of the over-the-counter setting was impossible.”19 In that trial, participants were asked to set a quit date within 7 days; they were given instructions on how to use the medication, the first use was under supervision, adverse events were monitored, and adherence was maintained during several site visits.19 This is a different situation from the real-world setting of our study in which smokers use the medication in an uncontrolled yet more realistic fashion.

tructions on how to use the medication, the first use was under supervision, adverse events were monitored, and adherence was maintained during several site visits.19 This is a different situation from the real-world setting of our study in which smokers use the medication in an uncontrolled yet more realistic fashion. Comparison With Findings From Observational Studies One of the aims of this prospective cohort study was to confirm the findings from our earlier cross-sectional study on the real-world effectiveness of smoking cessation treatments.8 The findings from the present study regarding prescription medication largely confirm those from our earlier study, even though the 2 effect estimates for prescription medication with or without specialist behavioral support were closer to 1 in this study, suggesting that residual confounding played a greater role in our previous study. Although NRT bought over the counter was equally associated with the success of quitting than not using treatment in our earlier study (adjusted odds ratio, 0.96; 95% CI, 0.81-1.13),8 NRT bought over the counter was associated with a significant reduction in success in our present study (adjusted odds ratio, 0.68; 95% CI, 0.49-0.94).

ught over the counter was equally associated with the success of quitting than not using treatment in our earlier study (adjusted odds ratio, 0.96; 95% CI, 0.81-1.13),8 NRT bought over the counter was associated with a significant reduction in success in our present study (adjusted odds ratio, 0.68; 95% CI, 0.49-0.94). Our finding of a positive association between the use of prescription medication and the success of attempts to quit smoking is largely consistent with previous prospective cohort studies.20-25 For example, a study using data from 12,156 treatment episodes routinely recorded by 31 NHS Stop Smoking Services in England found that specialist behavioral support combined with dual NRT (but not single NRT), varenicline, or bupropion was associated with a higher rate of success of quit attempts than was behavioral support without medication.20 A study in 7436 smokers taking part in the International Tobacco Control Four Country Study reported higher success rates in smokers trying to quit who used NRT, varenicline, or bupropion than in smokers trying to quit without medication, although the effect estimates were much higher than in our study.21 Another international study in more than 1089 smokers from 5 different countries reported a higher success rate in smokers who used NRT than in smokers who did not use NRT, again with higher effect estimates than in our study.22

uit without medication, although the effect estimates were much higher than in our study.21 Another international study in more than 1089 smokers from 5 different countries reported a higher success rate in smokers who used NRT than in smokers who did not use NRT, again with higher effect estimates than in our study.22 Study Limitations This study has several limitations. First, the response to our 6-month follow-up was only 21% and the response also differed slightly by demographic and smoking characteristics. A higher response would have resulted in increased statistical power, but our sample was large enough to statistically detect the differences in success rates between the treatment groups. We have no reason to assume that the somewhat differential nonresponse biased our estimates for the relative effectiveness of the treatments, but it may have reduced the generalizability of our findings to a small extent. Second, nonrandomized studies are generally vulnerable to confounding. We reduced this risk further than did many previous studies by adjusting for tobacco dependence—measured before a quit attempt was initiated—and several other potential confounders. However, residual confounding may have occurred because not all factors associated with self-selection of treatment, such as comorbidity26 or psychological distress,27 were measured in our survey. Third, our self-reported outcome measure of abstinence from smoking was not biochemically validated. In observational studies such as ours, however, it is unlikely that misreporting of abstinence is associated with the type of treatment respondents used during the last quit attempt they recall.13,14 Fourth, we did not have data on actual use of, and adherence to, the medication and the behavioral support. We have no reason to assume that the report of various treatments was dependent on the respondents’ smoking status at the 6-month follow-up measurement. If bias occurred, this would have led to an underestimation of the effectiveness of prescription medication and specialist behavioral support because unaided quit attempts that fail are more likely to be forgotten.28 An improved real-world design that would reduce the risk of confounding and the reliance on recall data may involve baseline characteristics to be collected first and then recent treatment assessed at a second time point before assessing smoking status at the final follow-up.

hat fail are more likely to be forgotten.28 An improved real-world design that would reduce the risk of confounding and the reliance on recall data may involve baseline characteristics to be collected first and then recent treatment assessed at a second time point before assessing smoking status at the final follow-up. Finally, our sample size was too small for comparing the differential effectiveness of different prescription medications. Strengths As far as we are aware, our study is the first prospective cohort study comparing prescription medication when offered with specialist behavioral support with prescription medication offered without such support. A major strength of our study is the use of a representative sample of the English population that was sufficiently large to detect an effect of specialist behavioral support despite its low prevalence. We used aggregated data from monthly surveys over a period of more than 5 years and therefore minimized potential bias from the rate of quit attempts depending on the time of the year.

of the English population that was sufficiently large to detect an effect of specialist behavioral support despite its low prevalence. We used aggregated data from monthly surveys over a period of more than 5 years and therefore minimized potential bias from the rate of quit attempts depending on the time of the year. Conclusion The use of prescription medication with specialist behavioral support delivered by an NHS Stop Smoking Service or with minimal behavioral support is associated with improved outcomes compared with unaided quitting. Thus, more smokers should be guided into these forms of treatment because currently only 1 of 4 smokers attempting to quit use them. The most frequently used form of treatment, NRT bought over the counter, appears to be associated with reduced success rates. More research is urgently needed on the effectiveness of NRT bought over the counter in the real world. Supplemental Online Material Video 1 For editorial comment, see page 1328 Grant Support: The Smoking Toolkit Study is funded by the English Department of Health, Cancer Research UK, Pfizer, GlaxoSmithKline, and Johnson & Johnson.

Conclusion The use of prescription medication with specialist behavioral support delivered by an NHS Stop Smoking Service or with minimal behavioral support is associated with improved outcomes compared with unaided quitting. Thus, more smokers should be guided into these forms of treatment because currently only 1 of 4 smokers attempting to quit use them. The most frequently used form of treatment, NRT bought over the counter, appears to be associated with reduced success rates. More research is urgently needed on the effectiveness of NRT bought over the counter in the real world. Supplemental Online Material Video 1 For editorial comment, see page 1328 Grant Support: The Smoking Toolkit Study is funded by the English Department of Health, Cancer Research UK, Pfizer, GlaxoSmithKline, and Johnson & Johnson. Potential Competing Interests: Pfizer, Johnson & Johnson, and GlaxoSmithKline are manufacturers of smoking cessation products who had no involvement in the design of the study, collection, analysis or interpretation of the data, the writing of the report, or the decision to submit the paper for publication. Dr West has undertaken research and consultancy and received travel funds from companies that develop and manufactures smoking cessation medications. He has a share of a patent for a novel nicotine delivery device. He is a trustee of the stop-smoking charity, QUIT, and a co-director of the National Centre for Smoking Cessation and Training. Dr Kotz has received an unrestricted research grant from Pfizer for a smoking cessation trial. Dr Brown has received an unrestricted research grant from Pfizer.

novel nicotine delivery device. He is a trustee of the stop-smoking charity, QUIT, and a co-director of the National Centre for Smoking Cessation and Training. Dr Kotz has received an unrestricted research grant from Pfizer for a smoking cessation trial. Dr Brown has received an unrestricted research grant from Pfizer. Table 1 Sample Characteristics (N=1560)a Nonsmoker at follow-up 23.0 (359) Age at baseline 46.5±15.7 Female sex 55.8 (871) Social grade AB 11.0 (171) C1 20.9 (326) C2 22.0 (343) D 17.5 (273) E 28.7 (447) Time spent with urges to smoke at baselineb 3.2±1.2 Strength of urges to smoke at baselinec 2.2±1.0 Time since last quit attempt started at follow-up ≤1 wk 10.5 (164) 2-4 wk 21.1 (329) 5-8 wk 21.0 (327) 9-12 wk 19.8 (309) 13-26 wk 27.6 (431) Number of quit attempts before the most recent one and up to 6 mo at follow-up 0 69.2 (1079) 1 22.5 (351) 2 8.3 (130) Stopped abruptly during last quit attempt at follow-up (vs cut down first) 47.9 (747) Use of smoking cessation treatments during last quit attempt at follow-up Medication on prescription combined with specialist behavioral supportd 4.8 (75) Medication on prescription combined with brief adviced 20.8 (324) NRT bought over the counter 29.9 (467) None of the above 44.5 (694) a Values are expressed as mean ± SD or as No. (percentage). b Time spent with urges to smoke: 1 (not at all) to 6 (all the time). c Strength of urges to smoke: 0 (no urges) to 5 (extremely strong urges). d Medication on prescription included nicotine replacement therapy (NRT), varenicline, or bupropion.

Nonsmoker at follow-up 23.0 (359) Age at baseline 46.5±15.7 Female sex 55.8 (871) Social grade AB 11.0 (171) C1 20.9 (326) C2 22.0 (343) D 17.5 (273) E 28.7 (447) Time spent with urges to smoke at baselineb 3.2±1.2 Strength of urges to smoke at baselinec 2.2±1.0 Time since last quit attempt started at follow-up ≤1 wk 10.5 (164) 2-4 wk 21.1 (329) 5-8 wk 21.0 (327) 9-12 wk 19.8 (309) 13-26 wk 27.6 (431) Number of quit attempts before the most recent one and up to 6 mo at follow-up 0 69.2 (1079) 1 22.5 (351) 2 8.3 (130) Stopped abruptly during last quit attempt at follow-up (vs cut down first) 47.9 (747) Use of smoking cessation treatments during last quit attempt at follow-up Medication on prescription combined with specialist behavioral supportd 4.8 (75) Medication on prescription combined with brief adviced 20.8 (324) NRT bought over the counter 29.9 (467) None of the above 44.5 (694) a Values are expressed as mean ± SD or as No. (percentage). b Time spent with urges to smoke: 1 (not at all) to 6 (all the time). c Strength of urges to smoke: 0 (no urges) to 5 (extremely strong urges). d Medication on prescription included nicotine replacement therapy (NRT), varenicline, or bupropion. Table 2 Associations Between Characteristics of the Sample and Use of Smoking Cessation Treatmentsa

b Time spent with urges to smoke: 1 (not at all) to 6 (all the time). c Strength of urges to smoke: 0 (no urges) to 5 (extremely strong urges). d Medication on prescription included nicotine replacement therapy (NRT), varenicline, or bupropion. Table 2 Associations Between Characteristics of the Sample and Use of Smoking Cessation Treatmentsa Variable Medication on prescription combined with specialist behavioral supportb (n=75) Medication on prescription combined with brief adviceb (n=324) NRT bought over the counter (n=467) None of the others (n=694) P Age at baseline 52.0±13.01 48.6±13.82 46.6±15.41 44.9±16.81,2 <.001 Female sex 50.0 (31) 56.4 (167) 57.1 (306) 54.1 (398) .22 Social grade AB 16.1 (10) 8.1 (24) 11.0 (59) 11.7 (86) .007 C1 14.5 (9) 22.6 (67) 20.0 (107) 20.8 (153) C2 30.6 (19) 16.9 (50) 22.2 (119) 23.1 (170) D 4.8 (3) 20.9 (62) 15.7 (84) 18.2 (134) E 33.9 (21) 31.4 (93) 31.2 (167) 26.1 (192) Time spent with urges to smoke at baselinec 3.7±1.23 3.5±1.24 3.3±1.25 2.9±1.13,4,5 <.001 Strength of urges to smoke at baselined 2.5±1.06 2.4±1.17 2.3±1.08 2.0±1.06,7,8 <.001 Time since quit attempt started at follow-up <.001 ≤1 wk 4.8 (3) 8.8 (26) 9.1 (49) 12.8 (94) 2-4 wk 25.8 (16) 11.5 (34) 23.3 (125) 22.4 (165) 5-8 wk 16.1 (10) 20.9 (62) 22.0 (118) 20.3 (149) 9-12 wk 24.2 (15) 26.0 (77) 17.7 (95) 18.1 (133) 13-26 wk 29.0 (18) 32.8 (97) 27.8 (149) 26.4 (194) Number of quit attempts before the most recent one and up to 6 mo at follow-up .002 0 75.8 (47) 77.4 (229) 67.2 (360) 67.6 (497) 1 14.5 (9) 17.2 (51) 23.9 (128) 23.1 (170) 2 9.7 (6) 5.4 (16) 9.0 (48) 9.3 (68) Stopped abruptly during last quit attempt at follow-up (vs cut down first) 48.4 (30) 44.9 (133) 45.7 (245) 50.1 (368) .14 Superscript numbers 1-8 indicate statistically significant (P<.05) differences between groups with the same letter according to the post hoc analyses.

23.1 (170) 2 9.7 (6) 5.4 (16) 9.0 (48) 9.3 (68) Stopped abruptly during last quit attempt at follow-up (vs cut down first) 48.4 (30) 44.9 (133) 45.7 (245) 50.1 (368) .14 Superscript numbers 1-8 indicate statistically significant (P<.05) differences between groups with the same letter according to the post hoc analyses. a Values are expressed as mean ± SD or as No. (percentage). b Medication on prescription included nicotine replacement therapy (NRT), varenicline, or bupropion. c Time spent with urges to smoke: 1 (not at all) to 6 (all the time). d Strength of urges to smoke: 0 (no urges) to 5 (extremely strong urges). Table 3 Unadjusted and Adjusted Odds of Self-Reported Nonsmoking at 6-mo Follow-Up Stratified by the Method of Quitting Smoking cessation treatment Odds ratio (95% CI) Unadjusted model Partially adjusted modela Fully adjusted modelb Medication on prescription combined with specialist behavioral support (n=62)c 1.98 (1.20-3.24) 2.27 (1.32-3.92) 2.58 (1.48-4.52) Medication on prescription combined with brief advice (n=296)c 1.20 (0.89-1.62) 1.38 (1.00-1.91) 1.55 (1.11-2.16) NRT bought over the counter (n=536) 0.57 (0.42-0.78) 0.62 (0.45-0.85) 0.68 (0.49-0.94) None of the above (reference) (n=735) 1 1 1 a Partially adjusted model was adjusted for age, sex, social grade, time since last quit attempt started, number of quit attempts before the one in question, stopping abruptly vs cutting down, and year of the survey. b Fully adjusted model was adjusted for the variables from the partially adjusted model and for time spent with urges to smoke and strength of urges to smoke.

Smoking cessation treatment Odds ratio (95% CI) Unadjusted model Partially adjusted modela Fully adjusted modelb Medication on prescription combined with specialist behavioral support (n=62)c 1.98 (1.20-3.24) 2.27 (1.32-3.92) 2.58 (1.48-4.52) Medication on prescription combined with brief advice (n=296)c 1.20 (0.89-1.62) 1.38 (1.00-1.91) 1.55 (1.11-2.16) NRT bought over the counter (n=536) 0.57 (0.42-0.78) 0.62 (0.45-0.85) 0.68 (0.49-0.94) None of the above (reference) (n=735) 1 1 1 a Partially adjusted model was adjusted for age, sex, social grade, time since last quit attempt started, number of quit attempts before the one in question, stopping abruptly vs cutting down, and year of the survey. b Fully adjusted model was adjusted for the variables from the partially adjusted model and for time spent with urges to smoke and strength of urges to smoke. c Medication on prescription included nicotine replacement therapy (NRT), varenicline, or bupropion.

In this issue of Mayo Clinic Proceedings, journal readers will discover the first of 15 articles that constitute the new Symposium on Antimicrobial Therapy.1 The articles will be published sequentially in the monthly issues of the journal, ending in mid-2012. This new symposium is published in part because of readers' requests to once again address antimicrobial drugs, as was done in the Proceedings' Symposium on Antimicrobial Agents, published between October 1998 and February 2000. The new 2011-2012 symposium arrives at an important time for infectious disease management worldwide.

ymposium is published in part because of readers' requests to once again address antimicrobial drugs, as was done in the Proceedings' Symposium on Antimicrobial Agents, published between October 1998 and February 2000. The new 2011-2012 symposium arrives at an important time for infectious disease management worldwide. The past 2 decades have seen an unprecedented wave of new and old infections thrust into the public's attention. During that time, the number of emerging and reemerging infectious diseases has substantially increased. Emerging infections are infections that appear for the first time in a population, whereas reemerging infections are known infections that reappear after a decline in incidence or extend their geographic impact. Examples include pandemic influenza A (H1N1) virus,2 avian influenza virus,3 severe acute respiratory syndrome (SARS),4 west Nile virus infection,5 and ehrlichiosis.6 A feature of current emerging and reemerging infections is that disease first appearing at one geographic location traverses continents and affects millions of people within a very short period. First reported from Mexico in the spring of 2009, pandemic influenza A (H1N1) virus infection was noted in almost all countries in the world by March 2010, resulting in nearly 18,000 deaths.7 In only a few months, SARS spread from China to 26 countries and affected 8098 people, causing 774 deaths.4

a very short period. First reported from Mexico in the spring of 2009, pandemic influenza A (H1N1) virus infection was noted in almost all countries in the world by March 2010, resulting in nearly 18,000 deaths.7 In only a few months, SARS spread from China to 26 countries and affected 8098 people, causing 774 deaths.4 The human immunodeficiency virus (HIV) epidemic continues to affect communities worldwide; at the end of 2009, an estimated 33.3 million people were living with HIV.8 However, the most recent global figures indicate that the epidemic is beginning to slow down and perhaps reverse its course. Both HIV incidence and HIV-related deaths have decreased by nearly 20% worldwide. This decline is attributable in part to access to antiretroviral therapy; in 2009, more than 5 million people were receiving antiretroviral therapy. See also page 156

The human immunodeficiency virus (HIV) epidemic continues to affect communities worldwide; at the end of 2009, an estimated 33.3 million people were living with HIV.8 However, the most recent global figures indicate that the epidemic is beginning to slow down and perhaps reverse its course. Both HIV incidence and HIV-related deaths have decreased by nearly 20% worldwide. This decline is attributable in part to access to antiretroviral therapy; in 2009, more than 5 million people were receiving antiretroviral therapy. See also page 156 Globally, tuberculosis (TB) continues to account for a substantial burden of disease, with 9.4 million (11%-13% HIV-positive) incident cases, 14 million prevalent cases, and 1.7 million deaths in 2009.9 The number of cases of multidrug-resistant TB in 2008 was estimated at 440,000. By July 2010, 58 countries and territories had reported at least 1 case of extensively drug-resistant TB. Intensive efforts to reduce the global burden of TB are under way. The cornerstone of these efforts is access to quality diagnosis and treatment. Although little progress has been made in the development of new anti-TB drugs, the scale-up of intensive efforts to improve TB care and control globally has resulted in up to 6 million lives being saved.9 The introduction of newer diagnostic modalities, including automated molecular tests that can be used in a resource-limited setting where the burden of TB is the highest, has generated great optimism and excitement.

sive efforts to improve TB care and control globally has resulted in up to 6 million lives being saved.9 The introduction of newer diagnostic modalities, including automated molecular tests that can be used in a resource-limited setting where the burden of TB is the highest, has generated great optimism and excitement. Many infections have become increasingly difficult to treat because of the emergence of resistance to commonly used antibiotics.10 Bacteria develop resistance in response to selective pressure exerted by inappropriately used antibiotics. Mutations that confer resistance may be passed on to other bacteria of the same species as well as those of different species and genera. Hospital-acquired antibiotic-resistant infections are estimated to cause 100,000 deaths in the United States, with substantial direct and indirect economic costs to the country.11 These antibiotic-resistant infections are caused by a variety of organisms, including methicillin-resistant Staphylococcus aureus, penicillin-resistant pneumococci, vancomycin-resistant enterococci, and resistant gram-negative bacteria (eg, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa), and extended-spectrum β-lactamase–producing bacteria (eg, Escherichia coli, Enterobacter species).12 Some of the reasons for this epidemic of antibiotic resistance among bacteria include poor infection control practices, injudicious use of antibiotics in human medicine, and injudicious use of antibiotics in agriculture. The problem is further aggravated by the lack of a robust antibiotic drug–development pipeline.

.12 Some of the reasons for this epidemic of antibiotic resistance among bacteria include poor infection control practices, injudicious use of antibiotics in human medicine, and injudicious use of antibiotics in agriculture. The problem is further aggravated by the lack of a robust antibiotic drug–development pipeline. Advances in cancer chemotherapy and transplantation, with the resultant increase in the number of people with compromised immunity, as well as an increase in the use of invasive procedures and wide-spectrum antibiotics, have contributed to an increase in the incidence of invasive fungal infections. Although some progress has been made in the development of new diagnostic assays and new antifungal drugs, they remain wholly inadequate, and optimal treatment strategies for many of these invasive fungal infections remain to be defined.13

have contributed to an increase in the incidence of invasive fungal infections. Although some progress has been made in the development of new diagnostic assays and new antifungal drugs, they remain wholly inadequate, and optimal treatment strategies for many of these invasive fungal infections remain to be defined.13 The Mayo Clinic Proceedings' Editorial Board has selected 15 topics for the Symposium on Antimicrobial Therapy that we think will be of relevance and of practical value to general internists and other clinicians. In the first article, Leekha et al1 discuss general principles of antimicrobial therapy, dispensing pearls of infectious diseases practice that are difficult to find in any other single publication. Subsequent articles address a variety of infectious disease–related topics, ranging from pharmacology of antimicrobial agents to current concepts in the management of various infections, including bacterial, fungal, viral, mycobacterial, and parasitic infections. Topics addressed in this symposium also include laboratory testing to guide antimicrobial therapy, antibiotic prophylaxis, and current concepts in outpatient antibiotic therapy. All articles are authored by experts in the subject matter. As with previous symposia published by Mayo Clinic Proceedings, once all the articles in this Symposium on Antimicrobial Therapy have appeared in the journal, they will be compiled into a book that we hope will serve as a valuable resource to the practicing clinician.

ALT = alanine aminotransferase; CHB = chronic hepatitis B; CHC = chronic hepatitis C; CMV = cytomegalovirus; CSF = cerebrospinal fluid; EBV = Epstein-Barr virus; FDA = US Food and Drug Administration; HBeAg = hepatitis B e antigen; HBV = hepatitis B virus; HCV = hepatitis C virus; HHV = human herpesvirus; HIV = human immunodeficiency virus; HSV = herpes simplex virus; HSV-1 = HSV type 1; HSV-2 = HSV type 2; IFN = interferon; IV = intravenous; mRNA= messenger RNA; RSV = respiratory syncytial virus; SC = subcutaneous; SVR = sustained virologic response; TK = thymidine kinase; VZV = varicella zoster virus

uman herpesvirus; HIV = human immunodeficiency virus; HSV = herpes simplex virus; HSV-1 = HSV type 1; HSV-2 = HSV type 2; IFN = interferon; IV = intravenous; mRNA= messenger RNA; RSV = respiratory syncytial virus; SC = subcutaneous; SVR = sustained virologic response; TK = thymidine kinase; VZV = varicella zoster virus Most diseases caused by viral pathogens are self-limited and do not require specific antiviral therapy. Other than therapies targeting the human immunodeficiency virus (HIV), currently available antiviral drugs in the clinical setting target 3 principal groups of viruses—the herpes, hepatitis, and influenza viruses. This review article is structured to discuss antiviral therapeutics on the basis of these 3 major antiviral categories, with the caveat that some drugs discussed in these sections possess other potential applications, such as ribavirin for the treatment of respiratory syncytial virus (RSV) and cidofovir for the treatment of cytomegalovirus (CMV) and other DNA viral infections. Nucleos(t)ide analogues for the treatment of chronic hepatitis B (CHB) may also possess anti-HIV properties, but their clinical utility for the treatment of HIV will be discussed in a separate article in this symposium. Experimental and novel therapies that have not reached clinical application will not be reviewed.

s. Nucleos(t)ide analogues for the treatment of chronic hepatitis B (CHB) may also possess anti-HIV properties, but their clinical utility for the treatment of HIV will be discussed in a separate article in this symposium. Experimental and novel therapies that have not reached clinical application will not be reviewed. ANTIHERPES DRUGS Acyclovir Acyclovir is a synthetic guanosine analogue used for treating herpes simplex virus (HSV) and varicella zoster virus (VZV) infections.1-3 Intravenous (IV) acyclovir provides excellent tissue and fluid penetration, including the cerebrospinal fluid (CSF), whereas oral acyclovir provides modest bioavailability of 15% to 30%. Bioavailability is improved with the use of valacyclovir, the valyl ester formulation of acyclovir. Acyclovir is excreted by glomerular filtration and tubular secretion. Herpesviruses have varying degrees of susceptibility to acyclovir, with HSV type 1 (HSV-1) being most susceptible, followed by HSV type 2 (HSV-2) and VZV, and to a lesser extent Epstein-Barr virus (EBV).1-3 High acyclovir concentrations may also inhibit CMV in vitro, but acyclovir is not recommended clinically for CMV treatment. Acyclovir is not active against human herpesvirus (HHV) 6, 7, and 8. To exert antiviral activity, acyclovir must be converted to acyclovir-triphosphate; this process is initially catalyzed by viral thymidine kinase (TK) and subsequently by human enzymes. Acyclovir-triphosphate serves as a competitive substrate for viral DNA polymerase, and its incorporation into the DNA chain results in termination of viral replication.

ovir must be converted to acyclovir-triphosphate; this process is initially catalyzed by viral thymidine kinase (TK) and subsequently by human enzymes. Acyclovir-triphosphate serves as a competitive substrate for viral DNA polymerase, and its incorporation into the DNA chain results in termination of viral replication. Acyclovir is approved for the treatment of primary and recurrent genital HSV infection (Table 1).2,4,5 Topical acyclovir may be used to treat genital herpes, but the oral formulation is generally recommended6; IV acyclovir is used for severe cases.1,4 Suppressive therapy with oral acyclovir is also indicated to reduce the incidence of recurrent genital herpes.4,7 Oral acyclovir is modestly efficacious against orolabial herpes. In immunocompetent individuals, orolabial herpes is often self-limited, and antiviral treatment is generally not recommended.7 However, oral acyclovir may be indicated for severe cases, for those with recurrent orolabial herpes, and in those who are immunocompromised.7,8

s modestly efficacious against orolabial herpes. In immunocompetent individuals, orolabial herpes is often self-limited, and antiviral treatment is generally not recommended.7 However, oral acyclovir may be indicated for severe cases, for those with recurrent orolabial herpes, and in those who are immunocompromised.7,8 Intravenous acyclovir is the first-line treatment for HSV encephalitis9 and should be started as soon as the disease is suspected clinically. Magnetic resonance imaging of the brain typically demonstrates temporal lobe involvement, and diagnosis is confirmed by detection of HSV DNA in the CSF. Major studies have evaluated the efficacy of 10 days of acyclovir treatment for HSV encephalitis; however, the recommended duration of treatment in the clinical setting is 2 to 3 weeks because shorter durations have been associated with relapse.10 The treatment duration may be further prolonged in immunocompromised patients.8

tudies have evaluated the efficacy of 10 days of acyclovir treatment for HSV encephalitis; however, the recommended duration of treatment in the clinical setting is 2 to 3 weeks because shorter durations have been associated with relapse.10 The treatment duration may be further prolonged in immunocompromised patients.8 Acyclovir is also approved by the US Food and Drug Administration (FDA) for the treatment of VZV11,12; however, young immunocompetent patients with zoster may not require treatment if the lesions are localized and have been present for more than 72 hours. Intravenous acyclovir is recommended for patients with disseminated zoster disease or visceral involvement. Acyclovir treatment of zoster reduces duration of viral shedding, formation of new lesions, and short- and long-term neuralgia.13 Therapy should be started early, but even delayed initiation of acyclovir may still be beneficial in immunocompromised patients. Short-course prednisone may be added as an adjunct to acyclovir treatment of zoster to improve quality of life, especially in elderly patients. Acyclovir has been used in the treatment of acute retinal necrosis (which is associated with HSV or VZV), eczema herpeticum, and oral hairy leukoplakia due to EBV. Oral acyclovir is used to prevent HSV during the early period after transplant in patients not receiving ganciclovir or valganciclovir prophylaxis.14

Acyclovir is also approved by the US Food and Drug Administration (FDA) for the treatment of VZV11,12; however, young immunocompetent patients with zoster may not require treatment if the lesions are localized and have been present for more than 72 hours. Intravenous acyclovir is recommended for patients with disseminated zoster disease or visceral involvement. Acyclovir treatment of zoster reduces duration of viral shedding, formation of new lesions, and short- and long-term neuralgia.13 Therapy should be started early, but even delayed initiation of acyclovir may still be beneficial in immunocompromised patients. Short-course prednisone may be added as an adjunct to acyclovir treatment of zoster to improve quality of life, especially in elderly patients. Acyclovir has been used in the treatment of acute retinal necrosis (which is associated with HSV or VZV), eczema herpeticum, and oral hairy leukoplakia due to EBV. Oral acyclovir is used to prevent HSV during the early period after transplant in patients not receiving ganciclovir or valganciclovir prophylaxis.14 Acyclovir is generally well tolerated. However, IV acyclovir may cause reversible nephrotoxicity in 5% to 10% of patients because of intratubular precipitation of acyclovir crystals. Acyclovir crystalline nephropathy is more common when acyclovir is given as a rapid infusion (reaching serum concentrations >25 μg/mL)15 and in patients with dehydration and preexisting renal impairment.16 Adequate hydration, a slower rate of infusion, and dosing based on renal function may reduce this risk. Reversible neurologic symptoms such as delirium and seizures may occur rarely in elderly people and those with renal impairment; this toxicity has been associated with high serum acyclovir concentrations15 and high CSF levels of its metabolite 9-carboxymethoxymethylguanine.17-19 Other adverse effects are gastrointestinal symptoms, myelosuppression, and rash.3,20,21

and seizures may occur rarely in elderly people and those with renal impairment; this toxicity has been associated with high serum acyclovir concentrations15 and high CSF levels of its metabolite 9-carboxymethoxymethylguanine.17-19 Other adverse effects are gastrointestinal symptoms, myelosuppression, and rash.3,20,21 Acyclovir-resistant HSV has been reported, especially in immunocompromised patients.22-24 Resistance occurs by selection of viral mutants that are deficient in TK (which results in an inability to activate acyclovir) or that have altered DNA polymerase with reduced affinity to acyclovirtriphosphate.23 Brivudin Brivudin is a 5′-halogenated thymidine nucleoside analogue that is highly active against HSV-1 and VZV.25,26 Brivudin is phosphorylated by viral TK and cellular kinases to brivudin-triphosphate, which serves as a competitive inhibitor of viral DNA polymerase, thereby terminating viral DNA synthesis. It is available in some countries for the treatment of herpes zoster and herpes simplex. However, concerns about its toxicity halted its clinical development in the United States. Its metabolite, bromovinyluracil, irreversibly inhibits dihydropyridine dehydrogenase, which regulates nucleoside metabolism. Coadministration with 5-fluorouracil has resulted in lethal bone marrow toxicity and severe gastrointestinal toxicity.25,26

out its toxicity halted its clinical development in the United States. Its metabolite, bromovinyluracil, irreversibly inhibits dihydropyridine dehydrogenase, which regulates nucleoside metabolism. Coadministration with 5-fluorouracil has resulted in lethal bone marrow toxicity and severe gastrointestinal toxicity.25,26 Cidofovir Cidofovir is a nucleoside analogue used for the treatment of CMV, other herpesviruses, and other DNA viral infections.27 It is available as an IV formulation, and an oral prodrug of cidofovir (known as CMX-001) is under clinical development.28 This investigational lipid ester formulation of cidofovir has enhanced bioavailability, resulting in improved 50% inhibitory concentrations.28 Direct intraocular injection of cidofovir is contraindicated due to ocular hypotony.27 Serum cidofovir concentrations decline rapidly after IV infusion, with a half-life of 2 hours; however, the intracellular half-life of active cidofovir-diphosphate is as long as 65 hours. Cidofovir is eliminated by glomerular filtration and tubular secretion; probenecid reduces its excretion by blocking tubular secretion.29,30

dofovir concentrations decline rapidly after IV infusion, with a half-life of 2 hours; however, the intracellular half-life of active cidofovir-diphosphate is as long as 65 hours. Cidofovir is eliminated by glomerular filtration and tubular secretion; probenecid reduces its excretion by blocking tubular secretion.29,30 Cidofovir is phosphorylated by cellular kinases into cidofovir-diphosphate, a competitive substrate for viral DNA polymerase, thereby halting viral DNA synthesis.27 The major clinical indication for cidofovir is the treatment of CMV retinitis in HIV-infected patients (Table 1).31 Cidofovir is also used as rescue therapy for immunocompromised patients with CMV disease resistant or unresponsive to ganciclovir.32 Because activation of cidofovir does not rely on viral kinases, it retains activity against CMV with the UL97 mutation and HSV with the TK mutation.33 Resistance to cidofovir occurs when the virus develops mutations in the DNA polymerase gene (ie, CMV-UL54 gene mutations).33 Cidofovir has also been used off-label for various illnesses, such as acyclovir-resistant HSV disease, condyloma acuminatum, BK virus–associated hemorrhagic cystitis, JC virus–associated progressive multifocal leukoencephalopathy, and other infections due to double-stranded DNA viruses.34-47 TABLE 1. Suggested Antiviral Drugs for the Treatment of Herpesvirus infectionsa,b,c

Cidofovir is phosphorylated by cellular kinases into cidofovir-diphosphate, a competitive substrate for viral DNA polymerase, thereby halting viral DNA synthesis.27 The major clinical indication for cidofovir is the treatment of CMV retinitis in HIV-infected patients (Table 1).31 Cidofovir is also used as rescue therapy for immunocompromised patients with CMV disease resistant or unresponsive to ganciclovir.32 Because activation of cidofovir does not rely on viral kinases, it retains activity against CMV with the UL97 mutation and HSV with the TK mutation.33 Resistance to cidofovir occurs when the virus develops mutations in the DNA polymerase gene (ie, CMV-UL54 gene mutations).33 Cidofovir has also been used off-label for various illnesses, such as acyclovir-resistant HSV disease, condyloma acuminatum, BK virus–associated hemorrhagic cystitis, JC virus–associated progressive multifocal leukoencephalopathy, and other infections due to double-stranded DNA viruses.34-47 TABLE 1. Suggested Antiviral Drugs for the Treatment of Herpesvirus infectionsa,b,c Nephrotoxicity is the most common serious adverse effect of cidofovir.27 The incidence and severity of nephrotoxicity may be reduced by hydration and probenecid.48 Blood cell counts should be monitored to assess myelosuppression, and ophthalmological surveillance is recommended because of the risk of ocular hypotony, uveitis, and iritis.49,50

st common serious adverse effect of cidofovir.27 The incidence and severity of nephrotoxicity may be reduced by hydration and probenecid.48 Blood cell counts should be monitored to assess myelosuppression, and ophthalmological surveillance is recommended because of the risk of ocular hypotony, uveitis, and iritis.49,50 Famciclovir Famciclovir is a diacetyl 6-deoxy analogue of penciclovir. Oral famciclovir is rapidly absorbed and achieves a bioavailability of 77%.51 Famciclovir is metabolized into penciclovir, reaching peak plasma penciclovir concentrations within 1 hour. Because of extensive hepatic metabolism, virtually no famciclovir is detectable in plasma.51 Famciclovir is excreted renally as penciclovir and its 6-deoxy precursor.9 Famciclovir is active against HSV-1, HSV-2, and VZV, and, to a lesser extent, against EBV. Its mechanism of action is through penciclovir; penciclovir triphosphate inhibits herpes DNA synthesis by acting as a substrate for viral DNA polymerase. The major clinical indications for famciclovir use are treatment of herpes zoster, recurrent genital herpes,52 and recurrent herpes labialis.53 Famciclovir can also be used as suppression therapy to reduce the risk of recurrent genital herpes as well as oral treatment of uncomplicated varicella in HIV-infected patients. The most common adverse effects of famciclovir are headache and nausea.54 Rare adverse events include jaundice, rash, pruritus, somnolence, and confusion.54 Acute renal failure has occurred in patients taking inappropriately high doses of famciclovir.

Famciclovir is active against HSV-1, HSV-2, and VZV, and, to a lesser extent, against EBV. Its mechanism of action is through penciclovir; penciclovir triphosphate inhibits herpes DNA synthesis by acting as a substrate for viral DNA polymerase. The major clinical indications for famciclovir use are treatment of herpes zoster, recurrent genital herpes,52 and recurrent herpes labialis.53 Famciclovir can also be used as suppression therapy to reduce the risk of recurrent genital herpes as well as oral treatment of uncomplicated varicella in HIV-infected patients. The most common adverse effects of famciclovir are headache and nausea.54 Rare adverse events include jaundice, rash, pruritus, somnolence, and confusion.54 Acute renal failure has occurred in patients taking inappropriately high doses of famciclovir. Fomivirsen Fomivirsen is a 21-nucleotide phosphorothionate oligonucleotide complementary to messenger RNA (mRNA) of the immediate-early region of CMV.55-57 Its antiviral property is exerted by antisense inhibition of target gene expression. Other potential mechanisms of antiviral activity include its nonspecific interactions with viral particles that may prevent adsorption or lead to inhibition of enzymes required for viral DNA synthesis.

mediate-early region of CMV.55-57 Its antiviral property is exerted by antisense inhibition of target gene expression. Other potential mechanisms of antiviral activity include its nonspecific interactions with viral particles that may prevent adsorption or lead to inhibition of enzymes required for viral DNA synthesis. Fomivirsen is given intravitreally. Its main indication is the treatment of CMV retinitis in patients with AIDS who have not benefited from or are intolerant of standard CMV therapies, or whose virus is resistant to ganciclovir and foscarnet.55-57 The main adverse effect of fomivirsen is increased intraocular pressure and inflammation. Blurred vision, conjunctival hemorrhage, retinal detachment, and retinal edema are other adverse effects.55-57 Foscarnet Foscarnet is a nonnucleoside pyrophosphate analogue that is given intravenously for the treatment of herpesviruses.58 Its pharmacokinetic profile is complicated by a high incidence of nephrotoxicity and by its deposition and subsequent gradual release from bone.58 Its half-life depends on the duration of therapy; in patients with normal renal function, the plasma half-life is about 2 to 4 hours, but terminal half-lives up to about 8 days may occur when it has accumulated in bones. Foscarnet is excreted through glomerular filtration.

on and subsequent gradual release from bone.58 Its half-life depends on the duration of therapy; in patients with normal renal function, the plasma half-life is about 2 to 4 hours, but terminal half-lives up to about 8 days may occur when it has accumulated in bones. Foscarnet is excreted through glomerular filtration. Foscarnet selectively inhibits pyrophosphate binding on viral DNA polymerases, thus suppressing HSV-1, HSV-2, and CMV replication. It is also active against VZV, HHV-6, and EBV.59 Unlike ganciclovir, foscarnet does not require intracellular conversion to active triphosphate, thus maintaining activity against herpesviruses with TK or UL97 kinase mutations.33 Foscarnet is approved for the treatment of CMV retinitis in patients with AIDS.58 It has been used to treat other CMV diseases in immunocompromised patients, especially those unable to tolerate ganciclovir and those infected with ganciclovir-resistant virus.60,61 Foscarnet is also used for treating acyclovir-resistant mucocutaneous HSV and VZV in immunocompromised patients.58 On rare occasion, it has been used for prevention of CMV in transplant recipients; however, its toxicity limits this clinical indication.60,61

ovir and those infected with ganciclovir-resistant virus.60,61 Foscarnet is also used for treating acyclovir-resistant mucocutaneous HSV and VZV in immunocompromised patients.58 On rare occasion, it has been used for prevention of CMV in transplant recipients; however, its toxicity limits this clinical indication.60,61 Nephrotoxicity is the most common serious adverse effect of foscarnet, affecting 30% of patients. It is caused by deposition of foscarnet crystals in the glomerular capillary lumen.62,63 Foscarnet may cause myelosuppression, with anemia as the most common effect. It can chelate bivalent metal ions and may lead to reductions in ionized calcium. Other electrolyte disturbances are hypokalemia, hypomagnesemia, and hypophosphatasemia, which could manifest as paresthesias, cardiac dysrhythmias, and neurologic symptoms, including seizures.64 Patients should be hydrated to prevent nephrotoxicity, and electrolyte abnormalities should be corrected to avoid cardiac and neurologic complications. Ganciclovir Ganciclovir is an acyclic 2′-deoxyguanosine analogue for the management of CMV.65 It is available in oral and parenteral formulations. Oral ganciclovir is poorly absorbed, with a bioavailability of only 5%.65 Management of active CMV disease is therefore with IV ganciclovir or its oral valyl prodrug valganciclovir. Intravitreal ganciclovir implants are also available, with minimal systemic absorption. Ganciclovir is excreted renally.

ral formulations. Oral ganciclovir is poorly absorbed, with a bioavailability of only 5%.65 Management of active CMV disease is therefore with IV ganciclovir or its oral valyl prodrug valganciclovir. Intravitreal ganciclovir implants are also available, with minimal systemic absorption. Ganciclovir is excreted renally. Ganciclovir undergoes triphosphorylation to become active, with the initial monophosphorylation catalyzed by UL97-encoded kinase and subsequently by cellular kinases. Ganciclovir triphosphate inhibits viral DNA synthesis through competitive incorporation during viral DNA synthesis, thereby leading to DNA chain termination. In vitro, it is 10 times more potent than acyclovir against CMV and EBV and is just as effective as acyclovir against HSV-1, HSV-2, and VZV.66 Ganciclovir is active against HHV-6 and HHV-8 but not against HHV-7.67

is through competitive incorporation during viral DNA synthesis, thereby leading to DNA chain termination. In vitro, it is 10 times more potent than acyclovir against CMV and EBV and is just as effective as acyclovir against HSV-1, HSV-2, and VZV.66 Ganciclovir is active against HHV-6 and HHV-8 but not against HHV-7.67 Ganciclovir is approved for the treatment of CMV retinitis in patients with AIDS, the treatment of herpes simplex keratitis, and CMV prophylaxis in transplant recipients. Intravenous ganciclovir may also be used to treat other forms of CMV disease, such as colitis or esophagitis. Induction therapy with IV ganciclovir for CMV retinitis in patients with AIDS has an efficacy of 85% to 95% in stabilizing disease.68 Because it is poorly absorbed, oral ganciclovir should not be used for induction treatment of CMV disease.69 Because CMV disease often recurs or progresses in patients with advanced AIDS, oral or IV ganciclovir (or valganciclovir) is given as maintenance therapy until immune reconstitution is achieved.69 Intravitreal ganciclovir may also be surgically implanted for the treatment of CMV retinitis, although this treatment should be used together with systemic therapy with IV ganciclovir or oral valganciclovir therapy.

nciclovir (or valganciclovir) is given as maintenance therapy until immune reconstitution is achieved.69 Intravitreal ganciclovir may also be surgically implanted for the treatment of CMV retinitis, although this treatment should be used together with systemic therapy with IV ganciclovir or oral valganciclovir therapy. Oral ganciclovir may be used to prevent CMV in patients with AIDS; however, the benefit of this strategy is not as pronounced in the era of highly active antiretroviral therapy. Although IV and oral ganciclovir have also been used to prevent CMV disease in transplant recipients, valganciclovir is currently the preferred drug for this indication.60,61,70 Intravenous ganciclovir is also used as a first-line treatment of CMV disease in bone marrow and solid organ transplant recipients.61 Reversible bone marrow suppression is the most common adverse effect of ganciclovir. Other adverse effects of the drug are rash, pruritus, diarrhea, nausea, vomiting, and increased levels of serum creatinine and liver enzymes. Neurotoxicity may occur occasionally. Resistance to ganciclovir occurs most commonly in severely immunocompromised patients with prolonged exposure to the drug. The most common mechanism for ganciclovir resistance is UL97 gene mutation71; this mutation leads to deficiency in the viral kinase that is necessary for the initial phosphorylation of ganciclovir into its active form. A less common mechanism is a mutation in the UL54 gene, which encodes for the CMV DNA polymerase.71

. The most common mechanism for ganciclovir resistance is UL97 gene mutation71; this mutation leads to deficiency in the viral kinase that is necessary for the initial phosphorylation of ganciclovir into its active form. A less common mechanism is a mutation in the UL54 gene, which encodes for the CMV DNA polymerase.71 Penciclovir Penciclovir is an acyclic guanine analogue that is chemically similar to acyclovir. Because it is poorly absorbed from the gastrointestinal tract, it is only available as topical therapy for mucocutaneous herpes. For systemic use, penciclovir has been reformulated into the oral prodrug famciclovir. The antiviral activity of penciclovir is similar to that of acyclovir, with efficacy against HSV-1, HSV-2, and VZV, and, to a lesser extent, against EBV.72 Penciclovir is monophosphorylated by TK and subsequently by cellular kinases into active penciclovir-triphosphate, which inhibits herpes DNA polymerase activity by serving as a competitive inhibitor of deoxyguanosine triphosphate.73 Penciclovir is approved as topical therapy for recurrent herpes labialis, resulting in a faster healing rate and reduction in pain and viral shedding.74 Valacyclovir Valacyclovir, an L-valyl ester prodrug of acyclovir,75 provides a higher bioavailability (55%) than oral acyclovir. After absorption, valacyclovir is hydrolyzed almost completely to acyclovir by first-pass intestinal and hepatic metabolism. It achieves peak serum concentration in 1 to 3 hours. Serum acyclovir levels are much higher with valacyclovir than with oral acyclovir.75

ides a higher bioavailability (55%) than oral acyclovir. After absorption, valacyclovir is hydrolyzed almost completely to acyclovir by first-pass intestinal and hepatic metabolism. It achieves peak serum concentration in 1 to 3 hours. Serum acyclovir levels are much higher with valacyclovir than with oral acyclovir.75 The mechanism of action and spectrum of activity of valacyclovir is identical to those of acyclovir. It is approved for the treatment of initial or recurrent episodes of genital herpes76 and for the treatment of recurrent herpes labialis.4 Treatment is most efficacious when initiated at the earliest onset of symptoms.4 Suppressive therapy with valacyclovir is recommended to prevent recurrent genital herpes76 and has the potential to reduce transmission to sexual partners.4

episodes of genital herpes76 and for the treatment of recurrent herpes labialis.4 Treatment is most efficacious when initiated at the earliest onset of symptoms.4 Suppressive therapy with valacyclovir is recommended to prevent recurrent genital herpes76 and has the potential to reduce transmission to sexual partners.4 Valacyclovir is approved for treatment of VZV. Varicella often resolves without antiviral therapy in those who are immunocompetent. However, in immunocompromised patients, such as HIV-infected patients and transplant recipients, valacyclovir may be used to treat varicella, even if it is uncomplicated.77 Valacyclovir is the most commonly used drug for the treatment of zoster.75,77 In a randomized double-blind trial of older immunocompetent patients, valacyclovir was as effective as acyclovir, with similar resolution rates of cutaneous zoster but accelerated resolution of herpetic pain and a lower risk of postherpetic neuralgia.75 The typical course of zoster treatment is 7 days, and the first dose should be started within 48 hours of rash onset. Treatment can be prolonged, continuing until all lesions have crusted, in immunocompromised patients.77

s zoster but accelerated resolution of herpetic pain and a lower risk of postherpetic neuralgia.75 The typical course of zoster treatment is 7 days, and the first dose should be started within 48 hours of rash onset. Treatment can be prolonged, continuing until all lesions have crusted, in immunocompromised patients.77 Valacyclovir has also been used to treat acute retinal necrosis and for prevention of CMV disease in kidney transplant recipients.78 Although ganciclovir is the backbone for CMV prevention in transplant recipients, the efficacy of valacyclovir prophylaxis for CMV prevention was demonstrated in kidney transplant recipients.78 However, valacyclovir has not been proven effective for preventing CMV in heart, liver, lung, pancreas, and small bowel transplant recipients. The adverse effects of valacyclovir are similar to those of acyclovir. At very high doses, neurotoxicity characterized by confusion, hallucinations, and seizures may occur,78 especially in elderly patients and in those with dehydration and renal disease. The mechanism of resistance for valacyclovir is identical to that of acyclovir (TK mutation); however, achieving higher serum acyclovir levels with valacyclovir could reduce the risk of resistance compared with oral acyclovir.

may occur,78 especially in elderly patients and in those with dehydration and renal disease. The mechanism of resistance for valacyclovir is identical to that of acyclovir (TK mutation); however, achieving higher serum acyclovir levels with valacyclovir could reduce the risk of resistance compared with oral acyclovir. Valganciclovir Valganciclovir is the L-valyl ester prodrug of ganciclovir. Oral valganciclovir is well absorbed and converted to ganciclovir by first-pass intestinal or hepatic metabolism.79 The bioavailability of ganciclovir after valganciclovir administration is about 60%, and peak plasma concentrations are achieved in 1 to 3 hours.80,81 Valganciclovir is eliminated renally as ganciclovir.80,82

valganciclovir is well absorbed and converted to ganciclovir by first-pass intestinal or hepatic metabolism.79 The bioavailability of ganciclovir after valganciclovir administration is about 60%, and peak plasma concentrations are achieved in 1 to 3 hours.80,81 Valganciclovir is eliminated renally as ganciclovir.80,82 Valganciclovir exerts its antiviral activity in the form of ganciclovir-triphosphate, which inhibits viral replication by serving as a competitive substrate for CMV DNA polymerase. Valganciclovir was first approved by the FDA for treatment of CMV retinitis in patients with AIDS.83 For immediate sight-threatening lesions, valganciclovir is used in combination with an intravitreal ganciclovir implant. Valganciclovir is also used for preventing CMV disease in high-risk CMV donor-positive/recipient-negative recipients of kidney, heart, or kidney-pancreas transplants.61,84 In the United States, valganciclovir is not approved for preventing CMV disease in liver recipients because of a higher incidence of tissue-invasive CMV disease in patients who received valganciclovir vs oral ganciclovir prophylaxis. In other countries, valganciclovir is used for preventing CMV disease in all solid organ transplant recipients. It has recently gained approval for the prevention of CMV disease in pediatric heart and kidney transplant recipients. It can also be used to preemptively treat asymptomatic CMV infection in transplant recipients.85-88 Valganciclovir was recently demonstrated to be as effective as IV ganciclovir for treating mild to moderate CMV disease in transplant recipients.86,87,89

f CMV disease in pediatric heart and kidney transplant recipients. It can also be used to preemptively treat asymptomatic CMV infection in transplant recipients.85-88 Valganciclovir was recently demonstrated to be as effective as IV ganciclovir for treating mild to moderate CMV disease in transplant recipients.86,87,89 Bone marrow suppression is the most common adverse effect of valganciclovir. Gastrointestinal manifestations, such as diarrhea, nausea, and vomiting, may be observed. Resistance to valganciclovir occurs through mechanisms identical to those underlying ganciclovir resistance, ie, through mutations in the UL97 gene, which encodes for CMV kinase, and the UL54 gene, which encodes for CMV DNA polymerase.71 Vidarabine Vidarabine, a purine nucleoside obtained from Streptomyces antibioticus, was historically used for treating HSV and VZV. Acyclovir has since become the preferred drug for these conditions.90 Vidarabine is currently available only as an ophthalmic solution for treating recurrent epithelial keratitis and acute keratoconjunctivitis.90 Once phosphorylated into its active form, vidarabine inhibits viral DNA polymerase. Adverse effects of ophthalmic vidarabine include irritation, pain, photophobia, lacrimation, and occlusion of the lacrimal duct.90

y as an ophthalmic solution for treating recurrent epithelial keratitis and acute keratoconjunctivitis.90 Once phosphorylated into its active form, vidarabine inhibits viral DNA polymerase. Adverse effects of ophthalmic vidarabine include irritation, pain, photophobia, lacrimation, and occlusion of the lacrimal duct.90 ANTIVIRAL DRUGS FOR INFLUENZA M2 Inhibitors Amantadine. Amantadine is a symmetric tricyclic amine that inhibits replication of influenza A virus by impairing the function of the membrane protein M2.91 Present only in influenza A virus, M2 is an acid-activated ion channel required for nucleocapsid release.91 Amantadine is well absorbed after oral administration. It has an elimination half-life of 11 to 15 hours and is excreted by glomerular filtration and tubular secretion. Amantadine is effective for treating susceptible influenza A virus infection.91 It results in a more rapid functional recovery and reduces the duration of fever and other symptoms by about 1 day, if given within 48 hours of disease onset.91 Amantadine is effective as prophylaxis for preventing symptomatic influenza A infection in exposed persons.92,93 It is usually given for 14 days or for at least 7 days after the last confirmed illness. Seasonal influenza vaccination, however, remains the preferred method for prevention.

hin 48 hours of disease onset.91 Amantadine is effective as prophylaxis for preventing symptomatic influenza A infection in exposed persons.92,93 It is usually given for 14 days or for at least 7 days after the last confirmed illness. Seasonal influenza vaccination, however, remains the preferred method for prevention. Amantadine is generally well tolerated. Among its adverse effects are mild neurologic symptoms such as anxiety, disorientation, and headache, especially in elderly patients and those taking neuroaffective drugs. Emergence of amantadine resistance has limited its use in the clinical setting.94,95 Amantadine resistance, characterized by amino acid substitutions in the M2 protein, emerges within 2 to 4 days of treatment. Because of widespread resistance, amantadine is no longer recommended for empiric treatment of influenza.94,95 M2 mutation confers cross-resistance with rimantadine. Rimantadine. Rimantadine is a symmetric tricyclic amine that inhibits influenza virus.93 It is well absorbed after oral administration, reaching peak plasma concentration in 3 to 5 hours. Rimantadine undergoes extensive hepatic metabolism before it is excreted in the urine.

Amantadine is generally well tolerated. Among its adverse effects are mild neurologic symptoms such as anxiety, disorientation, and headache, especially in elderly patients and those taking neuroaffective drugs. Emergence of amantadine resistance has limited its use in the clinical setting.94,95 Amantadine resistance, characterized by amino acid substitutions in the M2 protein, emerges within 2 to 4 days of treatment. Because of widespread resistance, amantadine is no longer recommended for empiric treatment of influenza.94,95 M2 mutation confers cross-resistance with rimantadine. Rimantadine. Rimantadine is a symmetric tricyclic amine that inhibits influenza virus.93 It is well absorbed after oral administration, reaching peak plasma concentration in 3 to 5 hours. Rimantadine undergoes extensive hepatic metabolism before it is excreted in the urine. The mechanism of action of rimantadine is similar to that of amantadine; it inhibits the ion channel function of M2, thereby inhibiting viral uncoating. Rimantadine is indicated for prevention and treatment of influenza A virus93; however, its clinical utility is currently limited by drug resistance.96,97 A few trials that compared amantadine and rimantadine suggested similar efficacy; however, neurologic adverse events are less severe and frequent with rimantadine.

g. Rimantadine is indicated for prevention and treatment of influenza A virus93; however, its clinical utility is currently limited by drug resistance.96,97 A few trials that compared amantadine and rimantadine suggested similar efficacy; however, neurologic adverse events are less severe and frequent with rimantadine. Neuraminidase Inhibitors Oseltamivir. Oseltamivir phosphate is a prodrug of oseltamivir carboxylate, which is an inhibitor of neuraminidase that is essential in the replication of influenza A and B viruses.98 Oral oseltamivir is well absorbed and reaches peak serum concentrations in 1 hour. Bioavailability of oseltamivir phosphate is at least 75%. The prodrug oseltamivir phosphate undergoes extensive hepatic metabolism via ester hydrolysis. More than 99% of active oseltamivir carboxylate is excreted renally. Oseltamivir carboxylate, the active drug metabolite, selectively blocks viral neuraminidase, thereby preventing the release of virus from infected cells.98 Oseltamivir is approved for the treatment of children (≥1 year) and adults with influenza A or B viral infections.98 Treatment should start within 48 hours of disease onset and continue for 5 days. Oseltamivir is as effective as the other neuraminidase inhibitor, zanamivir, in reducing the febrile period during infection with influenza A (H1N1), influenza A (H3N2), and influenza B virus.99

ts with influenza A or B viral infections.98 Treatment should start within 48 hours of disease onset and continue for 5 days. Oseltamivir is as effective as the other neuraminidase inhibitor, zanamivir, in reducing the febrile period during infection with influenza A (H1N1), influenza A (H3N2), and influenza B virus.99 Oseltamivir is also used for postexposure prophylaxis against influenza A and B, including pandemic strains. For this indication, oseltamivir should be started within 48 hours of exposure and continued daily for at least 10 days or for up to 6 weeks during an outbreak. A systematic review reported no statistically significant difference between oseltamivir and zanamivir prophylaxis for preventing symptomatic influenza among immunocompetent adults.100 The most common adverse effects of oseltamivir are nausea, vomiting, diarrhea, abdominal pain, insomnia, and vertigo. Neuropsychiatric adverse effects, including delirium, abnormal behavior, and hallucinations, have been reported. Oseltamivir-resistant influenza A virus has been reported.101-103 Mutations in the neuraminidase gene, such as R292K101 and H274Y,98 account for oseltamivir resistance. Surveillance conducted during the 2009 H1N1 influenza pandemic detected sporadic and infrequent incidence of oseltamivir-resistant pandemic (H1N1) 2009 influenza virus. All resistant viruses had neuraminidase mutations (most commonly H275Y mutation) that conferred resistance to oseltamivir, but not to zanamivir.104 Oseltamivir resistance among influenza B viruses occurs less frequently.105

sporadic and infrequent incidence of oseltamivir-resistant pandemic (H1N1) 2009 influenza virus. All resistant viruses had neuraminidase mutations (most commonly H275Y mutation) that conferred resistance to oseltamivir, but not to zanamivir.104 Oseltamivir resistance among influenza B viruses occurs less frequently.105 Zanamivir. Zanamivir is an inhaled neuraminidase inhibitor that is used for the treatment and prophylaxis of influenza A and B viruses.106 Zanamivir is not available orally since it is poorly absorbed.106 Inhaled zanamivir produces high concentrations in the respiratory tract where influenza virus infection occurs. About 4% to 20% of inhaled zanamivir is absorbed systemically, producing peak serum concentrations at 1 to 2 hours. The absorbed drug is not metabolized and is excreted unchanged in the urine, while the unabsorbed drug is excreted in the feces.106 The mechanism of action of zanamivir is similar to oseltamivir, by inhibiting neuraminidase, which is essential for release of newly formed viral particles from infected cells.106 For treatment, zanamivir is given by inhalation twice daily for 5 days, with the therapy begun within 48 hours after symptom onset. Zanamivir can be given once daily for 10 days as postexposure prophylaxis of influenza A and B in household or close contacts. Zanamivir prophylaxis during community outbreaks may be given for 28 days. Zanamivir has occasionally been given IV to treat critically ill patients with influenza.107,108

after symptom onset. Zanamivir can be given once daily for 10 days as postexposure prophylaxis of influenza A and B in household or close contacts. Zanamivir prophylaxis during community outbreaks may be given for 28 days. Zanamivir has occasionally been given IV to treat critically ill patients with influenza.107,108 Inhaled zanamivir is well tolerated.106 Acute bronchospasm with decline in respiratory function has been reported; a bronchodilator should be available if given as treatment for patients with underlying pulmonary disease. Other adverse effects include headache and gastrointestinal symptoms. Hypersensitivity reactions and neuropsychiatric adverse effects occur rarely.109

ospasm with decline in respiratory function has been reported; a bronchodilator should be available if given as treatment for patients with underlying pulmonary disease. Other adverse effects include headache and gastrointestinal symptoms. Hypersensitivity reactions and neuropsychiatric adverse effects occur rarely.109 ANTIVIRAL DRUGS FOR HEPATITIS AND OTHER VIRUSES Interferons Interferons (IFNs) are naturally occurring proteins produced in response to viral infection.110 The 3 major classes of IFNs are α, β, and γ; IFN-α and IFN-β are further classified as type I, whereas IFN-γ is type II.110 Available only in parenteral formulation, more than 80% of a subcutaneous (SC) or intramuscular dose of IFN-α is absorbed.110 After an intramuscular injection, peak IFN concentrations occur within 4 to 8 hours and return to baseline levels in 16 to 24 hours.110 Pegylation, which is the process of attachment of IFN to a large inert polyethylene glycol, markedly reduces the rate of absorption and excretion of IFN and therefore increases its plasma concentration.111 For example, after an SC dose of peginterferon α-2b, the peak serum concentration occurs in 15 to 44 hours, high concentrations are maintained for 48 to 72 hours, and the mean terminal half-life is about 40 hours.110 In contrast, the peak serum concentration of peginterferon α-2a is reached in 72 to 96 hours after an SC dose, and the mean terminal half-life is 160 hours.110 Interferon-α undergoes extensive renal catabolism, and negligible amounts of IFN are excreted in the urine.

nd the mean terminal half-life is about 40 hours.110 In contrast, the peak serum concentration of peginterferon α-2a is reached in 72 to 96 hours after an SC dose, and the mean terminal half-life is 160 hours.110 Interferon-α undergoes extensive renal catabolism, and negligible amounts of IFN are excreted in the urine. Interferons have multiple overlapping biological activities, including antiviral, antiproliferative, and immunoregulatory functions. After binding to receptors, IFNs initiate a cascade of events that lead to various cellular responses, such as inhibition of virus replication, suppression of cell proliferation, enhancement of the phagocytic activity of macrophages, and augmentation of the specific cytotoxicity of lymphocytes for target cells.

ctions. After binding to receptors, IFNs initiate a cascade of events that lead to various cellular responses, such as inhibition of virus replication, suppression of cell proliferation, enhancement of the phagocytic activity of macrophages, and augmentation of the specific cytotoxicity of lymphocytes for target cells. Interferons have been used in treating multiple viral infections and are most commonly used for treating chronic viral hepatitis.112 Interferon-α was the first drug approved for treatment of compensated liver disease due to CHB; it is not approved for treating acute hepatitis B. For CHB, IFN α-2a or α-2b is given parenterally, depending on dosing schedule, for 4 to 6 months or up to 48 weeks.112,113 Interferon was most effective in patients with recently acquired hepatitis B virus (HBV), high pretreatment levels of alanine aminotransferase (ALT), and low levels of HBV DNA. Subcutaneous peginterferon-α is as effective or slightly more effective than SC IFN-α.114 Likewise, SC peginterferon-α may be more effective than lamivudine in hepatitis B e antigen (HBeAg)–positive and HBeAg-negative patients with CHB,115-117 and the addition of lamivudine to peginterferon-α did not significantly enhance efficacy.118 Interferon-α is effective in patients with HBV and hepatitis D virus coinfection,119 although they are less responsive than patients infected with HBV alone.120 Guidelines for the management of CHB in HIV-infected patients were recently published121,122; for patients not requiring anti-HIV therapy, peginterferon-α for 12 months is considered a therapeutic option. Lamivudine and the other antiviral nucleos(t)ides for the treatment of HBV often have anti-HIV properties and may result in the development of HIV resistance if given as monotherapy in HBV-HIV coinfected patients.

patients not requiring anti-HIV therapy, peginterferon-α for 12 months is considered a therapeutic option. Lamivudine and the other antiviral nucleos(t)ides for the treatment of HBV often have anti-HIV properties and may result in the development of HIV resistance if given as monotherapy in HBV-HIV coinfected patients. Interferon-α-2a and -2b are approved for the treatment of chronic hepatitis C (CHC); however, they are not approved for acute hepatitis C. A meta-analysis found that IFN-α for at least 12 months had the best risk-benefit ratio for patients with CHC.123 Once-weekly peginterferon-α was more effective than IFN-α given 3 times weekly in patients with CHC.124-126 However, combination therapy with IFN-α and oral ribavirin is more effective than either drug used alone.127 Combining oral ribavirin with peginterferon-α may be more effective than combining it with IFN-α.128,129 Therefore, the British Society for Gastroenterology and the American Association for the Study of Liver Diseases130 recommends once-weekly SC peginterferon-α combined with oral ribavirin as the first line of treatment of CHC. The recommended duration of treatment of CHC in patients not infected with HIV is 24 weeks (for hepatitis C virus [HCV] genotype 2 or 3) or 48 weeks (for HCV genotype 1).

tion for the Study of Liver Diseases130 recommends once-weekly SC peginterferon-α combined with oral ribavirin as the first line of treatment of CHC. The recommended duration of treatment of CHC in patients not infected with HIV is 24 weeks (for hepatitis C virus [HCV] genotype 2 or 3) or 48 weeks (for HCV genotype 1). For patients coinfected with HIV and HCV, the rate of intolerance to a combination regimen of IFN-α and ribavirin is higher and the rate of sustained virologic response (SVR) lower than in patients infected with HCV alone.131-133 Use of peginterferon-α resulted in a higher SVR rate than use of IFN-α.131,133 The APRICOT study reported an SVR rate of 40% for patients treated with peginterferon-α plus ribavirin, compared with 20% for those treated with peginterferon-α monotherapy, and 12% for those treated with IFN-α plus ribavirin.132 A lower SVR rate to combination peginterferon-α plus ribavirin therapy was observed in patients coinfected with HCV genotype 1 (29%) than with HCV genotypes 2 and 3 (62%).132,133 Guidelines for the management of HIV and HCV coinfection have been published recently.130 In general, the guidelines recommend combination therapy with peginterferon-α and ribavirin for 48 weeks.

ibavirin therapy was observed in patients coinfected with HCV genotype 1 (29%) than with HCV genotypes 2 and 3 (62%).132,133 Guidelines for the management of HIV and HCV coinfection have been published recently.130 In general, the guidelines recommend combination therapy with peginterferon-α and ribavirin for 48 weeks. Interferons are generally not recommended in acute viral hepatitis, but treatment of acute HCV with IFN-α has resulted in a more rapid resolution of viremia and reduced progression to chronic hepatitis.134,135 The American Association for the Study of Liver Diseases recommends either IFN-α or peginterferon-α for at least 6 months for acute HCV if infection persists for 2 to 4 months after diagnosis. Interferons are also approved as intralesional therapy for condyloma acuminatum of genital and perianal areas.136 Intralesional injection ensures relatively high concentrations of IFN at the local site of infection, but occurrence of systemic adverse effects suggests its absorption from this site. Currently, HSV is generally treated with acyclovir, but beneficial responses to topical IFN-α have been reported for genital herpes137 and HSV keratitis.90 Beneficial responses to IFN-α have been reported for HIV-associated progressive multifocal leukoencephalopathy138; however, these findings are debatable because IFN-α may not provide added benefits when used with highly active antiretroviral therapy.139

FN-α have been reported for genital herpes137 and HSV keratitis.90 Beneficial responses to IFN-α have been reported for HIV-associated progressive multifocal leukoencephalopathy138; however, these findings are debatable because IFN-α may not provide added benefits when used with highly active antiretroviral therapy.139 Most patients receiving IFN may develop flulike symptoms, which appear to be dose-related, are more likely to occur at the start of treatment, and typically respond to acetaminophen. Among the more serious adverse effects are neuropsychiatric disorders (eg, depression and homicidal and suicidal ideation), neurologic disturbances (eg, confusion and seizures), myelosuppression (neutropenia [most commonly] and aplastic anemia [rarely]), cardiovascular disorders (eg, arrhythmias), endocrine disorders (eg, thyroid disorders), and pulmonary disorders (eg, dyspnea and pneumonitis).140-142 Patients at risk for developing depression are those with preexisting mood and anxiety disorders, those with a history of major depression, and those receiving higher doses of IFN-α or undergoing long-term treatment regimens. Selective serotonin reuptake inhibitors have been used successfully to treat patients with IFN-associated depression, allowing therapy to be continued,143 and as a pretreatment to prevent its occurrence in high-risk patients.144 Other adverse effects are altered liver function,145 renal insufficiency,146 and gastrointestinal manifestations.147

ake inhibitors have been used successfully to treat patients with IFN-associated depression, allowing therapy to be continued,143 and as a pretreatment to prevent its occurrence in high-risk patients.144 Other adverse effects are altered liver function,145 renal insufficiency,146 and gastrointestinal manifestations.147 Ribavirin Ribavirin, a synthetic nucleoside analogue of guanine, is available in oral, aerosolized, and IV formulations. Oral ribavirin is absorbed extensively, but its bioavailability is only 65% because of first-pass metabolism. Peak plasma ribavirin concentrations occur within 1 to 2 hours after oral dose.148 Peak plasma concentrations increase over time and are 6 times higher after 4 weeks of treatment. Administration of aerosolized ribavirin leads to high concentrations in the respiratory tract, with some ribavirin absorbed systemically. Ribavirin is mainly excreted in the urine.149 The mechanism of action of ribavirin is known to be diverse but is not completely understood. It may be a competitive inhibitor of cellular enzymes because its antiviral activity is reversed by guanosine. Its triphosphorylated form, ribavirin triphosphate, is a potent competitive inhibitor of inosine monophosphate dehydrogenase, influenza virus RNA polymerase, and mRNA guanylyltransferase. As a result of this competitive inhibition, intracellular guanosine triphosphate pools are markedly reduced and viral nucleic acid and protein synthesis are inhibited. Ribavirin does not alter viral attachment, penetration, or uncoating, nor does it induce IFN production.

s RNA polymerase, and mRNA guanylyltransferase. As a result of this competitive inhibition, intracellular guanosine triphosphate pools are markedly reduced and viral nucleic acid and protein synthesis are inhibited. Ribavirin does not alter viral attachment, penetration, or uncoating, nor does it induce IFN production. Ribavirin inhibits multiple viruses in vitro. Among the susceptible DNA viruses are herpesviruses, adenoviruses, and poxviruses. Susceptible RNA viruses include HCV, Lassa virus, influenza, parainfluenza, measles, mumps, RSV, and HIV. However, no correlation has been found between ribavirin’s in vitro activity and its activity against human infections. Oral ribavirin is approved for use, in combination with IFN-α or peginterferon-α, for the treatment of CHC. However, it is not effective when given as monotherapy.150,151 The duration of treatment, and sometimes its dose, may be dictated by HCV genotype. Treatment for infections with HCV genotype 1, and probably with genotype 4, should generally continue for 48 weeks, whereas those with genotype 2 or 3 may be treated for 24 weeks. Treatment of HCV in patients coinfected with HIV should be for 48 weeks.150,151

nt, and sometimes its dose, may be dictated by HCV genotype. Treatment for infections with HCV genotype 1, and probably with genotype 4, should generally continue for 48 weeks, whereas those with genotype 2 or 3 may be treated for 24 weeks. Treatment of HCV in patients coinfected with HIV should be for 48 weeks.150,151 Ribavirin is approved for the treatment of RSV in children, including hematopoietic stem cell transplant recipients. When used for the treatment of RSV pneumonia, ribavirin is usually given by the aerosol route, which delivers high concentrations at the site of infection.152 Oral ribavirin has also been used with good outcomes.153 Ribavirin has been used, off-label, for the treatment of HSV, influenza, severe acute respiratory syndrome coronavirus,154,155 La Crosse encephalitis,156 Nipah encephalitis,157 Lassa fever,158 hemorrhagic fever with renal syndrome,159 Crimean-Congo hemorrhagic fever,160,161 Bolivian hemorrhagic fever,162 and hantavirus pulmonary syndrome.163

, off-label, for the treatment of HSV, influenza, severe acute respiratory syndrome coronavirus,154,155 La Crosse encephalitis,156 Nipah encephalitis,157 Lassa fever,158 hemorrhagic fever with renal syndrome,159 Crimean-Congo hemorrhagic fever,160,161 Bolivian hemorrhagic fever,162 and hantavirus pulmonary syndrome.163 Aerosolized ribavirin can cause sudden deterioration of respiratory function and cardiovascular effects. Precipitation of inhaled ribavirin may occur in ventilatory tubings. Hemolytic anemia occurs commonly,154 and ribavirin should not be given to patients with preexisting medical conditions exacerbated by ribavirin-induced hemolysis, including significant cardiac disease or hemoglobinopathies. Severe depression, suicidal ideation, and relapse of drug abuse may occur, and ribavirin is contraindicated in patients with a history of, or existing, psychiatric disorders. Significant teratogenic and/or embryocidal effects have been observed in animals exposed to ribavirin. Ribavirin is therefore contraindicated in pregnant women and their male partners, and it is recommended that patients use 2 forms of contraception and avoid pregnancy during therapy and for 6 months thereafter.

rders. Significant teratogenic and/or embryocidal effects have been observed in animals exposed to ribavirin. Ribavirin is therefore contraindicated in pregnant women and their male partners, and it is recommended that patients use 2 forms of contraception and avoid pregnancy during therapy and for 6 months thereafter. Nucleos(t)ide Analogues for CHB In addition to IFN, several nucleos(t)ide analogues are available for the treatment of CHB (Table 2). With the exception of telbivudine, these drugs possess anti-HIV properties, serving as inhibitors of the HIV reverse transcriptase inhibitors. The specific mechanism of their anti-HBV property is through competitive inhibition of HBV DNA polymerase. Because of their anti-HIV properties, it is highly recommended that CHB patients considered for treatment with these drugs be tested for HIV infection, and monotherapy with these drugs should be avoided for HIV-infected patients to reduce the risk of HIV resistance. Hepatitis B virus may also develop resistance to these drugs, usually after prolonged exposure, and this risk may be reduced by a strategy of combination antiviral therapies. The exact duration of anti-HBV treatment is not defined, and HBV relapse often occurs after discontinuation of treatment. Severe exacerbation of hepatitis may also occur on discontinuation of these drugs; hence, monitoring for hepatotoxicity should be performed after stopping treatment. Lactic acidosis may occur with nucleos(t)ide analogues, and the drugs should be withdrawn if there is a rapid increase in ALT levels, progressive hepatomegaly or steatosis, or acidosis.

s may also occur on discontinuation of these drugs; hence, monitoring for hepatotoxicity should be performed after stopping treatment. Lactic acidosis may occur with nucleos(t)ide analogues, and the drugs should be withdrawn if there is a rapid increase in ALT levels, progressive hepatomegaly or steatosis, or acidosis. Adefovir. Adefovir dipivoxil is an acyclic nucleotide analogue of adenosine monophosphate.164 Oral adefovir dipivoxil is rapidly absorbed and converted to adefovir. Its oral bioavailability is about 59%. Excretion of the drug is by glomerular filtration and active tubular secretion. TABLE 2. Antiviral Nucleos(t)ides for the Treatment of Chronic Hepatitis Ba Adefovir is converted intracellularly by cellular kinases to its active metabolite, adefovir diphosphate, which competitively inhibits HBV DNA polymerase.165 Although adefovir has the distinction of being the least potent among currently available anti-HBV drugs, it has been used in adults with decompensated liver disease, or with compensated liver disease with evidence of active viral replication, persistently elevated ALT levels, and histologic evidence of active inflammation and fibrosis.164

the distinction of being the least potent among currently available anti-HBV drugs, it has been used in adults with decompensated liver disease, or with compensated liver disease with evidence of active viral replication, persistently elevated ALT levels, and histologic evidence of active inflammation and fibrosis.164 The major adverse effect of adefovir is nephrotoxicity, including proximal renal tubular dysfunction and Fanconi syndrome. Gastrointestinal symptoms, such as nausea, diarrhea, and abdominal pain, may be observed. Adefovir resistance, characterized by the rtN236T mutation, gradually increases over time to 11%, 18%, and 29% at year 3, 4, and 5, respectively.166-169 To minimize the risk of resistance, adefovir is used in combination with other drugs such as lamivudine.165 However, concomitant use with the related drug tenofovir disoproxil fumarate is not recommended because of the augmented risk of nephrotoxicity.

time to 11%, 18%, and 29% at year 3, 4, and 5, respectively.166-169 To minimize the risk of resistance, adefovir is used in combination with other drugs such as lamivudine.165 However, concomitant use with the related drug tenofovir disoproxil fumarate is not recommended because of the augmented risk of nephrotoxicity. Emtricitabine. Emtricitabine is an analogue of cytidine. Although not currently approved for the treatment of CHB, emtricitabine has been used clinically in combination with tenofovir in HIV/HBV–coinfected patients. Emtricitabine is very similar to lamivudine, and cross-resistance between these drugs is common. Emtricitabine may be more potent than lamivudine; however, it should not be used as monotherapy because of high rates of resistance development.170 The rate of emtricitabine resistance among patients with HBV monoinfection is 18% at 96 weeks.170 Adverse effects are reportedly uncommon and include mild to moderate headache, nausea, diarrhea, and rash.170 Entecavir. Entecavir, a nucleoside guanosine analogue,171 is considered one of the most potent agents for the treatment of patients with CHB, including those resistant to lamivudine.172 Oral entecavir is extensively absorbed: peak plasma concentrations occur in 30 to 90 minutes, and oral bioavailability is almost 100%. Despite low plasma concentrations, entecavir maintains its potency by the long intracellular half-life of its active metabolite entecavir triphosphate. Entecavir is mainly excreted by glomerular filtration and active tubular secretion.

a concentrations occur in 30 to 90 minutes, and oral bioavailability is almost 100%. Despite low plasma concentrations, entecavir maintains its potency by the long intracellular half-life of its active metabolite entecavir triphosphate. Entecavir is mainly excreted by glomerular filtration and active tubular secretion. The mechanism of action of entecavir is somewhat unique because it inhibits 3 specific functions of the HBV DNA polymerase: priming of the HBV DNA polymerase, reverse transcription of the negative strand from the pregenomic mRNA, and synthesis of positive-strand HBV DNA.172 Entecavir is approved for the treatment of CHB, at a dose of 0.5 mg orally once daily for nucleoside treatment–naive patients, and a dose of 1 mg orally once daily for patients with a history of HBV viremia while receiving lamivudine, those with lamivudine- or telbivudine-resistant mutations, and those with decompensated liver disease.173 In randomized trials of HBeAg-positive and HBeAg-negative patients, entecavir demonstrated better outcomes than lamivudine, with improvement in histologic responses, higher percentages of HBV DNA suppression, and normalization or improvement of ALT levels.

stant mutations, and those with decompensated liver disease.173 In randomized trials of HBeAg-positive and HBeAg-negative patients, entecavir demonstrated better outcomes than lamivudine, with improvement in histologic responses, higher percentages of HBV DNA suppression, and normalization or improvement of ALT levels. Adverse effects of entecavir are generally mild and include headache, fatigue, nausea, diarrhea, and insomnia. Entecavir has a high barrier to resistance and requires at least 3 mutations for phenotypic resistance. Entecavir resistance requires a baseline rtM204V/I and rtL180M mutation plus either rtT184S/A/I/L, rtS202G/C, or rtM250L. Among nucleoside-naive patients, the rate of entecavir resistance is less than 1% after 5 years, but patients with preexisting rtM204V/I have a higher rate of entecavir resistance (51%) after 5 years.173 Lamivudine. Lamivudine is a nucleoside analogue of cytosine. Oral lamivudine provides bioavailability of about 85%, and peak serum concentrations occur in 1.0 to 1.5 hours. Hepatic metabolism is low, and up to 70% is excreted unchanged by the kidneys.174 Lamivudine is phosphorylated intracellularly into its active 5′-triphosphate metabolite, lamivudine triphosphate. When the active metabolite is incorporated into viral DNA by HBV polymerase, it results in DNA chain termination.

Lamivudine. Lamivudine is a nucleoside analogue of cytosine. Oral lamivudine provides bioavailability of about 85%, and peak serum concentrations occur in 1.0 to 1.5 hours. Hepatic metabolism is low, and up to 70% is excreted unchanged by the kidneys.174 Lamivudine is phosphorylated intracellularly into its active 5′-triphosphate metabolite, lamivudine triphosphate. When the active metabolite is incorporated into viral DNA by HBV polymerase, it results in DNA chain termination. Lamivudine was the first drug to be used as an alter native to IFN-α for the treatment of CHB.175,176 In a double-blind study involving about 350 patients with CHB, lamivudine was associated with substantial histologic improvement, HBeAg antibody seroconversion, and ALT normalization.177 However, relapses are common once treatment is discontinued.178 The adverse effects of lamivudine are mild and include abdominal pain, nausea, and headache. The clinical utility of lamivudine is limited by the rapid development of antiviral resistance. Lamivudine shares with the L-nucleosides the primary resistance mutation, rtM204V/I, which occurs easily and confers cross-resistance. After 4 years of lamivudine monotherapy, rtM204V/I resistance develops in up to 70% and 90% of patients with HBV monoinfection and HIV/HBV coinfection, respectively.

tiviral resistance. Lamivudine shares with the L-nucleosides the primary resistance mutation, rtM204V/I, which occurs easily and confers cross-resistance. After 4 years of lamivudine monotherapy, rtM204V/I resistance develops in up to 70% and 90% of patients with HBV monoinfection and HIV/HBV coinfection, respectively. Telbivudine. Telbivudine is a synthetic thymidine nucleoside analogue. Unlike other anti-HBV drugs, telbivudine has no activity against HIV. Oral telbivudine is well absorbed and achieves peak plasma concentrations after about 3 hours. It is mainly excreted by glomerular filtration, with a terminal elimination half-life of 30 to 50 hours.179 Telbivudine-triphosphate inhibits HBV by competitive inhibition of viral DNA polymerase. Oral telbivudine is approved for the treatment of CHB in patients with compensated liver disease and evidence of active viral replication, persistently increased serum ALT concentrations, and histologic evidence of active liver inflammation and fibrosis.180,181 It is considered more effective than lamivudine and adefovir.182,183 Compared with lamivudine, telbivudine was associated with a higher degree of reduction in HBV DNA levels; however, no significant differences were found in ALT level normalization, loss of HBeAg, or anti-HBe seroconversion.

mation and fibrosis.180,181 It is considered more effective than lamivudine and adefovir.182,183 Compared with lamivudine, telbivudine was associated with a higher degree of reduction in HBV DNA levels; however, no significant differences were found in ALT level normalization, loss of HBeAg, or anti-HBe seroconversion. The most common adverse effects reported for telbivudine are dizziness, fatigue, gastrointestinal symptoms, and rash. Unique adverse effects are peripheral neuropathy and myopathy with elevation in creatine kinase levels. Telbivudine treatment should be discontinued if either peripheral neuropathy or myopathy is diagnosed. The rate of resistance to telbivudine is 25% after 96 weeks of treatment. Tenofovir. Tenofovir disoproxil fumarate, an acyclic nucleoside phosphonate diester analogue of adenosine monophosphate, is considered one of the most potent anti-HBV drugs. In oral form, it is rapidly absorbed and converted to tenofovir, reaching peak plasma concentrations in 1 to 2 hours.184 Oral bioavailability, which is only 25% in the fasting state, can be enhanced when taken with a high-fat meal. The terminal elimination half-life of tenofovir is 12 to 18 hours, and it is excreted mainly by active tubular secretion and glomerular filtration.184 Tenofovir disoproxil fumarate is a prodrug that requires diester hydrolysis for conversion to tenofovir. Subsequent phosphorylation by cellular enzymes forms tenofovir diphosphate, which competes with the natural substrate deoxyadenosine 5′-triphosphate for incorporation into the viral DNA strand.

Tenofovir. Tenofovir disoproxil fumarate, an acyclic nucleoside phosphonate diester analogue of adenosine monophosphate, is considered one of the most potent anti-HBV drugs. In oral form, it is rapidly absorbed and converted to tenofovir, reaching peak plasma concentrations in 1 to 2 hours.184 Oral bioavailability, which is only 25% in the fasting state, can be enhanced when taken with a high-fat meal. The terminal elimination half-life of tenofovir is 12 to 18 hours, and it is excreted mainly by active tubular secretion and glomerular filtration.184 Tenofovir disoproxil fumarate is a prodrug that requires diester hydrolysis for conversion to tenofovir. Subsequent phosphorylation by cellular enzymes forms tenofovir diphosphate, which competes with the natural substrate deoxyadenosine 5′-triphosphate for incorporation into the viral DNA strand. Tenofovir is used for the treatment of CHB. In a randomized trial comparing tenofovir and adefovir, a higher percentage of patients receiving tenofovir achieved HBV DNA level suppression. In HBeAg-positive patients, the biochemical response was higher with tenofovir; however, the anti-HBe seroconversion rates and histologic responses were similar for adefovir and tenofovir.185-188 The adverse effects of tenofovir include gastrointestinal symptoms, dizziness, fatigue, and headache. Renal toxicities, including nephritis, proximal renal tubulopathy (including Fanconi syndrome), and renal failure, have been associated with tenofovir.189-193

Tenofovir is used for the treatment of CHB. In a randomized trial comparing tenofovir and adefovir, a higher percentage of patients receiving tenofovir achieved HBV DNA level suppression. In HBeAg-positive patients, the biochemical response was higher with tenofovir; however, the anti-HBe seroconversion rates and histologic responses were similar for adefovir and tenofovir.185-188 The adverse effects of tenofovir include gastrointestinal symptoms, dizziness, fatigue, and headache. Renal toxicities, including nephritis, proximal renal tubulopathy (including Fanconi syndrome), and renal failure, have been associated with tenofovir.189-193 Primary tenofovir resistance mutations have not been well defined. Although viruses with rtN236T are not resistant to tenofovir, they have a slower response than do wild-type viruses. One study reported rtA194T as a tenofovir resistance mutation; however, this pattern was not confirmed in other studies.

The adverse effects of tenofovir include gastrointestinal symptoms, dizziness, fatigue, and headache. Renal toxicities, including nephritis, proximal renal tubulopathy (including Fanconi syndrome), and renal failure, have been associated with tenofovir.189-193 Primary tenofovir resistance mutations have not been well defined. Although viruses with rtN236T are not resistant to tenofovir, they have a slower response than do wild-type viruses. One study reported rtA194T as a tenofovir resistance mutation; however, this pattern was not confirmed in other studies. Protease Inhibitors for the Treatment of CHC The current standard treatment of CHC is peginterferon-α in combination with ribavirin for 24 weeks (for HCV genotype 2 or 3) or 48 weeks (for HCV genotype 1). The major aim of treatment is to achieve SVR, which is defined as undetectable HCV RNA at 24 weeks after completion of treatment. A combination regimen of peginterferon-α and ribavirin results in SVR rates between 38% and 46%, and the rate is even lower among black patients. Hence, major efforts have been made to develop novel therapies for CHC. Recently, 2 serine protease inhibitors were approved as novel therapies for CHC due to genotype 1 infection. The addition of serine protease inhibitors to the backbone therapies of peginterferon-α and ribavirin will emerge as the standard of care for the HCV genotype 1 infection, both in treatment-naive and treatment-experienced patients.

rotease inhibitors were approved as novel therapies for CHC due to genotype 1 infection. The addition of serine protease inhibitors to the backbone therapies of peginterferon-α and ribavirin will emerge as the standard of care for the HCV genotype 1 infection, both in treatment-naive and treatment-experienced patients. Boceprevir. Boceprevir is a linear peptidomimetic ketoamide serine protease inhibitor that was recently approved for the treatment of CHC, particularly for genotype 1.194 It is available in oral formulation, and the time to peak concentration after oral administration is 2 hours. Food enhances its absorption. Boceprevir is metabolized primarily in the liver. It has an elimination half-life of 3 hours and is excreted mostly in the feces.194 Boceprevir exerts anti-HCV properties by binding reversibly to the HCV nonstructural 3 protein, ultimately inhibiting viral replication. In a recently conducted phase 3 international randomized placebo-controlled trial that enrolled previously untreated black and nonblack adults with HCV genotype 1 infection (SPRINT-2 [serine protease inhibitor therapy 2] trial), the addition of boceprevir for 22 weeks or 44 weeks to standard therapy (peginterferon-α-2b and ribavirin) resulted in significantly higher SVR rates compared with standard therapy alone for the nonblack cohort (67% and 68% vs 40%, respectively) and the black cohort (42% and 53% vs 23%, respectively).195 The relative increases in SVR rates for the nonblack cohort were 68% and 70%, respectively, compared with the standard therapy.195

in significantly higher SVR rates compared with standard therapy alone for the nonblack cohort (67% and 68% vs 40%, respectively) and the black cohort (42% and 53% vs 23%, respectively).195 The relative increases in SVR rates for the nonblack cohort were 68% and 70%, respectively, compared with the standard therapy.195 The HCV RESPOND-2 (Retreatment with HCV Serine Protease Inhibitor Boceprevir and PegIntron/Rebetol 2) trial evaluated boceprevir for the treatment of patients who had experienced a relapse or who had not achieved SVR to peginterferon-ribavirin treatment.196 In this randomized open-label trial that enrolled 403 patients, the SVR rates were significantly higher for patients who received peginterferon-ribavirin plus boceprevir treatment for 32 weeks (59%) or 44 weeks (66%) compared with standard peginterferon-ribavirin treatment alone (21%).196 In a multivariable stepwise logistic regression analysis, the baseline factors associated with SVR were boceprevir use, previous relapse (compared with previous nonresponder), low viral load at baseline, and absence of cirrhosis.196

44 weeks (66%) compared with standard peginterferon-ribavirin treatment alone (21%).196 In a multivariable stepwise logistic regression analysis, the baseline factors associated with SVR were boceprevir use, previous relapse (compared with previous nonresponder), low viral load at baseline, and absence of cirrhosis.196 Boceprevir (800 mg 3 times daily) was approved by the FDA as the first HCV protease inhibitor for the treatment of CHC, specifically for genotype 1; it should be combined with peginterferon and ribavirin. The most common adverse effects of boceprevir are flulike illness, fatigue, nausea, dysgeusia, and anemia.194 The addition of boceprevir nearly doubled the rate of anemia compared with the use of standard peginterferon and ribavirin therapy, with many patients requiring the use of erythropoietin.195 Telaprevir. Telaprevir is an orally available inhibitor specific to the HCV nonstructural 3/4A serine protease.197 It inhibits HCV replication by binding reversibly to nonstructural 3 serine protease. After oral administration, telaprevir achieves peak plasma concentrations in 4 to 5 hours. It is metabolized primarily in the liver and it has an elimination half-life of 4 to 5 hours. Most of the drug is excreted in the feces.

se.197 It inhibits HCV replication by binding reversibly to nonstructural 3 serine protease. After oral administration, telaprevir achieves peak plasma concentrations in 4 to 5 hours. It is metabolized primarily in the liver and it has an elimination half-life of 4 to 5 hours. Most of the drug is excreted in the feces. Early-phase studies demonstrated the potent anti-HCV properties of telaprevir.198-200 In a recent phase 3 international randomized double-blind placebo-controlled clinical trial, the addition of telaprevir to the standard treatment of peginterferon-ribavirin was associated with significantly higher SVR rates compared with standard peginterferon-ribavirin alone in a cohort of 1088 patients with previously untreated HCV genotype 1 infections.201 Specifically, the group of patients who received 12 weeks of telaprevir combined with peginterferon-ribavirin, followed by peginterferon-ribavirin for 12 weeks (if HCV RNA was undetectable at weeks 4 and 12) or 36 weeks (if HCV RNA was still detectable at weeks 4 and 12), had SVR rates of 75% vs 44% with standard therapy.201 The SVR rates were also significantly higher compared with standard therapy among patients who received only 8 weeks of telaprevir combined with peginterferon-ribavirin (69% vs 44%).201 In the second randomized phase 3 trial that evaluated telaprevir in treatment-experienced patients with HCV genotype 1 infection, the addition of telaprevir to the standard treatment regimen of peginterferon-α and ribavirin was associated with significantly higher SVR rates compared with the standard regimen of peginterferon-ribavirin alone.202

hase 3 trial that evaluated telaprevir in treatment-experienced patients with HCV genotype 1 infection, the addition of telaprevir to the standard treatment regimen of peginterferon-α and ribavirin was associated with significantly higher SVR rates compared with the standard regimen of peginterferon-ribavirin alone.202 Collectively, these studies indicate that the addition of telaprevir to standard peginterferon-ribavirin therapy can significantly improve SVR rates in treatment-naive patients infected with HCV genotype 1 and in those who did not benefit from initial treatment with peginterferon-α-2a and ribavirin. As a result of these findings, the FDA approved telaprevir (750 mg 3 times daily) for this treatment indication. The most common adverse effects are anemia, neutropenia, leukopenia, and rash.201 In one study, 41% to 60% of patients reported some kind of rash.199 Rashes can be mild to severe, and Stevens-Johnson syndrome and drug rash with eosinophilia and systemic symptoms have been reported. Telaprevir therapy should be discontinued if these dermatologic complications occur, especially in cases of severe rash or even mild to moderate rash if accompanied by systemic symptoms. The mechanism underlying rash development is unknown.199 Fatigue, pruritus, and gastrointestinal sympotoms (eg, nausea, diarrhea, and taste disturbance) may also be observed.199

these dermatologic complications occur, especially in cases of severe rash or even mild to moderate rash if accompanied by systemic symptoms. The mechanism underlying rash development is unknown.199 Fatigue, pruritus, and gastrointestinal sympotoms (eg, nausea, diarrhea, and taste disturbance) may also be observed.199 CONCLUSION This review has highlighted the pharmacokinetics, mechanisms of action, clinical indications, and adverse effects of clinically available drugs for the management of viruses other than HIV. The currently available antiviral drugs target 3 main groups of viruses: herpes, hepatitis, and influenza viruses. The antiviral therapeutic armamentarium has evolved over the years and is rapidly expanding. Some of the “old” antiviral drugs retain their clinical utility for most infections, such as acyclovir for herpes simplex virus and ganciclovir for CMV. However, other of these “old” antiviral drugs (eg, amantadine and rimantadine for influenza virus infections) have lost their clinical utility because of the rapid and widespread development of resistance. This serves as a catalyst for the development of novel therapies and, more importantly, should urge the medical community to use these drugs optimally in the clinical setting. Indeed, increased resistance has been observed to the neuraminidase inhibitors for the treatment of influenza viruses and the nucleos(t)ide analogues for the treatment of CHB. As novel therapies develop (eg, the serine protease inhibitors for the treatment of CHC), care must be taken to optimize their use so that the clinical life span of these drugs is not abbreviated by the development of resistance.

e treatment of influenza viruses and the nucleos(t)ide analogues for the treatment of CHB. As novel therapies develop (eg, the serine protease inhibitors for the treatment of CHC), care must be taken to optimize their use so that the clinical life span of these drugs is not abbreviated by the development of resistance. Supplementary Material CME Test The author has no conflicts of interest to declare. On completion of this article, you should be able to (1) discuss the different regimens for the prevention and treatment of human herpesviruses; (2) discuss options for the prevention and treatment of influenza virus, including infections with resistant strains; and (3) discuss antiviral drugs for the treatment of chronic hepatitis B and C infections, including novel nucleos(t)ide analogues and serine protease inhibitors, respectively.

A cluster of cases of pneumonia caused by a novel coronavirus, COVID-19, was first reported in Wuhan in the Hubei province in China in late December 2019. Since then, several thousand cases have been reported in mainland China, with spread to over two dozen countries. Although many comparisons to other coronavirus epidemics have been made, the potential impact of this coronavirus is uncertain. We seek to summarize what is known about COVID-19, compare this epidemic to prior coronavirus outbreaks, and provide a primer on novel coronaviruses for practicing clinicians. Coronaviruses are widespread among mammals and birds. The widest varieties of genotypes infect bats, but 2 subtypes infect humans: alpha and beta coronaviruses.1 Beta coronaviruses include severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), and the coronavirus variant COVID-19 virus first described in Wuhan. In humans, these coronaviruses have short incubation periods, ranging from days for SARS-CoV and weeks for MERS-CoV, with the COVID-19 appearing to fall in between the two.2 , 3 Although information about the COVID-19 is emerging, SARS-CoV and MERS-CoV provide some context for understanding the public health significance of coronaviruses.

onaviruses have short incubation periods, ranging from days for SARS-CoV and weeks for MERS-CoV, with the COVID-19 appearing to fall in between the two.2 , 3 Although information about the COVID-19 is emerging, SARS-CoV and MERS-CoV provide some context for understanding the public health significance of coronaviruses. SARS- CoV SARS-CoV was first noted in the Guangdong province of China in November 2002.4 , 5 The index case was a physician from that province who then traveled to Hong Kong and infected several others. Subsequently, SARS-CoV resulted in over 8000 cases and approximately 750 deaths occurred worldwide over the next several months. The outbreak finally ended in July 2003.4, 5, 6 Severe acute respiratory syndrome coronavirus typically presented with fever and symptoms of lower respiratory tract infection with radiographic evidence of pneumonia or acute respiratory distress syndrome (ARDS). SARS-CoV disproportionately impacted health care workers (HCWs) in countries with the most reported cases. However, in countries with relatively few cases, transmission was much rarer. This finding suggests that infection control measures are adequate to interrupt transmission to HCWs, but consistency is critical because the greater number of opportunities for lapses in the hardest hit centers likely led to more HCW infections.7

er, in countries with relatively few cases, transmission was much rarer. This finding suggests that infection control measures are adequate to interrupt transmission to HCWs, but consistency is critical because the greater number of opportunities for lapses in the hardest hit centers likely led to more HCW infections.7 The incubation period of SARS-CoV is between 2 and 10 days.8 Diagnosis is based on polymerase chain reaction testing. Treatments attempted included corticosteroids and ribavirin, which were not found to be beneficial. Supportive care remains the cornerstone of care for SARS-CoV, although in vitro studies suggest that antivirals developed in the wake of the Ebola virus epidemic may inhibit SARS-CoV replication as well.9 MERS-CoV MERS-CoV was first reported in September 2012.10 The virus was isolated from sputum of a man in Saudi Arabia hospitalized with a respiratory tract infection.10 Since then, more than 2400 cases of MERS-CoV have been reported to the World Health Organization (WHO) in and around the Arabian Peninsula.11 Periodic infections and localized outbreaks have continued. Similar to SARS-CoV, presentation is typically fever with symptoms of lower respiratory tract infection and radiographic evidence of pneumonia or ARDS. Other manifestations might include renal failure, anorexia, nausea, vomiting, diarrhea, abdominal pain, and disseminated intravascular coagulation. Again, HCWs were disproportionately infected, although a large number of those cases were mild or asymptomatic.7

t infection and radiographic evidence of pneumonia or ARDS. Other manifestations might include renal failure, anorexia, nausea, vomiting, diarrhea, abdominal pain, and disseminated intravascular coagulation. Again, HCWs were disproportionately infected, although a large number of those cases were mild or asymptomatic.7 The incubation period of MERS-CoV ranges from 1 to 14 days. Diagnosis is made by identifying the virus in respiratory samples by polymerase chain reaction testing. Treatment is largely supportive,11 focusing on management of complications of sepsis and ARDS in intensive care units. Antivirals such as ribavirin and interferon-based treatments have had questionable benefit, but the role for these treatments remains experimental.12

atory samples by polymerase chain reaction testing. Treatment is largely supportive,11 focusing on management of complications of sepsis and ARDS in intensive care units. Antivirals such as ribavirin and interferon-based treatments have had questionable benefit, but the role for these treatments remains experimental.12 COVID-19 Epidemiology Most recently, a novel strain of the coronavirus, COVID-19, was identified in Wuhan, a city in the Hubei province of China.3 Initial cases were associated with a seafood market that also sold live animals.2 The seafood market was shut down and disinfected to contain what was thought to be a zoonotic infection, ie, one that is transmitted from animals to humans. Despite this intervention, the reported number of persons infected increased rapidly, and on January 21, 2020, Chinese health authorities first reported human-to-human transmission including transmission to HCWs. Since then, case counts have been increasing rapidly.13 Cases have now been reported outside mainland China, with the spread of cases internationally to several countries in Asia, Europe, North America, and to Australia. Person to person transmission has been reported to family members, other close contacts, and to HCWs.

nce then, case counts have been increasing rapidly.13 Cases have now been reported outside mainland China, with the spread of cases internationally to several countries in Asia, Europe, North America, and to Australia. Person to person transmission has been reported to family members, other close contacts, and to HCWs. Clinical Features Initial reports suggest an incubation period similar to the incubation period of SARS-CoV and MERS-CoV.2 The clinical features are also rather similar to these viruses: fever, cough, chest tightness, dyspnea, and difficulty breathing.14 , 15 Severe cases with ARDS have been reported, with this being a leading reason for admission to the intensive care unit.2 Gastrointestinal symptoms have been reported in 10% of cases, a higher proportion than seen with other coronaviruses. The novel coronavirus also is associated with fewer upper respiratory tract symptoms and lower respiratory symptoms than other coronaviruses.14 Fever is a prominent symptom, present in 98.6% of cases.16 Between 20% and 25% require intensive care unit admission. Patients admitted to ICU had higher serum white blood cell counts, lower serum albumin, liver function test disorders, and higher D-dimer.14 Significantly, severe cases appear to cluster in the elderly, and thus far, severe disease has not been widely reported in children.16

d 25% require intensive care unit admission. Patients admitted to ICU had higher serum white blood cell counts, lower serum albumin, liver function test disorders, and higher D-dimer.14 Significantly, severe cases appear to cluster in the elderly, and thus far, severe disease has not been widely reported in children.16 The Centers for Disease Control and Prevention (CDC) has issued interim guidance for HCWs.17 Novel coronavirus should be suspected if patients meet the criteria described in Table 1 . The WHO uses similar criteria for case identification.Table 1 COVID-19 Diagnosis Criteria to Serve as Guidance for Evaluation COVID-19 Clinical features COVID-19 Epidemiological risk Fever AND symptoms of lower respiratory tract illness including, but not limited to, cough, difficulty breathing → AND any one of the following: (a) In the past 14 days (before symptom onset), a history of travel from Wuhan City, China OR (b) In the past 14 days (before symptom onset), close contact with a person who is under investigation for COVID-19 while that person was ill Fever OR symptoms of lower respiratory tract illness including, but not limited to, cough, difficulty breathing → AND In the past 14 days (before symptom onset), close contact with an ill patient with laboratory-confirmed COVID-19 COVID-19 = 2019 novel coronavirus. Adapted from the Centers for Disease Control and Prevention.16

COVID-19 Clinical features COVID-19 Epidemiological risk Fever AND symptoms of lower respiratory tract illness including, but not limited to, cough, difficulty breathing → AND any one of the following: (a) In the past 14 days (before symptom onset), a history of travel from Wuhan City, China OR (b) In the past 14 days (before symptom onset), close contact with a person who is under investigation for COVID-19 while that person was ill Fever OR symptoms of lower respiratory tract illness including, but not limited to, cough, difficulty breathing → AND In the past 14 days (before symptom onset), close contact with an ill patient with laboratory-confirmed COVID-19 COVID-19 = 2019 novel coronavirus. Adapted from the Centers for Disease Control and Prevention.16 Approach to a Suspected Case and Diagnosis The current approach includes early diagnosis and identification, prevention of spread, and management of complications.18 Optimal supportive care with appropriate isolation and infection control precautions are cornerstones of treatment. Health care professionals who encounter suspected cases should contact local infection control and public health offices regarding potential cases and appropriate next steps based on regional resources and protocols.

ortive care with appropriate isolation and infection control precautions are cornerstones of treatment. Health care professionals who encounter suspected cases should contact local infection control and public health offices regarding potential cases and appropriate next steps based on regional resources and protocols. Many unknowns remain regarding COVID-19. The exact mode of transmission has not been established. It appears that most transmission occurs by droplet spread, ie, large droplets that are generated when a patient coughs or sneezes. Protection against this type of transmission involves use of face masks with eye protection, gloves, gowns, and hand hygiene. There is concern that airborne transmission may also be playing a role. This possibility is more problematic because airborne infectious particles can remain suspended in the air for long periods, the infection can be transmitted to larger numbers of people including those not in close contact with the index case, and protective measures include wearing a respirator and patient placement in negative air pressure rooms that may not be available at all medical centers. At the present time, the CDC recommends a combination of airborne precautions (patient placement in a negative air pressure room, HCWs to wear respirators), contact precautions (HCWs to wear gloves and gowns for all patient contact), and use of eye protection for patients hospitalized with suspected COVID-19 infection.

At the present time, the CDC recommends a combination of airborne precautions (patient placement in a negative air pressure room, HCWs to wear respirators), contact precautions (HCWs to wear gloves and gowns for all patient contact), and use of eye protection for patients hospitalized with suspected COVID-19 infection. An initial report suggested transmission from an asymptomatic individual to several other people who attended business meetings with the index case. This has since been reported to be inaccurate.19 Table 2 presents a comparison of clinical symptoms of the 3 coronavirus strains that have caused worldwide outbreaks. As more cases are identified, the epidemiology and clinical characteristics of this disease will be better elucidated.Table 2 Comparison of Clinical Symptoms and Public Health Characteristics of 3 Coronavirus Strains

ts a comparison of clinical symptoms of the 3 coronavirus strains that have caused worldwide outbreaks. As more cases are identified, the epidemiology and clinical characteristics of this disease will be better elucidated.Table 2 Comparison of Clinical Symptoms and Public Health Characteristics of 3 Coronavirus Strains Characteristic SARS-CoV (2002-2003) MERS-CoV (2012-2013) COVID-19 (2019-2020) Clinical presentation (1) Fever (1) Pneumonia (1) Fever, cough, dyspnea (2) Symptoms of lower respiratory tract infection (cough, dyspnea, difficulty breathing) (2) Renal injury (2) Radiologic evidence of pneumonia (3) Radiologic evidence of pneumonia or ARDS (3) ARDS (3) ARDS (4) Diarrhea (5) Vomiting Incubation period 2-10 d 1-14 d 5-7 d (per initial reports) Geographic location China Arabian Peninsula Australia Hong Kong United States (2 imported cases) Belgium Canada South Korea (MERS-CoV outbreak in 2015) Cambodia Singapore Canada Vietnam China (including Hong Kong and Macau) Finland France Germany India Italy Japan Malaysia Nepal Nepal Singapore South Korea Spain Sri Lanka Sweden Taiwan Thailand United Arab Emirates United Kingdom United States Vietnam Cases 8096 2468 37,592a Case fatality rate 14%-15%20 35%12 2.2%a ARDS = acute respiratory distress syndrome; MERS-CoV = Middle East respiratory syndrome coronavirus; COVID-19 = 2019 novel coronavirus; SARS-CoV = severe acute respiratory syndrome coronavirus. a As of February 9, 2020.

Characteristic SARS-CoV (2002-2003) MERS-CoV (2012-2013) COVID-19 (2019-2020) Clinical presentation (1) Fever (1) Pneumonia (1) Fever, cough, dyspnea (2) Symptoms of lower respiratory tract infection (cough, dyspnea, difficulty breathing) (2) Renal injury (2) Radiologic evidence of pneumonia (3) Radiologic evidence of pneumonia or ARDS (3) ARDS (3) ARDS (4) Diarrhea (5) Vomiting Incubation period 2-10 d 1-14 d 5-7 d (per initial reports) Geographic location China Arabian Peninsula Australia Hong Kong United States (2 imported cases) Belgium Canada South Korea (MERS-CoV outbreak in 2015) Cambodia Singapore Canada Vietnam China (including Hong Kong and Macau) Finland France Germany India Italy Japan Malaysia Nepal Nepal Singapore South Korea Spain Sri Lanka Sweden Taiwan Thailand United Arab Emirates United Kingdom United States Vietnam Cases 8096 2468 37,592a Case fatality rate 14%-15%20 35%12 2.2%a ARDS = acute respiratory distress syndrome; MERS-CoV = Middle East respiratory syndrome coronavirus; COVID-19 = 2019 novel coronavirus; SARS-CoV = severe acute respiratory syndrome coronavirus. a As of February 9, 2020. Laboratory Testing The release of the viral genome sequence has made it possible for the CDC to create a rapid molecular diagnostic test for COVID-19. The test received expedited approval from the FDA and the test is being made available to state health departments and selected commercial laboratories. At this time the test is only performed at the CDC but it is likely that the test will be made available at several state health departments in the near feature. The currently available diagnostic tests for other coronaviruses (eg, FilmArray Respiratory Panel [BioFire Diagnostics]) do not detect the COVID-19.

ratories. At this time the test is only performed at the CDC but it is likely that the test will be made available at several state health departments in the near feature. The currently available diagnostic tests for other coronaviruses (eg, FilmArray Respiratory Panel [BioFire Diagnostics]) do not detect the COVID-19. Because of the potential for transmission to laboratory workers from patient specimens, the CDC recommends that laboratory workers use a class 2 biological safety cabinet and personal protective equipment when processing specimens with potential to generate fine particulate matter. Decontamination of work surfaces and equipment with Environmental Protection Agency–registered hospital disinfectant is of paramount importance.21 When transporting suspected case specimens, the International Air Transport Association guidelines for dangerous goods must be followed.21

generate fine particulate matter. Decontamination of work surfaces and equipment with Environmental Protection Agency–registered hospital disinfectant is of paramount importance.21 When transporting suspected case specimens, the International Air Transport Association guidelines for dangerous goods must be followed.21 Response and Public Health Impact Chinese officials closed the fish market initially suspected as the source of the virus on January 1, 2020. On January 20, China confirmed human to human transmission of this virus.22 , 23 On January 23, the Chinese government suspended air, road, and rail travel in the area around Wuhan in an effort to limit the spread outside the city over the Chinese New Year, traditionally a very busy time to travel. In addition, public gatherings for New Year festivities were banned all over the country. Over the next few days, quarantine orders were extended to cover the entire province of Hubei. Despite these stringent measures, case counts continued to rise within China, and several countries including the United States reported imported cases.

ic gatherings for New Year festivities were banned all over the country. Over the next few days, quarantine orders were extended to cover the entire province of Hubei. Despite these stringent measures, case counts continued to rise within China, and several countries including the United States reported imported cases. On January 30, the WHO declared that the COVID-19 outbreak was a public health emergency of international consequence (PHEIC). On January 31, the United States announced that it would bar entry of foreign nationals who had visited China and quarantine United States citizens arriving from China for 14 days. Simultaneously, several major United States airlines suspended flights to mainland China. Since then several other nations have imposed similar travel bans. However, at the time of this writing over 35,000 cases have been confirmed in 28 countries and there have been more than 800 deaths.24, 25, 26 China was initially lauded for its efforts to control the outbreak, including the construction of a 1000 bed medical facility in less than 10 days. More recently, the death of a Chinese physician Li Wenlinag, who was reprimanded by Chinese authorities for sounding the alarm about a cluster of pneumonia in December, has rekindled misgivings about how China is handling the situation.

ak, including the construction of a 1000 bed medical facility in less than 10 days. More recently, the death of a Chinese physician Li Wenlinag, who was reprimanded by Chinese authorities for sounding the alarm about a cluster of pneumonia in December, has rekindled misgivings about how China is handling the situation. At the time of this report, there have been more than 35,000 confirmed cases of COVID-19, with more than 800 confirmed deaths (Figure).27 , 28 Deaths appear to be occurring predominantly in the elderly, with a median age of 75 years in reported cases, but lately, younger patients have died as well. Conclusion The COVID-19 has resulted in a large outbreak of febrile respiratory illness originating in mainland China. There are still many unknowns: mode of transmission, risk factors for infection and mortality, and whether there is a nonhuman reservoir that could cause additional outbreaks. China has taken unprecedented measures to contain the infection by quarantining large cities, imposing bans on mass gatherings, and canceling public events associated with the Chinese New Year. Travel bans imposed by several countries have slowed, but not completely eliminated, the spread outside of China. In addition to the suffering and loss of life, the impact on the global supply chain is likely to be very significant as China as a whole, and Wuhan in particular, are major manufacturing hubs.

se New Year. Travel bans imposed by several countries have slowed, but not completely eliminated, the spread outside of China. In addition to the suffering and loss of life, the impact on the global supply chain is likely to be very significant as China as a whole, and Wuhan in particular, are major manufacturing hubs. There are fears that we are on the verge of a global pandemic. We are better prepared today than we have ever been in the past to limit the spread of infections in health care facilities in the United States. The CDC has provided conservative guidance on infection control measures to be used for a patient with the COVID-19 infection, but this is dependent on early recognition. There are no specific features that distinguish this infection from other respiratory viral infections. Following standard precautions, a set of infection control principles that recommend common sense precautions, including providing a mask to persons with a cough in outpatient settings, promoting hand hygiene, and asking sick individuals to maintain social distancing, are key to controlling rapid spread of the COVID-19 and all respiratory infections in general.Figure Timeline of events since the first report of COVID-19. Potential Competing Interests: Dr Sampathkumar reports consultancy fees from Merck. The other authors report no competing interests.

Severe acute respiratory syndrome (SARS) is the first important new infectious disease of the new millennium. It is now believed that the disease is caused by a novel coronavirus (SARS-CoV). SARS was first recognized as a distinct entity in February 2003 by Dr Carlo Urbani, an epidemiologist with the World Health Organization who was investigating the outbreak in Hanoi, Vietnam. Unfortunately, he himself contracted the disease and died. Since then and up to June 5, 2003, the disease has spread to affect more than 8000 worldwide.1 Although the medical community at large has been aware of this disease for only a few months, considerable progress has been made in understanding the epidemiology and clinical features, and the etiologic agent has been identified.

then and up to June 5, 2003, the disease has spread to affect more than 8000 worldwide.1 Although the medical community at large has been aware of this disease for only a few months, considerable progress has been made in understanding the epidemiology and clinical features, and the etiologic agent has been identified. EPIDEMIOLOGY A highly contagious atypical pneumonia first appeared in the Guangdong Province, People's Republic of China, in November 2002. This was not widely publicized, and the condition remained isolated to China for the next 3 months. On February 21, 2003, a Chinese physician from the Guangdong Province (patient A in Figure 1 ) who cared for patients with pneumonia and had himself developed symptoms traveled to Hong Kong to visit relatives. He stayed on the ninth floor of Hotel M for a day. On February 22, 2003, he was admitted to Hospital 2 with fever and respiratory symptoms and died of respiratory failure on March 4, 2003. He infected 2 of his family members and 4 health care workers (HCWs) in Hospital 2. In addition, 12 other hotel guests at Hotel M developed SARS, 10 of whom (patients B through K) were in the hotel the same day as patient A; the other 2 patients (patients L and M) stayed in the hotel during the time that 3 other symptomatic patients were guests at the hotel. Because of international travel and transmission to HCWs before the institution of protective measures, these patients were responsible for subsequent clusters of SARS around the globe. Patient B was the index patient for the outbreak in Hanoi involving HCWs and close contacts, including Dr Urbani. Patients C, D, and E were the index cases in Singapore. Patients F and G traveled back to Toronto, Canada, which resulted in the cluster of cases in Toronto. Patients H and J caused outbreaks among HCWs in other hospitals in Hong Kong. Patient L appears to have become infected during his stay at Hotel M, with subsequent transmission to his wife, patient M in the United States (Figure 1).Figure 1 Chain of transmission of severe acute respiratory syndrome from the initial patient to other guests at Hotel M in Hong Kong in 2003.

hospitals in Hong Kong. Patient L appears to have become infected during his stay at Hotel M, with subsequent transmission to his wife, patient M in the United States (Figure 1).Figure 1 Chain of transmission of severe acute respiratory syndrome from the initial patient to other guests at Hotel M in Hong Kong in 2003. *All guests except G and K stayed on the ninth floor of the hotel. Guest G stayed on the 14th floor, and guest K stayed on the 11th floor. †Guests L and M (spouses) were not at Hotel M during the same time as index guest A but were at the hotel during the same times as guests G and H and were ill during this period. HCWs = health care workers. From the Centers for Disease Control and Prevention.2

*All guests except G and K stayed on the ninth floor of the hotel. Guest G stayed on the 14th floor, and guest K stayed on the 11th floor. †Guests L and M (spouses) were not at Hotel M during the same time as index guest A but were at the hotel during the same times as guests G and H and were ill during this period. HCWs = health care workers. From the Centers for Disease Control and Prevention.2 Aggressive and unprecedented measures that included quarantine of thousands of people, travel restrictions, and temperature checks at airports have been successful to a large extent in containing the disease. Vietnam reported its last case more than 30 days ago. Singapore used its military forces to assist in contact tracing and enforcement of home quarantine. Through this and other measures, including screening of passengers at airports and seaports, concentration of patients in a single SARS-designated hospital, imposition of a no-visitors rule for all public hospitals, and use of a dedicated private ambulance service to transport all possible cases to the SARS-designated hospital, Singapore may have successfully controlled its outbreak and reported its last case on May 11, 2003. Hong Kong instituted a program of intensive contact tracing and home quarantine of all contacts and has reported a substantial decline in the number of new cases. Authorities in Toronto initially appeared to have controlled their outbreak, but on May 22, Health Canada began to report new clusters of cases of SARS, and since then 70 new cases linked to 4 Toronto hospitals have been reported. Mainland China and Taiwan continue to report new cases, and there is ongoing community transmission, although the daily number of reported new probable cases of SARS has declined from a mean of 166 cases during the first week of May to a mean of 2.5 cases in the first week of June.

Toronto hospitals have been reported. Mainland China and Taiwan continue to report new cases, and there is ongoing community transmission, although the daily number of reported new probable cases of SARS has declined from a mean of 166 cases during the first week of May to a mean of 2.5 cases in the first week of June. Reported cases in all other countries have acquired infection through travel to endemic areas, and only limited local transmission through close contact has occurred. As of June 3, 2003, a total of 372 cases have been reported in the United States (303 suspect and 69 probable cases, no deaths), and almost all the patients acquired infection while traveling overseas. CASE DEFINITION Based on available data, the Centers for Disease Control and Prevention (CDC) defines a suspect case of SARS as a person with onset of fever (temperature >38°C [100.4°F]) and lower respiratory tract symptoms within 10 days of either travel to an area with documented transmission of SARS or close contact with a person believed to have SARS. A probable case is a suspect case who also has chest radiographic findings of pneumonia, acute respiratory distress syndrome (ARDS), or an unexplained respiratory illness resulting in death, with autopsy findings of ARDS without identifiable cause.3 Suspect and probable cases are further classified based on laboratory findings as laboratory positive, laboratory negative, or indeterminate (Table 1 ).Table 1 Centers for Disease Control and Prevention Case Definition for SARS3, 4* Clinical criteria Asymptomatic or mild respiratory illness

CASE DEFINITION Based on available data, the Centers for Disease Control and Prevention (CDC) defines a suspect case of SARS as a person with onset of fever (temperature >38°C [100.4°F]) and lower respiratory tract symptoms within 10 days of either travel to an area with documented transmission of SARS or close contact with a person believed to have SARS. A probable case is a suspect case who also has chest radiographic findings of pneumonia, acute respiratory distress syndrome (ARDS), or an unexplained respiratory illness resulting in death, with autopsy findings of ARDS without identifiable cause.3 Suspect and probable cases are further classified based on laboratory findings as laboratory positive, laboratory negative, or indeterminate (Table 1 ).Table 1 Centers for Disease Control and Prevention Case Definition for SARS3, 4* Clinical criteria Asymptomatic or mild respiratory illness Moderate respiratory illness Temperature >100.4°F (>38°C) and One or more clinical findings of respiratory illness (eg, cough, shortness of breath, difficulty with breathing, or hypoxia) Severe respiratory illness Temperature >100.4°F (>38°C) and One or more clinical findings of respiratory illness (eg, cough, shortness of breath, difficulty with breathing, or hypoxia) AND Radiographic evidence of pneumonia or ARDS or Autopsy findings consistent with pneumonia or ARDS without an identifiable cause Epidemiological criteria Travel (including transit in an airport) within 10 days of onset of symptoms to an area with current or recently documented or suspected community transmission of SARS† OR

AND Radiographic evidence of pneumonia or ARDS or Autopsy findings consistent with pneumonia or ARDS without an identifiable cause Epidemiological criteria Travel (including transit in an airport) within 10 days of onset of symptoms to an area with current or recently documented or suspected community transmission of SARS† OR Close contact within 10 days of onset of symptoms with a person known or suspected to have SARS infection Laboratory criteria Confirmed Detection of antibody to SARS-CoV in specimens obtained during acute illness or >21 days after illness onset or Detection of SARS-CoV RNA by RT-PCR confirmed by a second PCR assay, by using a second aliquot of the specimen and a different set of PCR primers or Isolation of SARS-CoV Negative Absence of antibody to SARS-CoV in convalescent serum obtained >21 days after symptom onset Undetermined Laboratory testing either not performed or incomplete Case classification Probable case Meets the clinical criteria for severe respiratory illness of unknown etiology with onset since November 1, 2002, and epidemiological criteria; laboratory criteria confirmed, negative, or undetermined Suspect case Meets the clinical criteria for moderate respiratory illness of unknown etiology with onset since November 1, 2002, and epidemiological criteria; laboratory criteria confirmed, negative, or undetermined * ARDS = acute respiratory distress syndrome; RT-PCR = reverse-transcriptase polymerase chain reaction; SARS = severe acute respiratory syndrome; SARS-CoV = SARS coronavirus.

Suspect case Meets the clinical criteria for moderate respiratory illness of unknown etiology with onset since November 1, 2002, and epidemiological criteria; laboratory criteria confirmed, negative, or undetermined * ARDS = acute respiratory distress syndrome; RT-PCR = reverse-transcriptase polymerase chain reaction; SARS = severe acute respiratory syndrome; SARS-CoV = SARS coronavirus. † Travel criteria for suspect or probable US cases of SARS. Last date of illness onset for inclusion as a reported case: China (mainland), Hong Kong, Taiwan, Toronto, ongoing; Hanoi, Vietnam, May 25, 2003; Singapore, June 4, 2003. It is important to understand the meaning of close contact. It is defined as having cared for or lived with a person known to have SARS or unprotected contact with body secretions from such a person. This includes kissing, embracing, sharing utensils or bedding, performing a physical examination, or other direct physical contact between persons. It does not include sitting across a waiting room for a brief period, walking by a person with SARS, or other casual contact.

ntact with body secretions from such a person. This includes kissing, embracing, sharing utensils or bedding, performing a physical examination, or other direct physical contact between persons. It does not include sitting across a waiting room for a brief period, walking by a person with SARS, or other casual contact. CLINICAL FEATURES The incubation period is 2 to 10 days. Early manifestations include influenza-like symptoms, such as fever, myalgias, and headache. Fever occurs in virtually all patients and is often the presenting symptom. Often, fever is high and sometimes associated with chills and rigors. Fever may occasionally be absent in elderly persons or may have resolved by the time respiratory symptoms occur. Typically, rash and neurologic findings are absent. Diarrhea has been reported in up to 25% of patients.5, 6, 7 The respiratory phase starts within 2 to 4 days of onset of fever with a dry, nonproductive cough. This may progress to shortness of breath, usually in the second week of the illness, and might be accompanied by or progress to hypoxemia. In 10% to 20% of patients, the respiratory illness is severe enough to require tracheal intubation and mechanical ventilation. The case fatality rate is approximately 3% to 12% overall. The mortality rate may be as high as 45% in patients older than 60 years, particularly those with preexisting comorbidity (eg, diabetes, renal failure, and other chronic medical conditions).8 A concerning feature of this disease has been that young, previously healthy persons, many of them health care professionals, have also died of SARS. The reason for this is unclear but may be due to exposure to patients with higher viral loads or due to their host response. In contrast, SARS has affected relatively few children and appears to be milder in the pediatric age group.9

ously healthy persons, many of them health care professionals, have also died of SARS. The reason for this is unclear but may be due to exposure to patients with higher viral loads or due to their host response. In contrast, SARS has affected relatively few children and appears to be milder in the pediatric age group.9 A biphasic course has been described in many patients, with an initial illness followed by improvement and then subsequent deterioration. This worsening can present as recurrent fever 4 to 7 days after initial defervescence, new chest infiltrates, respiratory failure, or watery diarrhea. In a cohort of 75 patients in Hong Kong, 85% had recurrent symptoms after initial improvement.8 The authors described a triphasic course with fever, myalgia early in week 1, and recurrent fever, hypoxemia, diarrhea, and shifting chest infiltrates in week 2. Twenty percent of patients progressed to ARDS during the third week of the illness. Quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) of nasopharyngeal aspirate in 14 patients with relapse showed peak viral loads occurred at day 10 after onset of symptoms, suggesting that the late deterioration may be due to the host immune response rather than to uncontrolled viral replication.

s. Quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) of nasopharyngeal aspirate in 14 patients with relapse showed peak viral loads occurred at day 10 after onset of symptoms, suggesting that the late deterioration may be due to the host immune response rather than to uncontrolled viral replication. Radiology Chest radiographs of patients with SARS show patchy focal infiltrates or consolidation often with a peripheral distribution, which may progress to diffuse infiltrates. Pleural effusions have not been reported. Early findings may be subtle, and initial findings on chest radiographs may be normal in up to 25% of patients.6 Computed tomography (CT) may be more sensitive than plain films. Highresolution CT scans have shown abnormalities in patients with suspected SARS who have normal findings on plain films.10 The characteristic CT finding is bilateral peripheral airspaceground-glass consolidation mimicking that seen in bronchiolitis obliterans with organizing pneumonia. Laboratory Laboratory findings in patients with SARS include thrombocytopenia and leukopenia (in particular lymphopenia). Elevated creatine kinase, lactate dehydrogenase, and transaminase levels have been noted. A high peak lactate dehydrogenase level and an initial elevated white blood cell count may carry a poor prognosis.7

ory Laboratory findings in patients with SARS include thrombocytopenia and leukopenia (in particular lymphopenia). Elevated creatine kinase, lactate dehydrogenase, and transaminase levels have been noted. A high peak lactate dehydrogenase level and an initial elevated white blood cell count may carry a poor prognosis.7 ETIOLOGY The etiologic link of a coronavirus with the SARS epidemic was established by Peiris et al11 in Hong Kong. Several diagnostic laboratory methods were used to initially recover and then characterize coronavirus infection in various specimens obtained from patients with SARS. These included inoculation and recovery of the virus in cell cultures, characterization of morphologic features by electron microscopy, serologic antibody determination, and molecular amplification and sequencing of the target RNA of the agent. Overall, 45 of the 50 patients these investigators studied had 1 or more laboratory tests (serology, 32; RT-PCR, 22; culture, 2) that supported a coronavirus etiology. The results of this initial report were quickly confirmed and expanded by collaborative studies in several major public health centers and medical institutions throughout the world coordinated by the World Health Organization.12, 13 Molecular sequencing analyses have indicated that the virus is only distantly related to previously sequenced coronaviruses. Based on serologic studies, it appears that this virus has not previously circulated in humans and is now referred to as SARS-CoV.14, 15

world coordinated by the World Health Organization.12, 13 Molecular sequencing analyses have indicated that the virus is only distantly related to previously sequenced coronaviruses. Based on serologic studies, it appears that this virus has not previously circulated in humans and is now referred to as SARS-CoV.14, 15 Coronaviruses are enveloped RNA viruses that cause disease in humans and animals. The previously known human coronaviruses are a major cause of the common cold and can occasionally cause pneumonia. Research teams in Hong Kong and Shenzhen, China, recently detected several coronaviruses closely related genetically to the SARS-CoV in 2 animal species (masked palm civet and raccoon-dog) and antibodies against the SARS-CoV in 1 additional species (Chinese ferret badger). These and other wild animals are traditionally considered delicacies and are sold for human consumption in markets throughout southern China. This study provides the first indication that the SARS-CoV exists outside a human host. Studies are needed to determine how widespread the SARS virus might be in animals in Guangdong and elsewhere and if these animals can excrete the virus in an amount sufficient to infect humans and through what route such transmission occurs.

y provides the first indication that the SARS-CoV exists outside a human host. Studies are needed to determine how widespread the SARS virus might be in animals in Guangdong and elsewhere and if these animals can excrete the virus in an amount sufficient to infect humans and through what route such transmission occurs. TRANSMISSION The SARS-CoV appears to be transmitted primarily by large droplet spread, although surface contamination and possibly airborne spread may play a role. Recent data suggest that the virus may remain viable for considerable periods on a dry surface (up to 24 hours); hence, transmission through fomites may occur. The outbreak in an apartment complex in Hong Kong that accounted for more than 300 cases has been attributed to fecal spread. A patient with SARS who had diarrhea stayed with his brother in this building. It is thought that infection spread from him to other residents in the building through a leaking sewage drain, which allowed aerosolization of virus-containing material. Sewage also backed into bathroom floor drains in some apartments and may have accounted for some of the transmission. The SARS-CoV is stable in feces (and urine) at room temperature for at least 1 to 2 days. The virus is more stable (up to 4 days) in stool from patients with diarrhea (which has a higher pH than normal stool).16

so backed into bathroom floor drains in some apartments and may have accounted for some of the transmission. The SARS-CoV is stable in feces (and urine) at room temperature for at least 1 to 2 days. The virus is more stable (up to 4 days) in stool from patients with diarrhea (which has a higher pH than normal stool).16 It is presently unclear at what stage of the disease viral shedding occurs or whether someone who is infected but asymptomatic can infect others. As our knowledge of SARS and the etiologic coronavirus evolves, we will be able to address these important issues.

so backed into bathroom floor drains in some apartments and may have accounted for some of the transmission. The SARS-CoV is stable in feces (and urine) at room temperature for at least 1 to 2 days. The virus is more stable (up to 4 days) in stool from patients with diarrhea (which has a higher pH than normal stool).16 It is presently unclear at what stage of the disease viral shedding occurs or whether someone who is infected but asymptomatic can infect others. As our knowledge of SARS and the etiologic coronavirus evolves, we will be able to address these important issues. Some close contacts have reported a mild febrile illness without respiratory signs or symptoms, suggesting the illness might not always progress to the respiratory phase; others have not become ill at all. In contrast, “super spreaders” have been described who have infected 10 or more contacts, including HCWs, family and social contacts, or visitors to the health care facilities where patients were hospitalized. A similar phenomenon has been described with some other diseases, such as rubella, laryngeal tuberculosis, and Ebola virus, and might be the result of a combination of host, environment, and virus interactions. In Singapore, 5 super spreaders were responsible for a total of 170 suspect and probable cases of SARS.17 Additional data on the natural history of infection are needed to understand factors that might be associated with this phenomenon. Regardless of whether it is the result of other transmission routes, inadequate infection-control measures, or more viral shedding by certain patients, the fact remains that transmission of the SARS virus is highly efficient in some circumstances.

ded to understand factors that might be associated with this phenomenon. Regardless of whether it is the result of other transmission routes, inadequate infection-control measures, or more viral shedding by certain patients, the fact remains that transmission of the SARS virus is highly efficient in some circumstances. DIAGNOSIS The initial diagnosis of SARS is one of exclusion. Hence, common causes of respiratory illnesses should be sought. Initial diagnostic testing for patients with suspected SARS should include chest radiography, pulse oximetry, blood cultures, sputum Gram stain and culture, and testing for other respiratory pathogens, notably influenza A and B, respiratory syncytial virus, and Legionella (Table 2 ). Clinicians should save any available clinical specimens (respiratory, blood, serum, and stool) for additional testing until a specific diagnosis is made.Table 2 Diagnostic Approach to Patients With Possible SARS* Chest radiograph Sputum Gram stain and culture, blood culture Pulse oximetry Consider testing for other pathogens such as influenza, respiratory syncytial virus, Legionella Save clinical specimens (respiratory, blood, serum, stool) for possible additional testing until a definitive diagnosis is made Acute and convalescent serum (>21 days after symptom onset) Contact local and state health departments for SARS-CoV testing * SARS = severe acute respiratory syndrome; SARS-CoV = SARS corona-virus.

Consider testing for other pathogens such as influenza, respiratory syncytial virus, Legionella Save clinical specimens (respiratory, blood, serum, stool) for possible additional testing until a definitive diagnosis is made Acute and convalescent serum (>21 days after symptom onset) Contact local and state health departments for SARS-CoV testing * SARS = severe acute respiratory syndrome; SARS-CoV = SARS corona-virus. Acute and convalescent (>21 days after onset of symptoms) serum samples should be collected from each patient who meets the SARS case definition. Paired sera and other clinical specimens can be forwarded through state and local health departments for testing at the CDC. Specific instructions for collecting specimens from suspected SARS patients are available from the CDC.18 Laboratory diagnostic tests used at the CDC to test clinical specimens for evidence of SARS-CoV include serology, PCR testing, and viral cultures. Serologic testing for coronavirus antibody consists of indirect fluorescent antibody testing and enzyme-linked immunosorbent assays that are specific for antibody produced after infection. Patients seem to seroconvert at a mean of 10 days after onset of symptoms. The CDC has made reagents for SARS antibody testing available to state public health laboratories.

consists of indirect fluorescent antibody testing and enzyme-linked immunosorbent assays that are specific for antibody produced after infection. Patients seem to seroconvert at a mean of 10 days after onset of symptoms. The CDC has made reagents for SARS antibody testing available to state public health laboratories. An RT-PCR test specific for RNA from the SARS-CoV has been positive within the first 10 days after fever onset in respiratory specimens from most patients considered probable cases of SARS who have been tested and in stool samples in the second week of illness. The duration of detectable viremia or viral shedding needs further study.12, 13 Despite the fact that several thousand specimens from patients with SARS have been processed in laboratories worldwide, to date there have been no reported clusters of illness in laboratory workers. Nevertheless, reasonable precautions should be taken in handling these specimens. The CDC recommends that specimens from patients with SARS be labeled accordingly and that the laboratory be alerted before the samples are sent. Laboratory workers who handle these specimens should use standard precautions in a Biosafety Level 2 laboratory. Any procedure with the potential to generate fine particulate aerosols should be performed in a biological safety cabinet.19

abeled accordingly and that the laboratory be alerted before the samples are sent. Laboratory workers who handle these specimens should use standard precautions in a Biosafety Level 2 laboratory. Any procedure with the potential to generate fine particulate aerosols should be performed in a biological safety cabinet.19 TREATMENT There is no specific treatment currently available for SARS. Management consists of supportive care and appropriate infection control measures to prevent spread. Because the diagnosis is uncertain, empirical therapy for community-acquired pneumonia should be administered by using antibiotics with activity against both typical and atypical respiratory pathogens including influenza when appropriate. In all series of SARS cases described to date, therapy has involved broad-spectrum antibiotics, including a fluoroquinolone or macrolide. The antiviral drug ribavirin has been used in most patients treated in Hong Kong and in Toronto, without evidence of efficacy.7, 10 The adverse effects of ribavirin are significant, particularly hemolytic anemia and electrolyte disturbances such as hypokalemia and hypomagnesemia; hence, empirical therapy with ribavirin is not warranted.

ribavirin has been used in most patients treated in Hong Kong and in Toronto, without evidence of efficacy.7, 10 The adverse effects of ribavirin are significant, particularly hemolytic anemia and electrolyte disturbances such as hypokalemia and hypomagnesemia; hence, empirical therapy with ribavirin is not warranted. Anecdotal evidence suggests that corticosteroids may be beneficial, particularly in patients with progressive pulmonary infiltrates and hypoxemia. Various regimens have been used in different centers, with dosages of methylpred-nisolone ranging from 40 mg twice daily (similar to therapy for Pneumocystis carinii pneumonia) to 2 mg/kg per day (similar to late-phase therapy for ARDS) to pulse doses of 500 mg intravenously per day.20 Because corticosteroids have potential adverse effects, clinicians should carefully assess the risk vs the benefit on a case-by-case basis. INFECTION CONTROL Early recognition and isolation of patients with SARS is key to limiting spread of the disease. Based on our current understanding of disease transmission, infection control measures for suspected SARS cases should include the following.

Anecdotal evidence suggests that corticosteroids may be beneficial, particularly in patients with progressive pulmonary infiltrates and hypoxemia. Various regimens have been used in different centers, with dosages of methylpred-nisolone ranging from 40 mg twice daily (similar to therapy for Pneumocystis carinii pneumonia) to 2 mg/kg per day (similar to late-phase therapy for ARDS) to pulse doses of 500 mg intravenously per day.20 Because corticosteroids have potential adverse effects, clinicians should carefully assess the risk vs the benefit on a case-by-case basis. INFECTION CONTROL Early recognition and isolation of patients with SARS is key to limiting spread of the disease. Based on our current understanding of disease transmission, infection control measures for suspected SARS cases should include the following. Screening and Triage Early identification of patients with SARS in health care facilities and appropriate isolation are essential in preventing large outbreaks. The CDC has recommended that in health care settings, patients should be screened with targeted questions as soon as possible after arrival or while the patient is on the telephone making an appointment. We have been using a simple screening tool (Figure 2 ) to screen all patients in our facility. Patients who have positive findings on the initial screen are given a mask, separated from other patients, placed in an examination room (a negative-air room if available), and evaluated further by a physician with airborne (N-95 respirator) and contact (gown, gloves) precautions. If, during this evaluation, the patient fits the CDC case definition for SARS and needs admission, the patient is admitted to a negative-air room. If admission is unnecessary but further testing is required, the patient is escorted to appropriate areas (for laboratory tests, radiological studies, etc) and testing expedited so that exposure of other patients is minimized.Figure 2 Screening algorithm used to triage patients at first point of contact.

tive-air room. If admission is unnecessary but further testing is required, the patient is escorted to appropriate areas (for laboratory tests, radiological studies, etc) and testing expedited so that exposure of other patients is minimized.Figure 2 Screening algorithm used to triage patients at first point of contact. *List of affected countries may change; the evaluating physician should check the Centers for Disease Control and Prevention Web site on severe acute respiratory syndrome (SARS) for the most current epidemiological case definition. NIOSH = National Institute of Occupational Safety and Health; TB = tuberculosis. Outpatient Setting Diagnosis of SARS does not automatically necessitate admission. Patients who do not otherwise need to be admitted to a hospital should be managed as outpatients as long as they can limit interactions outside the home.

*List of affected countries may change; the evaluating physician should check the Centers for Disease Control and Prevention Web site on severe acute respiratory syndrome (SARS) for the most current epidemiological case definition. NIOSH = National Institute of Occupational Safety and Health; TB = tuberculosis. Outpatient Setting Diagnosis of SARS does not automatically necessitate admission. Patients who do not otherwise need to be admitted to a hospital should be managed as outpatients as long as they can limit interactions outside the home. Persons being managed as outpatients should be instructed to wear a surgical mask when in the presence of household members, and they should contain respiratory secretions in facial tissue and place these in lined containers for disposal with household waste. They should wash their hands frequently with soap and water or an alcohol-based hand sanitizer, especially after touching respiratory secretions and other body fluids. Sharing of eating utensils, towels, and bedding between patients with SARS and others should be avoided until these items have been washed with soap and hot water. Such patients should stay away from work, school, or other activities in a public place for 10 days after the resolution of fever provided that cough and other respiratory symptoms have resolved or have improved. A plan will need to be formulated to decide how these outpatients will obtain food and other supplies such as surgical masks during the period of isolation and how arrangements will be made for travel to and from necessary medical appointments.

d that cough and other respiratory symptoms have resolved or have improved. A plan will need to be formulated to decide how these outpatients will obtain food and other supplies such as surgical masks during the period of isolation and how arrangements will be made for travel to and from necessary medical appointments. Household members or other close contacts of patients with SARS should be advised to wear disposable gloves for any direct contact with body fluids from the patient and to practice good hand hygiene. Such people should be vigilant for the development of fever or respiratory symptoms, and if these occur, they should seek health care evaluation. They should inform their health care provider in advance of arriving for the evaluation that they have had close contact with a patient with SARS so that arrangements can be made, as necessary, to prevent transmission to others in the health care setting. In the absence of fever or respiratory symptoms, they need not limit their activities outside the home.

ovider in advance of arriving for the evaluation that they have had close contact with a patient with SARS so that arrangements can be made, as necessary, to prevent transmission to others in the health care setting. In the absence of fever or respiratory symptoms, they need not limit their activities outside the home. Hospital Setting Patients who require hospitalization should be admitted to a negative pressure, specially ventilated room. Visitors should be discouraged; the number of HCWs involved in the patient's care should be limited. All HCWs should use personal protective equipment appropriate for standard, contact, and airborne precautions (ie, hand hygiene, gown, gloves, and N-95 respirator) in addition to eye protection while caring for these patients. Procedures that result in coughing and aerosolization of respiratory secretions should be avoided. If bronchoscopy is considered essential for patient care, it should be performed by experienced personnel using maximum infection control precautions (Table 3 ).Table 3 Infection Control Precautions for Patients Hospitalized With Suspected/Probable SARS* Place patient in a negative pressure, specially vented room Maintain a log of all persons entering the patient's room Restrict visitors as much as possible Limit the number of hospital personnel caring for the patient All health care workers entering the room should use a combination of contact (gowns, gloves, hand hygiene) and airborne (N-95 respirator) precautions and eye protection Do not bring pens, hospital charts, etc, in and out of the patient's room

Restrict visitors as much as possible Limit the number of hospital personnel caring for the patient All health care workers entering the room should use a combination of contact (gowns, gloves, hand hygiene) and airborne (N-95 respirator) precautions and eye protection Do not bring pens, hospital charts, etc, in and out of the patient's room Minimize air turbulence when changing linens Clean surfaces in the room carefully and frequently with EPA-registered hospital-grade disinfectant Limit cough-inducing procedures (sputum induction, administration of nebulized medications, suctioning, bronchoscopy) Avoid use of noninvasive positive pressure ventilation (eg, CPAP, BiPAP) For patients receiving mechanical ventilation, use closed-suctioning devices, HEPA filtration on exhalation valve port Educate personnel involved in the care of these patients to be vigilant for symptoms of SARS for 10 days after contact with the patient Quarantine personnel with unprotected contact with a SARS patient during an aerosol-generating procedure * BiPAP = biphasic positive airway pressure; CPAP = continuous positive airway pressure; EPA = Environmental Protection Agency; HEPA = high-efficiency particulate air; SARS = severe acute respiratory syndrome.

Educate personnel involved in the care of these patients to be vigilant for symptoms of SARS for 10 days after contact with the patient Quarantine personnel with unprotected contact with a SARS patient during an aerosol-generating procedure * BiPAP = biphasic positive airway pressure; CPAP = continuous positive airway pressure; EPA = Environmental Protection Agency; HEPA = high-efficiency particulate air; SARS = severe acute respiratory syndrome. MANAGING HCW EXPOSURE An important feature of the SARS outbreaks in Canada, Singapore, and Hong Kong has been the fact that several HCWs have developed SARS after caring for patients with SARS. Transmission to HCWs appears to have occurred after close, unprotected contact with symptomatic individuals. This has placed additional strain on health care systems that have already been stressed by outbreaks of SARS. Active surveillance for fever and respiratory symptoms (eg, daily screening) should be conducted in HCWs with unprotected exposure for 10 days after the exposure, including checking the temperature when the employee reports to work and taking a history of respiratory symptoms. Workers with unprotected exposure who develop fever and/or respiratory symptoms should not come to work; they should stay home and report symptoms to infection control or the employee health service immediately. Health care workers with unprotected exposure during aerosolgenerating procedures (intubation, suctioning, bronchos-copy, etc) should be quarantined for a 10-day period at home because these procedures pose a higher risk of disease transmission.

symptoms to infection control or the employee health service immediately. Health care workers with unprotected exposure during aerosolgenerating procedures (intubation, suctioning, bronchos-copy, etc) should be quarantined for a 10-day period at home because these procedures pose a higher risk of disease transmission. CONCLUSION Case definitions of SARS are currently based on the presence of epidemiological risk factors (close contact with patients with SARS or travel to SARS-affected areas) and a combination of fever and respiratory symptoms, with or without chest radiographic changes. However, if SARS spreads into the general population, our ability to distinguish it from other community-acquired pneumonias based on such epidemiological linkages will fail. If this happens, SARS will need to be considered in the differential diagnosis of any community-acquired or nosocomial pneumonia. A “typical” history, suggestive laboratory values, and failure to respond to conventional antibiotics should raise suspicion. Diagnostic tests will be crucial in the future both to ensure that patients are isolated rapidly and to provide appropriate therapy. SARS has resulted in important challenges for the medical community. In affected areas, policies are changing daily as more information about the virus and the disease is obtained.

CONCLUSION Case definitions of SARS are currently based on the presence of epidemiological risk factors (close contact with patients with SARS or travel to SARS-affected areas) and a combination of fever and respiratory symptoms, with or without chest radiographic changes. However, if SARS spreads into the general population, our ability to distinguish it from other community-acquired pneumonias based on such epidemiological linkages will fail. If this happens, SARS will need to be considered in the differential diagnosis of any community-acquired or nosocomial pneumonia. A “typical” history, suggestive laboratory values, and failure to respond to conventional antibiotics should raise suspicion. Diagnostic tests will be crucial in the future both to ensure that patients are isolated rapidly and to provide appropriate therapy. SARS has resulted in important challenges for the medical community. In affected areas, policies are changing daily as more information about the virus and the disease is obtained. The resurgence of cases in Toronto in early May 2003 shows the difficulty of maintaining control over a new disease characterized by many puzzling epidemiological and clinical features. The continued alertness of Singapore, which most recently broke the chain of SARS transmission, shows the importance of maintaining a high level of vigilance and preparedness to ensure that a single imported case does not reignite an outbreak. Currently, control depends on prompt detection and isolation of cases, good infection control in hospitals, and the tracing and quarantine of contacts.

f SARS transmission, shows the importance of maintaining a high level of vigilance and preparedness to ensure that a single imported case does not reignite an outbreak. Currently, control depends on prompt detection and isolation of cases, good infection control in hospitals, and the tracing and quarantine of contacts. Questions About SARS 1. In which one of the following countries did the first cases of SARS seem to occur? a. United States b. Vietnam c. China d. Thailand e. Singapore 2. Which one of the following is the etiologic agent of SARS? a. A novel coronavirus b. Paramyxovirus c. Influenza d. Avian influenza e. Resistant pneumococcus 3. Which one of the following patients would fit the CDC case definition for probable SARS? a. A 45-year-old executive with a fever of 39°C (102°F), myalgias, dry cough, and a patchy left lower lobe infiltrate 5 days after returning from a business trip to Beijing b. A 50-year-old male smoker with severe chronic obstructive pulmonary disease who presents with cough, greenish sputum, and left lower lobe consolidation 5 days after returning from a 2-week vacation with his grandchildren at Walt Disney World in Florida c. A 35-year-old woman with a fever of 39°C, myalgias, dry cough, and normal findings on a chest x-ray film who returned from China 5 days ago with her adopted infant d. A 40-year-old recent immigrant to the United States who presents with a 2-month history of cough productive of blood-streaked sputum, low-grade fever (maximum 37.8°C [100°F]), and progressive weight loss

c. A 35-year-old woman with a fever of 39°C, myalgias, dry cough, and normal findings on a chest x-ray film who returned from China 5 days ago with her adopted infant d. A 40-year-old recent immigrant to the United States who presents with a 2-month history of cough productive of blood-streaked sputum, low-grade fever (maximum 37.8°C [100°F]), and progressive weight loss e. A 60-year-old man with an ejection fraction of 20% who presents with shortness of breath, orthopnea, bilateral pulmonary infiltrates, and no fever 7 days after returning from Singapore 4. Which one of the following infection control precautions is not recommended by the CDC for possible cases of SARS in the hospital setting? a. Airborne isolation b. Droplet isolation c. Use of gloves, gowns, good hand hygiene, and eye protection by health care personnel d. Quarantine of the physician who performed bronchoscopy on the patient before the diagnosis of SARS was considered and infection control measures instituted e. Mandatory quarantine of the patient's family even though they have no symptoms 5. Which one of the following statements regarding SARS is false? a. A fever higher than 38°C (100.4°F) is necessary to fit the current CDC case definition b. Nonproductive cough is frequently a presenting symptom c. All patients who may have SARS must be admitted to a hospital d. SARS may be less severe in children e. Some patients with SARS may have a biphasic or triphasic illness Correct answers: 1. c, 2. a, 3. a, 4. e, 5. c A question-and-answer section appears at the end of this article.

In November 2002, there were reports from the Guangdong Province in southern China of 305 cases of highly contagious, severe atypical pneumonia of unknown cause.1, 2 On March 13, 2003, as this novel infectious disease spread beyond China's borders, the World Health Organization issued a global alert and initiated worldwide surveillance. By this time, the US Centers for Disease Control and Prevention had named the condition severe acute respiratory syndrome (SARS) and had provided a clinical case definition.3 During an outbreak of atypical pneumonia in Hong Kong, scientists at the Centers for Disease Control and Prevention and in Hong Kong announced that a new coronavirus had been isolated from patients with SARS.4 Additional cases of suspected SARS were reported worldwide,5 but China, Hong Kong, Singapore, Toronto (Canada), and Taiwan have borne the brunt of the caseload. The first case of SARS occurred in Taiwan in February 20036: a merchant was returning to Taipei from the Guangdong Province via Hong Kong. On March 14 and 17, 2003, his wife and son, respectively, presented with probable SARS. Soon thereafter, other Taiwanese citizens returning from mainland China and Hong Kong were diagnosed as having SARS. During the early stages of the additional outbreaks in Taiwan, awareness of this new communicable disease was poor, and stringent infection control procedures had not been implemented in the hospitals, leading to a series of hospital-acquired infections.

from mainland China and Hong Kong were diagnosed as having SARS. During the early stages of the additional outbreaks in Taiwan, awareness of this new communicable disease was poor, and stringent infection control procedures had not been implemented in the hospitals, leading to a series of hospital-acquired infections. Although several case series of SARS have been reported,7, 8, 9 to our knowledge, a prospective clinical study including long-term follow-up assessment by chest radiography, chest high-resolution computed tomography (HRCT), and pulmonary function testing has not been reported, particularly for hospital-acquired cases. This prompted us to study prospectively the presenting manifestations and the eventual clinical outcome of 14 patients with hospital-acquired SARS. PATIENTS AND METHODS This study was approved by the ethics committee of the Veterans General Hospital, Taipei, Taiwan.

Although several case series of SARS have been reported,7, 8, 9 to our knowledge, a prospective clinical study including long-term follow-up assessment by chest radiography, chest high-resolution computed tomography (HRCT), and pulmonary function testing has not been reported, particularly for hospital-acquired cases. This prompted us to study prospectively the presenting manifestations and the eventual clinical outcome of 14 patients with hospital-acquired SARS. PATIENTS AND METHODS This study was approved by the ethics committee of the Veterans General Hospital, Taipei, Taiwan. The index patient with SARS visited the emergency department of Hospital A on April 9, 2003, and hospital-acquired infections spread in Hospital A (a community hospital). Subsequently, index patients with SARS seen at Hospital B (another community hospital) resulted in additional cases of hospital-acquired SARS. Hospitals A and B were closed subsequently. The Taipei Veterans General Hospital (Hospital C), the largest tertiary and national teaching hospital in Taipei City, was ordered by the government to admit the 12 patients with hospital-acquired SARS from Hospitals A and B. Two hospital staff members (a physician and an emergency department nurse) at Taipei Veterans General Hospital also acquired the SARS infection.

the largest tertiary and national teaching hospital in Taipei City, was ordered by the government to admit the 12 patients with hospital-acquired SARS from Hospitals A and B. Two hospital staff members (a physician and an emergency department nurse) at Taipei Veterans General Hospital also acquired the SARS infection. We conducted the initial management and data-collecting protocol on April 20, 2003, and enrolled these 14 patients from April 25 to May 7, 2003; follow-up extended through December 2003. All 14 patients met the World Health Organization case definition, established on April 17, 2003, for SARS1, 2, 3: fever (temperature =38°C), cough or shortness of breath, and pulmonary infiltration in the absence of an alternative diagnosis to explain the clinical presentation, combined with a history of direct exposure to SARS or returning from a SARS-infected area. Although the initial chest x-ray films were normal in 3 patients, radiographic abnormalities were noted on films obtained 1 to 2 days later. All 14 of these patients with SARS were admitted to the isolation wards at Taipei Veterans General Hospital. We classified the severity of SARS into 3 groups on the basis of the oxygenation status of the patients at enrollment: mild was defined by a normal PaO2, moderate was defined by an abnormally low PaO2 but a PaO2/fraction of inspired oxygen (FIO2) ratio of 200 mm Hg or higher, and severe was defined by a PaO2/FIO2 ratio lower than 200 mm Hg. (Patients with severe SARS developed adult respiratory distress syndrome [ARDS] and required mechanical ventilation.)

normal PaO2, moderate was defined by an abnormally low PaO2 but a PaO2/fraction of inspired oxygen (FIO2) ratio of 200 mm Hg or higher, and severe was defined by a PaO2/FIO2 ratio lower than 200 mm Hg. (Patients with severe SARS developed adult respiratory distress syndrome [ARDS] and required mechanical ventilation.) Laboratory and Radiological Assessment For all patients, hematologic (complete blood cell counts with differential leukocyte count and coagulation profile) and biochemical (electrolytes, liver and renal function, creatine kinase [CK], lactate dehydrogenase [LDH]) tests were performed every 2 days during hospitalization. Chest radiographs were obtained every 2 days during hospitalization and monthly after hospital discharge. Chest HRCT was performed every 3 months.

rofile) and biochemical (electrolytes, liver and renal function, creatine kinase [CK], lactate dehydrogenase [LDH]) tests were performed every 2 days during hospitalization. Chest radiographs were obtained every 2 days during hospitalization and monthly after hospital discharge. Chest HRCT was performed every 3 months. Reverse Transcriptase-Polymerase Chain Reaction For Diagnosis Of Sars Blood samples, throat swabs, and/or sputum were collected on the first day of admission. Molecular diagnosis of SARS was performed by extracting the viral RNA according to a viral RNA kit (QIAGEN, Hilden, Germany), followed by the use of a 1-step reverse transcriptase-polymerase chain reaction (RT-PCR) kit with coronavirus-specific primers (Roche, Mannheim, Germany) to carry out RT-PCR. The PCR products were observed through 1.5% agarose gel electrophoresis (Figure 1 ). The primers of RT-PCR were Cor-p-F2 (+) 5'CTAACATGCTTAGGATAATGG3' and Cor-p-R1 (-) 5'CAGGTAAGCGTAAAACTCATC3'. The product size (Cor-p-F2/Cor-p-R1) was 368 base pairs.10 FIGURE 1 Reverse transcriptase-polymerase chain reaction (RT-PCR) was used to diagnose the severe acute respiratory syndrome (SARS) coronavirus in patient 3. The PCR products were observed through 1.5% agarose gel electrophoresis. As shown in the S1 column, RT-PCR was done with the serum from this patient on hospital day 8, and results were positive; product size was 368 base pairs (bp). However, the same procedure was repeated with the serum from this patient on hospital day 50, and results were negative, as shown in the S2 column. This finding indicated that the virus was present in the blood during the initial phase but had disappeared in the late phase of disease.

duct size was 368 base pairs (bp). However, the same procedure was repeated with the serum from this patient on hospital day 50, and results were negative, as shown in the S2 column. This finding indicated that the virus was present in the blood during the initial phase but had disappeared in the late phase of disease. MANAGEMENT PROTOCOL All patients received oral ribavirin at 2000 mg/d for 10 days, intravenous injection of levofloxacin at 500 mg/d for 7 days, and intravenous immunoglobulin at 1 g/kg per day for 2 days after symptom onset. In cases of acute lung injury (PaO2/FIO2 ratio <200 mm Hg), methylprednisolone at 2 mg/kg per day was administered intravenously, and the dosage was tapered subsequently according to clinical response. The criteria for tracheal intubation and mechanical ventilation included an absolute indication, PaO2/FIO2 ratio less than 100 mm Hg, and a relative indication, PaO2/FIO2 ratio of 100 to 200 mm Hg. Mechanical ventilation was used with a low tidal volume (6–8 mL/kg), plateau pressure lower than 30 to 35 cm H2O, and adequate positive end-expiratory pressure to lessen the likelihood of barotrauma.11

olute indication, PaO2/FIO2 ratio less than 100 mm Hg, and a relative indication, PaO2/FIO2 ratio of 100 to 200 mm Hg. Mechanical ventilation was used with a low tidal volume (6–8 mL/kg), plateau pressure lower than 30 to 35 cm H2O, and adequate positive end-expiratory pressure to lessen the likelihood of barotrauma.11 FOLLOW-UP AFTER HOSPITAL DISCHARGE After discharge from the hospital, patients were followed up as outpatients with chest radiography, HRCT, and pulmonary function tests (Automated Body Plethysmograph 6200 Autobox DL, SensorMedics, Loma Linda, Calif). The impairment of pulmonary function was assessed according to the guidelines of the American Thoracic Society.12 The pulmonary function test result was interpreted as within normal limits if the total lung capacity (TLC), forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), and diffusing capacity were greater than 80% of the predicted normal value and the FEV1/FVC ratio was greater than 0.70. DATA ANALYSES Continuous data are expressed as the mean ± SD or a percentage. The Wilcoxon rank sum test was used to determine whether there was an association between any of the clinical and laboratory variables and mechanical ventilation. The Fisher exact test was used to determine whether there was an association between categorical variables. P<.05 was regarded as statistically significant. Statistical analysis was performed with SYSTAT software (Version 7.0, SPSS, Chicago, Ill).

any of the clinical and laboratory variables and mechanical ventilation. The Fisher exact test was used to determine whether there was an association between categorical variables. P<.05 was regarded as statistically significant. Statistical analysis was performed with SYSTAT software (Version 7.0, SPSS, Chicago, Ill). RESULTS EPIDEMIOLOGICAL CHARACTERISTICS The mean ± SD age of the 14 patients with hospital-acquired SARS was 36.1±13.9 years (median, 30 years; range, 25–74 years). Other epidemiological characteristics are shown in Table 1 . All patients were Chinese, and all were exposed to SARS in the hospital setting. Twelve of these 14 patients (86%) were health care workers (1 physician, 7 nurses, 2 radiology technicians, 1 clerical staff, and 1 laboratory technician). Most patients had been healthy before exposure to SARS.TABLE 1 Epidemiological Characteristics of the 14 Patients With SARS* Male 3 Female 11 Mean ± SD age (y) 36.1±13.9 Smoker Yes 0 No 14 Occupation (hospital where exposure occurred) Clerical staff 1 (A) Laboratory technician 1 (B) Physician 1 (C) Merchant 1 (B) Nurses 7 (A, 5; B, 1; C, 1) Patient 1 (B) X-ray technician 2 (B) History Asthma 1 Diabetes mellitus and congestive heart failure 1 Hepatitis B virus carrier 1 Hyperthyroidism 1 None 10 Travel None 14 Exposure to SARS Emergency department of Hospital C 2 Patient in Hospital A 1 Patient in Hospital B 5 SARS in Hospital B 6 * SARS = severe acute respiratory syndrome.

y technician 2 (B) History Asthma 1 Diabetes mellitus and congestive heart failure 1 Hepatitis B virus carrier 1 Hyperthyroidism 1 None 10 Travel None 14 Exposure to SARS Emergency department of Hospital C 2 Patient in Hospital A 1 Patient in Hospital B 5 SARS in Hospital B 6 * SARS = severe acute respiratory syndrome. INITIAL SYMPTOMS AND PHYSICAL EXAMINATION FINDINGS The most common symptoms of the patients at presentation were fever (n=14 [100%]), dyspnea (n=12 [86%]), dizziness (n=11 [79%]), diarrhea (n=11 [79%]), malaise (n=11 [79%]), dry cough (n=10 [71%]), muscle pain (n=9 [64%]), and chills (n=8 [57%]). Less common symptoms included sore throat (n=3 [21%]), sputum production (n=4 [29%]), nausea (n=2 [14%]), chest pain (n=2 [14%]), and vomiting (n=2 [14%]). Physical examination at admission revealed fever and inspiratory crackles in all patients. Rash, lymphadenopathy, and purpura were not observed. INITIAL LABORATORY FINDINGS Initial abnormal laboratory findings included leukopenia (n=4 [29%]), lymphopenia (n=14 [100%]), thrombocytopenia (n=2 [17%]), anemia (n=3 [21%]), and leukocytosis (n=6 [43%]), as well as elevated serum levels of aspartate aminotransferase (AST) (n=4 [29%]), alanine aminotransferase (ALT) (n=4 [29%]), LDH (n=10 [71%]), CK (n=1 [7%]), and C-reactive protein (CRP) (n=11 [79%]). All 14 patients had positive findings on RT-PCR assay of SARS coronavirus.

(n=3 [21%]), and leukocytosis (n=6 [43%]), as well as elevated serum levels of aspartate aminotransferase (AST) (n=4 [29%]), alanine aminotransferase (ALT) (n=4 [29%]), LDH (n=10 [71%]), CK (n=1 [7%]), and C-reactive protein (CRP) (n=11 [79%]). All 14 patients had positive findings on RT-PCR assay of SARS coronavirus. INITIAL RADIOLOGICAL FINDINGS In 3 patients (21%), the initial chest radiographs appeared normal, but radiological opacities were noted within 2 days of admission (Table 2 ). In the other 11 patients with abnormal chest radiographs on admission, the predominant pattern of abnormality was haziness (n=4 [36%]), consolidation (n=3 [27%]), and interstitial infiltrates (n=4 [36%]). The pattern of distribution was unilateral focal opacity (n=6 [55%]), unilateral multifocal opacities (n=4 [36%]), and bilateral opacities (n=1 [9%]).TABLE 2 Initial and Subsequent Findings on Chest Imaging in 14 Patients With SARS*

iness (n=4 [36%]), consolidation (n=3 [27%]), and interstitial infiltrates (n=4 [36%]). The pattern of distribution was unilateral focal opacity (n=6 [55%]), unilateral multifocal opacities (n=4 [36%]), and bilateral opacities (n=1 [9%]).TABLE 2 Initial and Subsequent Findings on Chest Imaging in 14 Patients With SARS* Clinical severity of illness Mild 4 Moderate 5 Severe 5 Chest radiograph on admission Bilateral diffuse interstitial infiltrates 1 Consolidation RML 1 RUL, RLL 1 Haziness LLL 2 RLL 1 RUL, RLL 1 Interstitial infiltrates LLL 1 RLL, LLL 2 Normal 3 Segmental consolidation RUL 1 Chest radiograph at peak illness Bilateral diffuse alveolar infiltrates 1 Bilateral diffuse alveolar infiltrates, pneumothorax 1 Bilateral diffuse haziness, pneumothorax 1 Consolidation RLL, haziness RLL 1 Consolidation LLL 1 RLL, LLL 5 RLL, RUL, LLL 1 RUL 1 RUL, LLL 1 RUL, RLL 1 6-month follow-up HRCT Bilateral basilar fibrosis with ground-glass opacities 1 Focal fibrosis LLL 3 In-hospital death 1 Multifocal fibrosis 1 Multifocal fibrosis with ground-glass opacities 2 Multifocal fibrosis with ground-glass opacities RLL, LLL 1 Normal 5 * HRCT = high-resolution computed tomography; LLL = left lower lobe; RLL = right lower lobe; RML = right middle lobe; RUL = right upper lobe; SARS = severe acute respiratory syndrome.

tifocal fibrosis 1 Multifocal fibrosis with ground-glass opacities 2 Multifocal fibrosis with ground-glass opacities RLL, LLL 1 Normal 5 * HRCT = high-resolution computed tomography; LLL = left lower lobe; RLL = right lower lobe; RML = right middle lobe; RUL = right upper lobe; SARS = severe acute respiratory syndrome. FOLLOW-UP RADIOLOGICAL FINDINGS Chest radiographs revealed maximal infiltrates at a mean ± SD of 8.7±3.8 days (range, 3–17 days) after onset of fever. The pattern of radiographic lung involvement varied dramatically among the patients. In 6 patients with only a focal opacity on initial chest radiographs, progression to bilateral lung involvement was seen, including ARDS in 1 patient (Figure 2 ). In 5 patients presenting with bilateral lung involvement on initial chest radiographs, continued radiological deterioration was seen, with 4 of these patients developing ARDS (Figure 3 ). There was a significant association between bilateral lung involvement and development of ARDS (P=.02; Fisher exact test). Thus, patients presenting with bilateral or multifocal involvement on initial chest radiography appeared to be at an increased risk of developing ARDS compared with those presenting with only a focal opacity.FIGURE 2 Images of patient 3 who had severe acute respiratory syndrome complicated by acute respiratory distress syndrome. Left, Chest radiograph on day 8 reveals bilateral consolidation and infiltrates (endotracheal tube was placed for mechanical ventilation). Middle, Chest radiograph performed 6 months after hospital discharge shows residual fibrotic infiltrates in the lower lung zones. Right, High-resolution computed tomography performed 6 months after hospital discharge reveals patchy ground-glass opacities and fibrotic infiltrates. Results of pulmonary function testing showed mild restrictive ventilatory impairment with a total lung capacity of 71%, forced expiratory volume in 1 second of 67%, and diffusing capacity of lung for carbon monoxide of 52%.

months after hospital discharge reveals patchy ground-glass opacities and fibrotic infiltrates. Results of pulmonary function testing showed mild restrictive ventilatory impairment with a total lung capacity of 71%, forced expiratory volume in 1 second of 67%, and diffusing capacity of lung for carbon monoxide of 52%. FIGURE 3 Serial radiographic studies of patient 5, a 30-year-old nurse from Hospital B, who had severe acute respiratory syndrome complicated by acute respiratory distress syndrome. Upper Left, Chest radiograph on admission shows bilateral consolidation and infiltrates involving the right upper lung, right lower lung, and left lower lung. Upper Middle, Chest radiograph on hospital day 2 shows progression of infiltration associated with development of severe hypoxia; mechanical ventilation was needed. Upper Right, Chest radiograph on hospital day 25 shows gradual resolution of consolidation and lung fibrotic infiltrates. Lower Left, Chest radiograph 3 months after disease onset shows near-normal findings, except for mild fibrotic lesion in left lower lung. Lower Middle and Lower Right, High-resolution computed tomography performed 3 and 6 months, respectively, after hospital discharge shows ground-glass opacities in the bilateral lower lung and fibrotic infiltrates in the left lower lung. Compared with 3-month scan, the 6-month scan shows that the area of ground glass was smaller but denser and reveals a fibrotic lesion. At 6-month follow-up, results of pulmonary function testing showed a total lung capacity of 82%, forced expiratory volume in 1 second of 53%, and diffusing capacity of lung for carbon monoxide of 39%.

-month scan, the 6-month scan shows that the area of ground glass was smaller but denser and reveals a fibrotic lesion. At 6-month follow-up, results of pulmonary function testing showed a total lung capacity of 82%, forced expiratory volume in 1 second of 53%, and diffusing capacity of lung for carbon monoxide of 39%. UNIVARIATE ANALYSES CORRELATING CLINICAL AND LABORATORY VARIABLES WITH USE OF MECHANICAL VENTILATION Initial laboratory findings included leukopenia, lymphopenia, thrombocytopenia, anemia, leukocytosis, and elevated serum levels of AST, ALT, LDH, CK, and CRP. Lymphopenia and elevated CK and LDH levels were the most common. The peak elevation of serum LDH (occurring a mean of 10 days after onset of fever) and CRP (a mean of 8 days after onset of fever), maximal lymphopenia (a mean of 9 days after onset of fever), and maximal infiltrates on chest imaging (a mean of 8.7 days after onset of fever) appeared to coincide within a 48-hour period during the course of illness in 5 patients with severe SARS. Higher peak levels of CRP and LDH were significantly associated with the need for mechanical ventilation (Table 3 ).TABLE 3 Univariate Analyses Correlating Clinical and Laboratory Variables With Mechanical Ventilation Outcome*

coincide within a 48-hour period during the course of illness in 5 patients with severe SARS. Higher peak levels of CRP and LDH were significantly associated with the need for mechanical ventilation (Table 3 ).TABLE 3 Univariate Analyses Correlating Clinical and Laboratory Variables With Mechanical Ventilation Outcome* Mechanical ventilation Variable† No (n=9) Yes (n=5) P value‡ Age (y) 33±10 41±19 .27 Neutrophil count (4.5-11.0 × 109/L) 9.2±5.1 11.6±3.0 .37 Lymphocyte count (1.0-8.0 × 109/L) 0.8±0.3 0.6±0.4 .17 Platelet count (150-350 × 109/L) 162±56 178±38 .59 Activated partial thromboplastin time (21-33 seconds) 29.7±5.0 34.36±5.0 .15 Sodium (137-147 mEq/L) 139.8±2.6 139.4±5.0 .79 Urea nitrogen (7-20 mg/dL) 12.9±3.9 10.2±1.9 .17 Creatinine (0.5-1.5 mg/dL) 0.89±0.22 0.72±0.08 .13 ALT (0-40 U/L) 38.6±32.4 68.6±78.2 .32 AST (5-45 U/L) 47.8±42.0 62.0±53.8 .59 CK (24-168 U/L) Initial 42.2±27.0 69.7±69.2 .42 Peak 95.4±10.1 57.6±24.7 .44 LDH (95-213 U/L) Initial 273.1±83.4 371.8±146.0 .13 Peak 377.5±70.8 510.6±136.0 .03 Peak CRP (0-0.5 mg/dL) 2.08±2.30 16.8±6.8 <.001 * Values are presented as mean ± SD unless indicated otherwise. ALT = alanine aminotransferase; AST = aspartate aminotransferase; CK = creatine kinase; CRP = C-reactive protein; LDH = lactate dehydrogenase. † All laboratory values are initial values unless indicated otherwise. Reference ranges are shown parenthetically. ‡ Wilcoxon rank sum test.

Mechanical ventilation Variable† No (n=9) Yes (n=5) P value‡ Age (y) 33±10 41±19 .27 Neutrophil count (4.5-11.0 × 109/L) 9.2±5.1 11.6±3.0 .37 Lymphocyte count (1.0-8.0 × 109/L) 0.8±0.3 0.6±0.4 .17 Platelet count (150-350 × 109/L) 162±56 178±38 .59 Activated partial thromboplastin time (21-33 seconds) 29.7±5.0 34.36±5.0 .15 Sodium (137-147 mEq/L) 139.8±2.6 139.4±5.0 .79 Urea nitrogen (7-20 mg/dL) 12.9±3.9 10.2±1.9 .17 Creatinine (0.5-1.5 mg/dL) 0.89±0.22 0.72±0.08 .13 ALT (0-40 U/L) 38.6±32.4 68.6±78.2 .32 AST (5-45 U/L) 47.8±42.0 62.0±53.8 .59 CK (24-168 U/L) Initial 42.2±27.0 69.7±69.2 .42 Peak 95.4±10.1 57.6±24.7 .44 LDH (95-213 U/L) Initial 273.1±83.4 371.8±146.0 .13 Peak 377.5±70.8 510.6±136.0 .03 Peak CRP (0-0.5 mg/dL) 2.08±2.30 16.8±6.8 <.001 * Values are presented as mean ± SD unless indicated otherwise. ALT = alanine aminotransferase; AST = aspartate aminotransferase; CK = creatine kinase; CRP = C-reactive protein; LDH = lactate dehydrogenase. † All laboratory values are initial values unless indicated otherwise. Reference ranges are shown parenthetically. ‡ Wilcoxon rank sum test. TREATMENT OUTCOME During hospitalization, 10 of the 14 patients needed supplemental oxygen therapy. Of these 10 patients, 5 (36% of the total 14) had progression to ARDS and required mechanical ventilation. The clinical course of the 14 patients was generally characterized by defervescence and gradual clinical improvement as well as normalization of blood cell counts and diminishing lung infiltrates during a course of 2 weeks of inpatient management. In this cohort of 14 patients, 1 died. This patient was elderly and had comorbidities, including diabetes mellitus and congestive heart failure. Her illness progressed to ARDS and was complicated by bilateral pneumothorax and multiorgan failure (respiratory, heart, and renal failure).

f 2 weeks of inpatient management. In this cohort of 14 patients, 1 died. This patient was elderly and had comorbidities, including diabetes mellitus and congestive heart failure. Her illness progressed to ARDS and was complicated by bilateral pneumothorax and multiorgan failure (respiratory, heart, and renal failure). The mean ± SD duration of hospitalization for the entire cohort was 24±5.7 days. In the 4 patients with ARDS who required mechanical ventilation (excluding the 1 patient who died), the duration of hospitalization was 37.2±9.8 days. At discharge from the hospital, chest imaging showed normal results in 4 patients and residual infiltrates in 9 patients. Only 1 patient had continuing need for supplemental oxygen therapy at the time of hospital discharge. Hair loss and joint pain occurred in patients with severe SARS but resolved within 3 months. Generalized anxiety disorder persisted in 1 patient and required medical attention.

At discharge from the hospital, chest imaging showed normal results in 4 patients and residual infiltrates in 9 patients. Only 1 patient had continuing need for supplemental oxygen therapy at the time of hospital discharge. Hair loss and joint pain occurred in patients with severe SARS but resolved within 3 months. Generalized anxiety disorder persisted in 1 patient and required medical attention. FOLLOW-UP PULMONARY FUNCTION TESTING AND CHEST IMAGING Of the 13 survivors, 4 refused follow-up assessment of pulmonary function because they had recovered fully and had no residual functional impairment. The 9 patients subjected to follow-up pulmonary function testing 6 months after discharge were 4 who survived ARDS and 5 who did not have ARDS; in 3 of these 9 patients, results were normal (Table 4 ). Mild restrictive impairment was observed in only 1 patient who had survived ARDS associated with SARS; this patient required 2 episodes of mechanical ventilation. A reduced diffusing capacity was found in 5 additional patients. The mean ± SD diffusing capacity of ARDS survivors who also had SARS was reduced to 51.5%±11.0% of the predicted normal value but was 83.8%±16% of that predicted in SARS patients who did not have ARDS.TABLE 4 Results of Pulmonary Function Tests in 9 Patients With SARS 6 Months After Discharge From the Hospital*

tients. The mean ± SD diffusing capacity of ARDS survivors who also had SARS was reduced to 51.5%±11.0% of the predicted normal value but was 83.8%±16% of that predicted in SARS patients who did not have ARDS.TABLE 4 Results of Pulmonary Function Tests in 9 Patients With SARS 6 Months After Discharge From the Hospital* Patient TLC (L) FVC (L) FEV1 (L) FEV1/FVC ratio Diffusing capacity (mL/min/mm Hg) 1 5.12 (100) 3.20 (96) 2.80 (97) 88 (98) 24.30 (98) 2 4.21 (94) 2.06 (69) 1.52 (62) 74 (92) 15.40 (63) 3 2.93 (71) 1.92 (67) 1.87 (77) 98 (115) 12.79 (52) 4 4.90 (98) 2.90 (95) 2.60 (97) 86 (97) 20.30 (98) 5 3.71 (82) 1.74 (53) 1.67 (59) 96 (111) 10.20 (39) 6 3.99 (94) 2.33 (80) 2.19 (90) 94 (113) 16.17 (66) 7 4.52 (103) 2.87 (91) 2.52 (92) 88 (102) 18.34 (71) 8 3.85 (87) 1.85 (57) 1.64 (58) 88 (101) 12.20 (49) 9 4.18 (100) 2.56 (84) 2.41 (90) 94 (106) 22.90 (89) * Values in parentheses are percentage predicted. FEV1 = forced expiratory volume in 1 second; FVC = forced vital capacity; SARS = severe acute respiratory syndrome; TLC = total lung capacity. In the 13 survivors, chest HRCT performed 6 months after hospital discharge showed normal results in 5, focal fibrosis in 3, multifocal fibrosis in 1, and multifocal fibrosis with ground-glass opacities in 4 with ARDS associated with SARS.

Patient TLC (L) FVC (L) FEV1 (L) FEV1/FVC ratio Diffusing capacity (mL/min/mm Hg) 1 5.12 (100) 3.20 (96) 2.80 (97) 88 (98) 24.30 (98) 2 4.21 (94) 2.06 (69) 1.52 (62) 74 (92) 15.40 (63) 3 2.93 (71) 1.92 (67) 1.87 (77) 98 (115) 12.79 (52) 4 4.90 (98) 2.90 (95) 2.60 (97) 86 (97) 20.30 (98) 5 3.71 (82) 1.74 (53) 1.67 (59) 96 (111) 10.20 (39) 6 3.99 (94) 2.33 (80) 2.19 (90) 94 (113) 16.17 (66) 7 4.52 (103) 2.87 (91) 2.52 (92) 88 (102) 18.34 (71) 8 3.85 (87) 1.85 (57) 1.64 (58) 88 (101) 12.20 (49) 9 4.18 (100) 2.56 (84) 2.41 (90) 94 (106) 22.90 (89) * Values in parentheses are percentage predicted. FEV1 = forced expiratory volume in 1 second; FVC = forced vital capacity; SARS = severe acute respiratory syndrome; TLC = total lung capacity. In the 13 survivors, chest HRCT performed 6 months after hospital discharge showed normal results in 5, focal fibrosis in 3, multifocal fibrosis in 1, and multifocal fibrosis with ground-glass opacities in 4 with ARDS associated with SARS. DISCUSSION Our study population of 14 patients with hospital-acquired SARS included 12 health care workers. In Taiwan, the outbreak of hospital-acquired SARS infection occurred initially in Hospital A and then in Hospital B.6 These unfortunate events occurred because the health care workers at these 2 hospitals had not been informed of SARS, and infection control measures had not been instituted in these hospitals. Thus, most cases of SARS in Taiwan were related to hospital exposure. Health care workers in the hospitals became infected because of their prolonged exposure to and close contact with patients harboring SARS.

tals had not been informed of SARS, and infection control measures had not been instituted in these hospitals. Thus, most cases of SARS in Taiwan were related to hospital exposure. Health care workers in the hospitals became infected because of their prolonged exposure to and close contact with patients harboring SARS. At initial presentation, the main symptoms of SARS in our patients were fever, dyspnea, diarrhea, and dry cough. Our patients experienced diarrhea more commonly than SARS patients reported in other studies.8, 13 However, as many as 66% of the patients in the SARS outbreak in the Amoy Gardens in Hong Kong also had diarrhea, contributing to a significant virus load being discharged in the sewage.14 In addition, 4 (29%) of our patients had mildly elevated serum aminotransferase levels during hospitalization, and 2 patients experienced nausea and vomiting. Our clinical findings are consistent with those of Zhang,15 who noted that the SARS virus can involve the digestive system. Lymphopenia and elevated serum levels of LDH and CRP were the most common laboratory findings in our patients. Some patients had increased levels of AST, ALT, and CK, as well as thrombocytopenia and anemia. Although the symptoms and laboratory findings of SARS are nonspecific, the constellation of these features should alert medical practitioners to the possibility of SARS.

e the most common laboratory findings in our patients. Some patients had increased levels of AST, ALT, and CK, as well as thrombocytopenia and anemia. Although the symptoms and laboratory findings of SARS are nonspecific, the constellation of these features should alert medical practitioners to the possibility of SARS. Lymphopenia was an extremely common finding in our patients, as reported in previous studies (69.7%-98.0%).8, 15, 16 Depletion of lymphocytes may be secondary to the direct effect of the virus on the lymphocytes, the effect of various cytokines involved in SARS, or a stress response.17, 18 Similar to findings in other reports,8, 15, 17 some of our patients with SARS had thrombocytopenia. Wong et al17 reported evidence of active bone marrow with normal megakaryocytes as part of postmortem findings in patients with thrombocytopenia; these findings favor an immune cause of thrombocytopenia.

response.17, 18 Similar to findings in other reports,8, 15, 17 some of our patients with SARS had thrombocytopenia. Wong et al17 reported evidence of active bone marrow with normal megakaryocytes as part of postmortem findings in patients with thrombocytopenia; these findings favor an immune cause of thrombocytopenia. Similar to previous reports,7, 8, 9, 19 our results show that the primary radiological appearance of SARS is focal airspace shadowing (hazy/ground-glass opacities or consolidation predominantly affecting the lower lobes) or an interstitial pattern. Although the initial radiographic appearance may be normal in some patients, all our patients had radiological abnormalities within 1 or 2 days of presentation, with increasing extent of involvement and consolidation. Radiological opacities progressed from focal to multiple, from unilateral to bilateral, or from focal to bilateral diffuse lung involvement. Abnormalities seen on chest x-ray films were the most severe at a mean of 8.7 days after onset of fever. Compared with patients who had only unilateral focal lung infiltrates, those with bilateral or multifocal pulmonary infiltrates on initial presentation had a higher risk of developing respiratory failure.

volvement. Abnormalities seen on chest x-ray films were the most severe at a mean of 8.7 days after onset of fever. Compared with patients who had only unilateral focal lung infiltrates, those with bilateral or multifocal pulmonary infiltrates on initial presentation had a higher risk of developing respiratory failure. Radiologically, SARS may be indistinguishable from bacterial bronchopneumonia or viral infections. Therefore, the clinical and radiological characteristics of SARS do not appear to be helpful in differentiating SARS from other pathogens involved in atypical pneumonias. On the basis of the aforementioned findings, we suggest that atypical pneumonia with lymphopenia, elevation of LDH levels, rapid clinical deterioration, and lack of response to empirical antibiotic therapy must raise the suspicion of SARS, especially in the context of suspected exposure.

nvolved in atypical pneumonias. On the basis of the aforementioned findings, we suggest that atypical pneumonia with lymphopenia, elevation of LDH levels, rapid clinical deterioration, and lack of response to empirical antibiotic therapy must raise the suspicion of SARS, especially in the context of suspected exposure. We evaluated the patients' clinical and laboratory data to determine which factors correlated with a need for mechanical ventilation. High serum LDH levels are often associated with other forms of lung tissue damage. The CRP level generally correlates with the severity of inflammation. Therefore, peak CK and LDH levels might reflect severity of inflammation and damage in the lungs, respectively. Not surprisingly, we found that bilateral lung involvement on the initial chest x-ray film and higher serum peak levels of LDH and CRP were associated with the need for mechanical ventilation. Our findings are similar to those reported by Lee et al,8 who noted that high peak serum LDH levels were an independent predictor of an adverse outcome.

d that bilateral lung involvement on the initial chest x-ray film and higher serum peak levels of LDH and CRP were associated with the need for mechanical ventilation. Our findings are similar to those reported by Lee et al,8 who noted that high peak serum LDH levels were an independent predictor of an adverse outcome. Our treatment protocol included an initial regimen of broad-spectrum antibacterial and antiviral therapy. When severe refractory hypoxemia occurred, mechanical ventilation was initiated by using a protective ventilatory strategy, and intravenous methylprednisolone therapy was administered. In our cohort of 14 patients, only 1 patient died. The clinical course of this elderly patient was complicated by ARDS, superimposed bacterial infections, and multiorgan failure. According to previous reports, old age, diabetes mellitus, hepatitis, and other comorbidities (chronic obstructive pulmonary disease, cancer, or cardiac disease) increase the risk of a poor outcome. Our patient who died had 3 risk factors: old age, diabetes mellitus, and congestive heart failure. In previous reports, the overall mortality rate has ranged from 3.6%8 to 16.8%.16, 20 Variable mortality rates were associated with variations in age, comorbid disease states, access to medical support care, and the approach to medical management. Age appears to affect the mortality rate associated with SARS, which has been estimated to be a mean of 13.2% (range, 9.8%-16.8%) for patients younger than 60 years and 43.3% (range, 35.2%-52.4%) for patients older than 60 years.20 Five of our patients (36%) developed ARDS and required mechanical ventilation compared with 20% and 23% reported in 2 previous studies.8, 16 Preliminary results from our treatment regimen, which resulted in a relatively low mortality rate, appear promising but need further evaluation in clinical trials.

han 60 years.20 Five of our patients (36%) developed ARDS and required mechanical ventilation compared with 20% and 23% reported in 2 previous studies.8, 16 Preliminary results from our treatment regimen, which resulted in a relatively low mortality rate, appear promising but need further evaluation in clinical trials. In this 8-month follow-up evaluation of patients with SARS, 9 of 13 survivors had residual focal, multifocal, or bilateral lung infiltrates on chest HRCT. Only 1 patient had mildly restrictive pulmonary impairment, and 5 other patients had a decreased diffusing capacity. All our patients who survived ARDS had abnormal diffusing capacity that was reduced compared with that in our SARS patients who did not have ARDS. Orme et al21 found that approximately 80% of their ARDS survivors who did not have SARS had reduced diffusing capacity. Our study found no evidence of pronounced airway obstruction in SARS survivors, an outcome similar to that reported by Aggarwal et al22 and Schelling et al.23 In the latter study, surviving SARS patients not experiencing ARDS had no long-term airflow limitations. In contrast, Orme et al21 reported that 20% of their ARDS survivors who did not have SARS had long-term airflow obstruction. Although the discrepancy of airway obstruction is unclear, it might be due to patient selection bias because some ARDS survivors had a history of chronic airway disease. In our study, 1 SARS-ARDS survivor (25%) had long-term mildly restrictive pulmonary impairment with reduced TLC. The main reason for impaired pulmonary function might be the same as for all ARDS survivors, regardless of whether they experienced SARS. The reduced TLC and reduced FVC were due to lung fibrosis and neuromuscular weakness, respectively.22 Our findings in SARS-ARDS survivors showed only mild reductions in pulmonary function 6 to 8 months after the acute severe illness, consistent with the natural history of ARDS survivors in other studies.21, 22

ed SARS. The reduced TLC and reduced FVC were due to lung fibrosis and neuromuscular weakness, respectively.22 Our findings in SARS-ARDS survivors showed only mild reductions in pulmonary function 6 to 8 months after the acute severe illness, consistent with the natural history of ARDS survivors in other studies.21, 22 SARS is highly infectious among close contacts. Although the predominant pathology of SARS involves the lungs, other organs can be involved with the SARS coronavirus.24 An accurate and rapid diagnostic test will be of great importance for managing this disease in the future. Until such a diagnostic test is available, a clear picture of the clinical presentation of SARS should help physicians recognize this condition. Early recognition, prompt isolation, and appropriate supportive therapy are the keys to reducing the mortality and morbidity associated with this potentially deadly infection. CONCLUSION The clinical course of our 14 patients with hospital-acquired SARS consisted of atypical pneumonia associated with lymphopenia, elevated serum levels of LDH, rapid clinical progression, and lack of response to empirical antibiotic therapy. Substantially increased levels of LDH and CRP correlated with severe disease that required mechanical ventilation. In those who needed mechanical ventilatory support, pulmonary function was only mildly decreased 6 to 8 months after onset of SARS. Acknowledgments

CONCLUSION The clinical course of our 14 patients with hospital-acquired SARS consisted of atypical pneumonia associated with lymphopenia, elevated serum levels of LDH, rapid clinical progression, and lack of response to empirical antibiotic therapy. Substantially increased levels of LDH and CRP correlated with severe disease that required mechanical ventilation. In those who needed mechanical ventilatory support, pulmonary function was only mildly decreased 6 to 8 months after onset of SARS. Acknowledgments We are indebted to the frontline medical and nursing staff who demonstrated selfless and heroic devotion to duty in the face of this SARS outbreak despite the potential threat to their own lives and those of their family members.

Since mid-December 2003, 8 Asian countries—Cambodia, China, Indonesia, Japan, Laos, South Korea, Thailand, and Vietnam—have reported outbreaks of highly pathogenic avian influenza caused by the H5N1 strain among poultry. This is the largest outbreak of avian influenza in poultry ever described. Most of these countries experienced outbreaks of avian influenza for the first time. During the past 3 months, more than 100 million domestic poultry have died, or they have been culled to contain the epidemic and prevent the potential transmission to humans. Despite the widespread infection of avian influenza viruses among poultry in Asia, reported infection in humans has been rare to date. As of March 8, 2004, only Vietnam and Thailand have reported influenza H5N1 infection in humans. Thirty-two human cases were laboratory confirmed, resulting in 22 deaths, a mortality rate approaching 70%.1 However, most of the affected countries have limited capacity for surveillance of human disease. In addition, poultry production contributes substantially to the economies of the affected countries, resulting in considerable political pressure to minimize the extent and seriousness of the epidemic. Therefore, the reported human cases of avian influenza may be underestimated.

city for surveillance of human disease. In addition, poultry production contributes substantially to the economies of the affected countries, resulting in considerable political pressure to minimize the extent and seriousness of the epidemic. Therefore, the reported human cases of avian influenza may be underestimated. Historically, this avian epidemic zoonosis is unprecedented in its scale, geographical distribution, economic losses, challenge for control, and potential public health consequences.2 The potential development of a human influenza pandemic similar to that of 1918 due to Spanish influenza is a major concern. Two of the 3 key criteria that characterized the pandemic of 1918-1919 have already been fulfilled in the current epidemic: (1) the ability of the virus to infect humans resulting in high mortality and (2) a global immunologically naive human population.3 The third criterion, efficient human-to-human transmission, has thus far not been observed.4 The adaptation that would result in human-to-human transmission might involve changes in the receptor properties or improved viral replication efficiency. This adaptation might be achieved by mutation of an avian virus genome or by mixing segments of an avian virus with segments from a virus already adapted to humans (genetic reassortment), leading to the emergence of a new influenza subtype with pandemic potential.5 Both events may occur easily. First, influenza viruses mutate frequently, potentially allowing them to change the host receptor specificity from avian to human.6 Second, the segmented viral genome allows the exchange of genes between viruses if they infect the same host cell, which serves as the “mixing vessel.”7

ial.5 Both events may occur easily. First, influenza viruses mutate frequently, potentially allowing them to change the host receptor specificity from avian to human.6 Second, the segmented viral genome allows the exchange of genes between viruses if they infect the same host cell, which serves as the “mixing vessel.”7 In the current H5N1 outbreak in Asia, no genetic reassortment among avian and human influenza viruses has been found; all genes are of avian origin.4, 8 However, the widespread epidemic of avian influenza in domestic birds increases the likelihood for mutational events and genetic reassortment. In view of the high mortality observed in the limited number of infections in humans, the prospect of a severe pandemic is of considerable importance.9 We review current knowledge about avian influenza, including the virology, epidemiology, diagnosis, and management of this emerging disease.

s and genetic reassortment. In view of the high mortality observed in the limited number of infections in humans, the prospect of a severe pandemic is of considerable importance.9 We review current knowledge about avian influenza, including the virology, epidemiology, diagnosis, and management of this emerging disease. VIROLOGY Antigenic Diversity Influenza viruses type A, B, and C belong to the family of Orthomyxoviridae. These enveloped viruses contain a segmented single-stranded RNA genome. A key difference among influenza virus types is their host range.10 Type A viruses have been isolated from a wide range of species, including humans, pigs, horses, seals, ferrets, mink, whales, and birds. Types B and C viruses infect humans predominantly but have also been isolated from seals and pigs, respectively.7 Influenza A viruses can be divided into subtypes based on surface glycoproteins, hemagglutinin and neuraminidase. To date, 15 different hemagglutinin (H1-H15) and 9 neuraminidase (N1-N9) proteins have been identified.10 Hemagglutinin facilitates entry of the virus into host cells through its attachment to sialic acid on epithelial cell receptors, promotes membrane fusion, and elicits protective neutralizing antibody response. Hemagglutinin is the crucial component of influenza vaccines. Neuraminidase has enzyme activity, which cleaves sialic acid on virion proteins, facilitating the release of progeny virions from infected cells. It is an important target for antiviral agents.11 Although all influenza A virus subtypes have been found in birds, only 3 different hemagglutinin (H1, H2, or H3) and 2 different neuraminidase (N1 or N2) proteins have circulated widely in humans.

roteins, facilitating the release of progeny virions from infected cells. It is an important target for antiviral agents.11 Although all influenza A virus subtypes have been found in birds, only 3 different hemagglutinin (H1, H2, or H3) and 2 different neuraminidase (N1 or N2) proteins have circulated widely in humans. A Constantly Changing Virus The antigenic characteristics of influenza virus change gradually by accumulation of point mutations (antigenic drift) or profoundly by genetic reassortment (antigenic shift) in the genes encoding primarily hemagglutinin and neuraminidase. During antigenic drift, mutations occur because of the lack of the proofreading activity of viral RNA polymerases. As a consequence, new antigenic variants emerge constantly, allowing the virus to evade immune recognition and giving rise to annual epidemics. The antigenic drift of influenza viruses requires the replacement of influenza strains used in the vaccine every several years.12 During antigenic shift, new strains appear to which most humans have no immunity and that have the potential to cause severe global outbreaks of human influenza. These pandemic strains derive from nonhuman viruses by interspecies transmission of the whole virus or by genetic reassortment between avian and human viruses that have infected a single cell. Pigs have receptors for both avian and human influenza viruses and have been considered an intermediate host for the reassortment of influenza viruses. Reemergence of a previously circulating virus to which most of the population is immunologically naive is another mechanism by which pandemic strains can occur.13

cell. Pigs have receptors for both avian and human influenza viruses and have been considered an intermediate host for the reassortment of influenza viruses. Reemergence of a previously circulating virus to which most of the population is immunologically naive is another mechanism by which pandemic strains can occur.13 The nomenclature of influenza viruses includes the type of virus (A, B, or C), host of origin (excluding humans), geographical site of origin, strain number, and year of isolation, followed in parentheses by the antigenic description of the hemagglutinin and neuraminidase glycoproteins, eg, A/chicken/Hong Kong/258/97 (H5N1).

menclature of influenza viruses includes the type of virus (A, B, or C), host of origin (excluding humans), geographical site of origin, strain number, and year of isolation, followed in parentheses by the antigenic description of the hemagglutinin and neuraminidase glycoproteins, eg, A/chicken/Hong Kong/258/97 (H5N1). Interspecies Transmission Avian influenza viruses do not replicate efficiently in humans, which suggested initially that direct avian-to-human transmission would not occur. The hemagglutinins of avian strains bind preferentially to host receptors terminating in an α(2,3)-linked sialic acid, whereas human strains bind preferentially to receptors terminating in an α(2,6)-linkage. The predominance of these receptors in different tissues partly reflects the tropism of influenza in different species.5 Receptor specificity and inability of efficient replication in vivo were believed to provide a barrier against human infection by avian influenza virus. High doses of avian influenza virus strains were required for replication in volunteers. The first human infections by avian H5N1 virus in Hong Kong in 1997 showed that receptor specificity was not a definitive host restriction factor.14 In this epidemic, an intermediate host was not necessary for transmission of avian strains to humans.

influenza virus strains were required for replication in volunteers. The first human infections by avian H5N1 virus in Hong Kong in 1997 showed that receptor specificity was not a definitive host restriction factor.14 In this epidemic, an intermediate host was not necessary for transmission of avian strains to humans. AVIAN INFLUENZA IN ANIMALS Influenza in Wild Animals All birds are thought to be susceptible to infection with avian influenza viruses. Wild waterfowl and migrating bird populations provide an extensive natural reservoir for influenza A viruses (Figure 1 ).15 The virus multiplies in the intestines of these birds, particularly in wild ducks, and they can carry the virus without developing signs of infection, indicating an optimal level of viral adaptation in these hosts. Therefore, influenza is not an eradicable disease, and prevention and control of outbreaks are the only realistic goals.16 Unlike mammalian influenza virus strains, avian viruses have shown little antigenic variability during the past decades. The high level of genetic conservation suggests that avian viruses have reached an evolutionary stage in which antigenic changes provide no selective advantage.Figure 1 Wild aquatic birds are the main reservoir for influenza A viruses, from which viruses can be transmitted to other hosts such as horses, pigs, poultry, whales, seals, and humans. As indicated by arrows, humans can also be infected by pigs and poultry.

ge in which antigenic changes provide no selective advantage.Figure 1 Wild aquatic birds are the main reservoir for influenza A viruses, from which viruses can be transmitted to other hosts such as horses, pigs, poultry, whales, seals, and humans. As indicated by arrows, humans can also be infected by pigs and poultry. Infected birds excrete large amounts of virus in respiratory secretions, saliva, and feces. In the Northern Hemisphere, the prevalence of avian influenza peaks between late summer and early winter when the birds leave their breeding grounds and migrate; up to 30% of these birds may excrete virus.15 Water sources that are contaminated by wild bird droppings and used by domestic poultry are a common and efficient means of viral spread. Migratory birds are capable of flying long distances, and those migrating longitudinally appear to play a key role in viral transmission.7

to 30% of these birds may excrete virus.15 Water sources that are contaminated by wild bird droppings and used by domestic poultry are a common and efficient means of viral spread. Migratory birds are capable of flying long distances, and those migrating longitudinally appear to play a key role in viral transmission.7 Influenza in Domestic Animals The fowl plague was first described in 1878 as a disease affecting chickens in Italy. The causative agent was isolated from a chicken in 1902, which was the first identified influenza virus (the human influenza virus was not identified until 1933). Domestic poultry flocks are highly vulnerable to avian influenza, particularly birds that are raised outdoors. Once introduced into domestic flocks, the virus can spread among farms via contaminated inanimate objects, contributing to the rapid evolution of epidemics. Avian influenza in birds is characterized by a wide spectrum of symptoms, ranging from a mild illness to a highly contagious, severe, and rapidly fatal disease with a mortality rate approaching 100%. The latter syndrome was formerly known as fowl plague; it is now termed highly pathogenic avian influenza and is characterized by coughing, sneezing, excessive lacrimation, cyanosis of the unfeathered skin, edema of the head, ruffled feathers, diarrhea, nervous system disorders, or sudden death without clinical signs.15 In the past, most outbreaks of highly pathogenic avian influenza in poultry have been due to subtypes H5 or H7.

characterized by coughing, sneezing, excessive lacrimation, cyanosis of the unfeathered skin, edema of the head, ruffled feathers, diarrhea, nervous system disorders, or sudden death without clinical signs.15 In the past, most outbreaks of highly pathogenic avian influenza in poultry have been due to subtypes H5 or H7. Epidemics of avian influenza among poultry have produced serious economic consequences.7 In addition to a highly pathogenic avian influenza, viruses of low pathogenicity resulting in mild respiratory symptoms and reduced egg production can cause substantial economic losses. In 1995, 178 turkey farms in Minnesota were affected by influenza virus H9N2, resulting in an economic loss of approximately $6 million.15 Moreover, avian influenza viruses of low pathogenicity can mutate into highly pathogenic viruses after circulating for several months. During the 1999-2001 epidemic in Italy, the H7N1 virus mutated within 9 months to a highly pathogenic form, and more than 13 million birds died or were culled.1

roximately $6 million.15 Moreover, avian influenza viruses of low pathogenicity can mutate into highly pathogenic viruses after circulating for several months. During the 1999-2001 epidemic in Italy, the H7N1 virus mutated within 9 months to a highly pathogenic form, and more than 13 million birds died or were culled.1 Since 1997, outbreaks of highly pathogenic avian influenza have increased in frequency and severity, and the number of novel strains suggests that the next influenza pandemic is imminent.9 In 2004, outbreaks of highly pathogenic avian influenza occurred among chickens at farms in Delaware, Pennsylvania, Texas, and Maryland. The diseased and exposed birds were killed, and a quarantine zone was implemented around the affected farms. On February 20, 2004, H5N1 infection was confirmed in 2 dead domestic cats and in a tiger in a zoo in Thailand. To date, these animals have not been considered susceptible to influenza viruses. This raises concern about the need for surveillance in animals other than birds.1

e was implemented around the affected farms. On February 20, 2004, H5N1 infection was confirmed in 2 dead domestic cats and in a tiger in a zoo in Thailand. To date, these animals have not been considered susceptible to influenza viruses. This raises concern about the need for surveillance in animals other than birds.1 Breeding Ground for Avian Influenza Since the late 1970s, live poultry markets have been considered the source of human influenza viruses. These permanent live animal markets (wet markets) are embedded strongly in the food culture of Asian countries. Close human contact with live animals provides an ideal environment for the zoonotic transfer and evolution of infectious disease agents.17 The most important control measure for containing the outbreak in Hong Kong in 1997 was rapid destruction of the entire poultry population, proper disposal of carcasses, and rigorous disinfection of farms. To reduce the risk of reemergence of avian influenza, all aquatic birds were removed from retail markets, including ducks, geese, and quails (source of the H5N1 strain). Monthly “clean days” were introduced when all markets are emptied and cleaned simultaneously. New regulations mandate quarantine of poultry in designated farms in mainland China for 5 days and testing for H5 infection before importation to Hong Kong.18 Other control measures include continuous surveillance of influenza virus strains in humans and in birds, careful protection of cullers through appropriate personal protective equipment, restrictions on the movement of live poultry, and use of the human influenza vaccine to reduce the risk of coinfection in poultry workers and cullers.4

ures include continuous surveillance of influenza virus strains in humans and in birds, careful protection of cullers through appropriate personal protective equipment, restrictions on the movement of live poultry, and use of the human influenza vaccine to reduce the risk of coinfection in poultry workers and cullers.4 HUMAN INFLUENZA Severe Influenza Pandemics Throughout History A global outbreak of influenza usually occurs when a new influenza virus emerges, spreads, and causes disease worldwide.13 Descriptions of widespread and serious epidemics of respiratory disease suggestive of influenza have been recorded for centuries. Hippocrates in ancient Greece described the first case of influenza-like illness. In the 20th century, 4 human influenza pandemics emerged with intervals of 9 to 39 years .14 The Spanish influenza of 1918-1919 (H1N1) was the most devastating pandemic in recorded human history, resulting in 25 to 50 million deaths worldwide; nearly half of those who died were healthy young adults. This figure is at least double the number of soldiers killed on the battlefields of Europe during World War I. Other less catastrophic pandemics occurred in 1957 (Asian influenza), 1968 (Hong Kong influenza), and 1977 (Russian influenza). The Asian (H2N2) and Hong Kong (H3N2) pandemic strains were generated by reassortment between human and avian viral genes. The Russian influenza virus (H1N1) circulated in the 1950s and reemerged in 1977. The illness occurred almost exclusively among persons younger than 20 years. The relatively low mortality rate associated with this pandemic can be attributed to the immunity of older individuals who had antibodies from their previous exposure to nearly identical viruses.7

circulated in the 1950s and reemerged in 1977. The illness occurred almost exclusively among persons younger than 20 years. The relatively low mortality rate associated with this pandemic can be attributed to the immunity of older individuals who had antibodies from their previous exposure to nearly identical viruses.7 Transmission of Avian Influenza Viruses to Humans To date, human infection with avian influenza viruses has been confirmed on several occasions (Table 1 ). In 1997, the first documented direct transmission of an avian influenza virus to humans occurred in Hong Kong, when an H5N1 strain caused a severe respiratory disease in 18 previously healthy young adults, 6 of whom died.3 The outbreak in Hong Kong was controlled by the destruction of the entire poultry population; within 3 days, more than 1.5 million chickens were killed. In 1999, avian influenza H9N2 viruses were isolated for the first time in humans; 2 children were hospitalized with uncomplicated upper respiratory tract infection in Hong Kong, and both recovered completely.19 In May 2001 and in February and April 2002, the poultry stocks in Hong Kong were again destroyed when the highly pathogenic H5N1 virus reemerged in flocks. However, no more human cases of H5N1 influenza were identified until February 2003, when 2 cases were confirmed in 2 Hong Kong residents after travel to China, 1 of whom died.19 In February 2003, a large outbreak of H7N7 avian influenza occurred in poultry farms in the Netherlands.20 The virus caused mild illness in several farm workers, but a veterinarian who had visited an affected farm died of pneumonia. The virus isolated from the fatal case displayed 14 amino acid substitutions, which possibly contributed to the increased disease severity. All farm workers received mandatory influenza vaccination and prophylaxis with oseltamivir.21 The H7N7 poultry outbreak subsequently spread to Germany and Belgium but was eventually controlled by destruction of more than 30 million domestic poultry. In February 2004, another outbreak of H7N7 avian influenza occurred on a poultry farm in British Columbia, Canada, and resulted in at least 5 humans with infection, mainly conjunctivitis.1 Recently, the crystal structure of the hemagglutinin from the 1918 virus was determined, explaining why this virus was able to spread efficiently in the human population despite retainment of the avian receptor-binding site.6 Table 1 Human Influenza Pandemics in the 20th Century

with infection, mainly conjunctivitis.1 Recently, the crystal structure of the hemagglutinin from the 1918 virus was determined, explaining why this virus was able to spread efficiently in the human population despite retainment of the avian receptor-binding site.6 Table 1 Human Influenza Pandemics in the 20th Century No. of deaths Year Colloquial name Subtype Country of origin Origin of viral genes Worldwide United States 1918-1919 Spanish flu* H1N1 China? Europe? North America? Unclear, contains mammalian and avian genes 25-50 million >500,000 1957 Asian flu H2N2† China Reassortment with avian virus >1 million About 70,000 1968 Hong Kong flu H3N2† China Reassortment with avian virus >1 million About 34,000 1977 Russian flu‡ H1N1† China, Russia Reappearance of 1950s H1N1 virus (from frozen source?) Low mortality Low mortality * Many people died within the first few days after infection, nearly half of whom were healthy young adults. † Virus is still circulating. ‡ Illness occurred almost exclusively among persons younger than 20 years. This pandemic did not increase mortality.

No. of deaths Year Colloquial name Subtype Country of origin Origin of viral genes Worldwide United States 1918-1919 Spanish flu* H1N1 China? Europe? North America? Unclear, contains mammalian and avian genes 25-50 million >500,000 1957 Asian flu H2N2† China Reassortment with avian virus >1 million About 70,000 1968 Hong Kong flu H3N2† China Reassortment with avian virus >1 million About 34,000 1977 Russian flu‡ H1N1† China, Russia Reappearance of 1950s H1N1 virus (from frozen source?) Low mortality Low mortality * Many people died within the first few days after infection, nearly half of whom were healthy young adults. † Virus is still circulating. ‡ Illness occurred almost exclusively among persons younger than 20 years. This pandemic did not increase mortality. Human-to-Human Transmission Epidemiological studies suggest that most human H5N1 infections resulted from contact with infected birds or surfaces contaminated with their excretions. However, evidence of limited human-to-human transmission of avian influenza viruses has occurred (Table 2 ). A case-control study of 15 patients hospitalized for influenza virus H5N1 disease in 1997 was conducted in Hong Kong.22 Exposure to live poultry in the week before the onset of illness was significantly associated with H5N1 disease, whereas traveling, eating, or preparing poultry products and recent exposure to persons with respiratory illness showed no significant association. In a cohort study including 3 hospitals in Hong Kong at which patients infected with H5N1 strains had been admitted, a significantly higher seropositivity rate for H5N1 was found among exposed health care workers (3.7%) than among nonexposed ones (0.7%), providing epidemiological evidence of transmission from infected patients to health care workers.23 In the Netherlands in 2003, 3 family members of farm workers were infected during the H7N7 outbreak, demonstrating the ability of human-to-human transmission.20 Table 2 Confirmed Human Infections With Avian Influenza Viruses

iding epidemiological evidence of transmission from infected patients to health care workers.23 In the Netherlands in 2003, 3 family members of farm workers were infected during the H7N7 outbreak, demonstrating the ability of human-to-human transmission.20 Table 2 Confirmed Human Infections With Avian Influenza Viruses Year Country Subtype Characteristics 1997 Hong Kong* H5N1 18 people were infected, 6 of whom died 1999 Hong Kong H9N2 Virus was isolated from 2 children with mild influenza-like symptoms; both recovered 2003 Hong Kong H5N1 Infection occurred among 2 family members after returning from China, 1 of whom died; source of infection remains uncertain 2003 The Netherlands* H7N7 Infection occurred in 83 humans (mostly conjunctivitis), 1 of whom died 2003 Hong Kong H9N2 Child was hospitalized with influenza symptoms and recovered 2003 Several Asian countries*† H5N1 This is the largest outbreak of avian influenza in poultry ever reported 2004 British Columbia, Canada H7N7 Infection (mostly conjunctivitis) occurred in 5 humans * Limited person-to-person transmission occurred. † As of March 8, 2004, outbreaks in poultry have been confirmed in 8 countries: Cambodia, China, Indonesia, Japan, Laos, South Korea, Thailand, and Vietnam. In most of these countries, this is the first outbreak of avian influenza.

Year Country Subtype Characteristics 1997 Hong Kong* H5N1 18 people were infected, 6 of whom died 1999 Hong Kong H9N2 Virus was isolated from 2 children with mild influenza-like symptoms; both recovered 2003 Hong Kong H5N1 Infection occurred among 2 family members after returning from China, 1 of whom died; source of infection remains uncertain 2003 The Netherlands* H7N7 Infection occurred in 83 humans (mostly conjunctivitis), 1 of whom died 2003 Hong Kong H9N2 Child was hospitalized with influenza symptoms and recovered 2003 Several Asian countries*† H5N1 This is the largest outbreak of avian influenza in poultry ever reported 2004 British Columbia, Canada H7N7 Infection (mostly conjunctivitis) occurred in 5 humans * Limited person-to-person transmission occurred. † As of March 8, 2004, outbreaks in poultry have been confirmed in 8 countries: Cambodia, China, Indonesia, Japan, Laos, South Korea, Thailand, and Vietnam. In most of these countries, this is the first outbreak of avian influenza. CURRENT OUTBREAK OF H5N1 INFLUENZA IN ASIA Chronology of Events The present epidemic of highly pathogenic avian influenza virus in Asia is historically unprecedented and extremely challenging.4 Between December 5 and 11 in 2003, sudden death occurred in 19,000 chickens at a farm near Seoul, South Korea; this was later confirmed as being caused by the highly pathogenic avian influenza virus H5N1. On January 8, 2004, authorities in Vietnam also reported several outbreaks of avian influenza H5N1 at farms in the southern provinces. Human cases of H5N1 avian influenza presenting as severe respiratory illness occurred, with a mortality rate of more than 70%. On January 11, 2004, the World Health Organization alerted the Global Outbreak Alert and Response Network to support health authorities in the epidemiological investigation and containment of human cases. These H5N1 viruses are substantially different from the H5N1 viruses in outbreaks in Hong Kong in 1997 and 2003, indicating that the virus has mutated. On January 23, 2004, authorities in Thailand reported an outbreak of highly pathogenic avian influenza among poultry, with laboratory-confirmed cases of H5N1 infection in humans.24 Japan, the European Union, the United States, and other major export markets banned import of poultry products from the affected Asian countries.

uary 23, 2004, authorities in Thailand reported an outbreak of highly pathogenic avian influenza among poultry, with laboratory-confirmed cases of H5N1 infection in humans.24 Japan, the European Union, the United States, and other major export markets banned import of poultry products from the affected Asian countries. Clinical Features Preliminary clinical data from 10 confirmed human cases of H5N1 avian influenza from the current epidemic in Vietnam were summarized recently.25 The mean age of the patients was 13.7 years (range, 5-24 years); none had any clinically important preexisting medical conditions. Of the 10 patients, 9 had a history of direct contact with poultry (chicken or ducks), with a median time before onset of illness of 3 days (range, 2-4 days). The main clinical features were fever, shortness of breath, cough, and diarrhea. Notably, sore throat, coryza, and conjunctivitis were absent. All patients presented with pronounced lymphopenia (mean lymphocyte count, 0.7 × 109/L) and important chest radiographic abnormalities including diffuse, multifocal, or patchy infiltrates or segmental or lobular consolidation. Eight of the 10 patients (80%) died after a mean of 10 days of illness. The clinical features, together with liver dysfunction, renal failure, coagulopathy, and pancytopenia seen in the 1997 Hong Kong H5N1 outbreak, are similar to those seen in patients with severe acute respiratory syndrome.

or lobular consolidation. Eight of the 10 patients (80%) died after a mean of 10 days of illness. The clinical features, together with liver dysfunction, renal failure, coagulopathy, and pancytopenia seen in the 1997 Hong Kong H5N1 outbreak, are similar to those seen in patients with severe acute respiratory syndrome. Similarly, human infection with avian influenza H5N1 reported in 1997 in Hong Kong presented as an influenzalike illness with pneumonia.26 Reactive hemophagocytic syndrome was the most characteristic pathologic finding and probably contributed to the lymphopenia, liver dysfunction, and abnormal clotting profiles that were observed among these patients.27 Gastrointestinal manifestations, renal failure unrelated to rhabdomyolysis, and pancytopenia were unusually prominent. Factors associated with severe disease included older age, delay in hospitalization, lower respiratory tract involvement, and leukopenia or lymphopenia at admission. The preliminary findings suggest that cytokine dysfunction contributes to the severity of H5N1 disease.19 There is no evidence of H5N1 virus replication outside the respiratory tract. Viral replication seems to trigger a burst of cytokine production that may ultimately result in multiorgan failure.

openia at admission. The preliminary findings suggest that cytokine dysfunction contributes to the severity of H5N1 disease.19 There is no evidence of H5N1 virus replication outside the respiratory tract. Viral replication seems to trigger a burst of cytokine production that may ultimately result in multiorgan failure. LABORATORY DIAGNOSIS All patients who present to a health care setting with fever and respiratory symptoms should be questioned regarding their recent travel and exposure history.8 In patients at risk for avian influenza H5N1, laboratory testing is indicated (Table 3 ). The optimal specimen for influenza virus detection is a nasopharyngeal aspirate obtained within 3 days of the onset of symptoms; however, nasopharyngeal swabs and other specimens can be used. The H5N1 influenza virus can be detected by rapid antigen tests, virus culture, and reverse transcriptase-polymerase chain reaction (RT-PCR). At least 6 rapid antigen detection assays are commercially available and provide results in 15 to 30 minutes but are not as sensitive or specific as virus culture or RT-PCR.10 Virus isolation in cell cultures enables further antigenic and genetic characterization, drug susceptibility testing, and vaccine preparation. However, cultures take 2 to 10 days and must be performed under Biosafety Level 3+ laboratory conditions. Conventional and real-time PCR assays detect diverse influenza type A viruses, including the avian H5N1 strains.28, 29 Polymerase chain reaction primers are directed to the conserved matrix gene of the virus, and therefore this assay would be expected to detect recombinant avian strains of the virus. Of emphasis, avian influenza virus may be recombinant strains of the virus and may not contain the essential genes for replication in laboratory cultures.14 Rapid antigen detection and RT-PCR can be performed with standard Biosafety Level 2 laboratory conditions in a class II biological safety cabinet. Serologic diagnosis of influenza is based on the detection of a 4-fold or greater increase in specific antibody titer in paired serum samples; the first should be collected as soon as possible after onset of illness and the second, 10 to 14 days later. This limits the usefulness of serology in the diagnosis and treatment of acute illness.Table 3 Indications for Laboratory Testing for Avian Influenza H5N18

se in specific antibody titer in paired serum samples; the first should be collected as soon as possible after onset of illness and the second, 10 to 14 days later. This limits the usefulness of serology in the diagnosis and treatment of acute illness.Table 3 Indications for Laboratory Testing for Avian Influenza H5N18 Testing is indicated for hospitalized patients with Radiographically confirmed pneumonia, acute respiratory distress syndrome, or other severe respiratory illness for which an alternate diagnosis has not been established and History of travel to a country with documented H5N1 avian influenza within 10 days of symptom onset Testing should be considered on a case-by-case basis in consultation with state and local health departments for hospitalized or ambulatory patients with Temperature >38°C (>100.4°F) and One or more of the following: cough, sore throat, shortness of breath and History of contact with domestic poultry (eg, visited a poultry farm, household raising poultry, or bird market) or a known or suspected human case of influenza H5N1 in an H5N1-affected country within 10 days of symptom onset

Testing should be considered on a case-by-case basis in consultation with state and local health departments for hospitalized or ambulatory patients with Temperature >38°C (>100.4°F) and One or more of the following: cough, sore throat, shortness of breath and History of contact with domestic poultry (eg, visited a poultry farm, household raising poultry, or bird market) or a known or suspected human case of influenza H5N1 in an H5N1-affected country within 10 days of symptom onset ANTIVIRAL TREATMENT The current H5N1 strains are resistant to amantadine and rimantadine but are susceptible to neuraminidase inhibitors (oseltamivir and zanamivir). These drugs are effective for prophylaxis and treatment of influenza A virus infection, including the avian influenza H5N1. However, no efficacy trials have been performed due to the small number of human cases. Because a potential vaccine may be in short supply, antiviral drugs may play an important role in reducing the severity and spread of infection during the first stages of a pandemic.32 For prophylaxis, oseltamivir should be administered to individuals exposed to H5N1 avian influenza within 48 hours. Therefore, a global influenza strategy in the 21st century calls for stockpiling antiviral drugs and drafting plans for rapid distribution.9

nd spread of infection during the first stages of a pandemic.32 For prophylaxis, oseltamivir should be administered to individuals exposed to H5N1 avian influenza within 48 hours. Therefore, a global influenza strategy in the 21st century calls for stockpiling antiviral drugs and drafting plans for rapid distribution.9 PREVENTION General Precautions In geographic areas affected by avian influenza, individuals should avoid contact with poultry, and they should perform thorough and frequent hand hygiene using soap and water or alcohol-based hand rubs. The virus is killed by heat (56°C for 3 hours, 60°C for 30 minutes, or 70°C for 1 minute) and common disinfectants such as alcohol, bleach, formalin, or iodine compounds. Generally, 5% bleach solution is appropriate for dealing with biohazardous spillage. Influenza virus can survive in feces for several months. It can survive in water for up to 4 days at 22°C, for more than 30 days at 0°C, and indefinitely in frozen material.1 Therefore, poultry, including the eggs, should be cooked thoroughly. Recently, the Centers for Disease Control and Prevention issued guidelines for airline flight crews and persons meeting passengers arriving from areas with avian influenza.30 Protection of persons involved in outbreak eradication activities includes strict adherence to hand hygiene practices and the use of appropriate personal protective equipment (gloves, disposable clothing, shoe covers, safety goggles, and particulate respirators).30 During handling of human specimens, formation of aerosols and droplets should be minimized.

break eradication activities includes strict adherence to hand hygiene practices and the use of appropriate personal protective equipment (gloves, disposable clothing, shoe covers, safety goggles, and particulate respirators).30 During handling of human specimens, formation of aerosols and droplets should be minimized. Patient Isolation Isolation precautions identical to those recommended for severe acute respiratory syndrome should be implemented for all hospitalized patients diagnosed as having or being evaluated for avian influenza H5N1 (Table 4 ).31 These precautions should be continued for 14 days after onset of symptoms, until an alternative diagnosis is established, or until diagnostic test results indicate that the patient is not infected with influenza A virus. Patients managed as outpatients or hospitalized patients discharged before 14 days should be isolated in the home setting.30 Table 4 Isolation Precautions for Patients Hospitalized With Suspected or Confirmed Avian Influenza H5N1*8 Standard precaution Strict hand hygiene before and after all patient contacts Contact precautions Use gloves and gown for all patient contact Eye protection Wear when within 3 feet (1 m) of the patient Airborne precautions Place the patient in an airborne isolation room (ie, monitored negative air pressure in relationship to the surrounding areas with 6 to 12 air changes per hour) Use a fit-tested respirator, at least as protective as an NIOSH-approved N-95 filtering facepiece respirator, when entering the room * NIOSH = National Institute of Occupational Safety and Health.

Airborne precautions Place the patient in an airborne isolation room (ie, monitored negative air pressure in relationship to the surrounding areas with 6 to 12 air changes per hour) Use a fit-tested respirator, at least as protective as an NIOSH-approved N-95 filtering facepiece respirator, when entering the room * NIOSH = National Institute of Occupational Safety and Health. Vaccine Development The current inactivated trivalent human influenza vaccine provides no protection against the H5 and H7 avian influenza strains. However, an important control measure is providing the seasonal human influenza vaccine to people at risk for avian influenza to reduce the risk of coinfection with avian and human influenza viruses simultaneously and to decrease the possibility of reassortment. The resultant hybrid virus could be highly transmissible among humans.

mportant control measure is providing the seasonal human influenza vaccine to people at risk for avian influenza to reduce the risk of coinfection with avian and human influenza viruses simultaneously and to decrease the possibility of reassortment. The resultant hybrid virus could be highly transmissible among humans. A prototype virus and candidate vaccines have been developed for protection against the H5N1 virus strain that infected 2 people and resulted in 1 death in Hong Kong in 2003.2 However, the avian subtypes are rapidly lethal to chicken embryos, and therefore the traditional chicken embryo method is not applicable. Alternative means of producing H5 and H7 vaccines were exploited, including the plasmid-based reverse genetic technology.9 A vaccine strain can be created by merging selected hemagglutinin and neuraminidase genes from the target virus with a laboratory virus. The resulting virus is recognized by the human immune system and causes a protective immune response but no disease. However, such vaccines have yet to be studied in clinical trials, and safety testing must be completed.

rging selected hemagglutinin and neuraminidase genes from the target virus with a laboratory virus. The resulting virus is recognized by the human immune system and causes a protective immune response but no disease. However, such vaccines have yet to be studied in clinical trials, and safety testing must be completed. CONCLUSION The occurrence of avian influenza H5N1 in humans is another reminder of our vulnerability to an emerging pandemic. Several measures can help to minimize the global public health risk. An immediate priority is to halt further spread of epidemics in poultry populations that would reduce the opportunities for human exposure to the virus. Clinicians should be cognizant of human influenza H5N1 infection among patients with the appropriate epidemiological exposure, so that patients can be identified quickly and managed appropriately and health care workers can be protected. The reemergence of H5N1 influenza in humans emphasizes the need to develop a vaccine against this virus. World Health Organization www.who.int/en/ Centers for Disease Control and Prevention www.cdc.gov/ World Organization for Animal Health www.oie.int/eng/en_index.htm Animal and Plant Health Inspection Service, US Department of Agriculture www.aphis.usda.gov/ Food and Agriculture Organization of the United Nations www.fao.org/ Questions About Avian Influenza 1. Which one of the following statements about avian influenza viruses is false? a. Viruses are divided into subtypes on the basis of surface glycoproteins hemagglutinin and neuraminidase

World Health Organization www.who.int/en/ Centers for Disease Control and Prevention www.cdc.gov/ World Organization for Animal Health www.oie.int/eng/en_index.htm Animal and Plant Health Inspection Service, US Department of Agriculture www.aphis.usda.gov/ Food and Agriculture Organization of the United Nations www.fao.org/ Questions About Avian Influenza 1. Which one of the following statements about avian influenza viruses is false? a. Viruses are divided into subtypes on the basis of surface glycoproteins hemagglutinin and neuraminidase b. Receptor specificity is an absolute barrier against human infection by avian influenza viruses c. The H5N1 avian influenza subtype mutates rapidly and has the propensity to acquire genes from viruses infecting other species d. Migratory aquatic birds are the natural reservoir of avian influenza viruses e. Transmission by feces provides an efficient way for wild birds to spread viruses 2. Which one of the following subtypes of influenza viruses is responsible for the current avian influenza outbreak in Asia? a. H5N2 b. H9N2 c. H5N1 d. H7N7 e. H3N2 3. Which one of the following human influenza out-breaks was the most devastating in recorded human history? a. Spanish influenza of 1918-1919 (H1N1) b. Asian influenza in 1957 (H2N2) c. Hong Kong influenza in 1968 (H3N2) d. Russian influenza in 1977 (H1N1) e. Hong Kong avian influenza in 1997 (H5N1) 4. Which one of the following statements about the current H5N1 avian influenza outbreak in Asia is true? a. Most human cases of avian influenza presented with conjunctivitis and/or mild upper respiratory tract symptoms

c. Hong Kong influenza in 1968 (H3N2) d. Russian influenza in 1977 (H1N1) e. Hong Kong avian influenza in 1997 (H5N1) 4. Which one of the following statements about the current H5N1 avian influenza outbreak in Asia is true? a. Most human cases of avian influenza presented with conjunctivitis and/or mild upper respiratory tract symptoms b. No evidence exists for direct human-to-human transmission of avian influenza virus c. The avian influenza virus is killed by freezing at −20°C d. The optimal specimen for influenza virus detection is a nasopharyngeal aspirate obtained within 3 days of the onset of symptoms e. The first documented human infection by avian influenza viruses occurred in mainland China in 2003 5. Which one of the following isolation precautions is not recommended for hospitalized patients being evaluated for avian influenza? a. Strict hand hygiene before and after all patient contact b. Use of gloves and gown for all patient contact c. Use of eye protection when within 3 feet (1 m) of the patient d. Use of shoe covers when entering the isolation room e. Placement of the patient in an airborne isolation room Correct answers: 1. b, 2. c, 3. a, 4. d, 5. d A question-and-answer section appears at the end of this article.

PATHOLOGY Multiple sclerosis (MS) affects scattered areas of the central nervous system with a predilection for periventricular white matter, brainstem, spinal cord, and optic nerves.1 The plaques are characterized by primary demyelination (destruction of myelin sheaths with preservation of axons) and death of oligodendrocytes (myelin-producing cells) within the center of the lesion. During the early evolution of the plaque, perivascular inflammatory cells (lymphocytes, plasma cells, macrophages) invade the substance of the white matter and are thought to play a critical role in myelin destruction.2 This process is followed by extensive gliosis by astrocytes and aberrant attempts at remyelination with oligodendrocytes proliferating at the edges of the plaque.1 In addition, immunoglobulins are deposited within each plaque.3 Whether the principal effector cells that mediate demyelination are T cells or macrophages is unknown. Attempts to type the cells that infiltrate the brain in MS have yielded conflicting results.4, 5, 6, 7 Both CD8+ (cytotoxic/suppressor) T lymphocytes and CD4+ (helper/inducer) T lymphocytes surround the MS plaque. The relative proportions of T-cell subsets are controversial. Some investigators have found an excess of CD8+ cells in the perivascular cuffs at the edge of the lesion.7 Others have found an excess of CD4+ cells.4 These discrepancies probably result from examination of the plaques at different stages of their evolution.

he relative proportions of T-cell subsets are controversial. Some investigators have found an excess of CD8+ cells in the perivascular cuffs at the edge of the lesion.7 Others have found an excess of CD4+ cells.4 These discrepancies probably result from examination of the plaques at different stages of their evolution. Recent experiments have analyzed antigens of the major histocompatibility complex (MHC) in the brains of patients with MS.8 The MHC is a set of closely linked genes that play a central role in the control of immune responses to self and foreign antigens. This function is of particular importance because CD4+ and CD8+ T cells recognize foreign antigen in the context of class II (HLA-DR, la) or class I (HLA-ABC) MHC gene products, respectively. The class II gene products, found primarily on macrophages and B cells, are important in presentation of antigen to T cells. Class I gene products are on the majority of cells in the body and are important in the generation of the cytotoxic response against viruses.

or class I (HLA-ABC) MHC gene products, respectively. The class II gene products, found primarily on macrophages and B cells, are important in presentation of antigen to T cells. Class I gene products are on the majority of cells in the body and are important in the generation of the cytotoxic response against viruses. The central nervous system is unique because MHC antigens normally are not present on neurons and glial cells.8 In MS, however, class I and class II MHC-positive astrocytes are found with high frequency in active lesions. The class I-reactive glia are primarily associated with T-cell infiltrates, whereas class II-reactive astrocytes are found in many lesions, independently of the composition of inflammatory cells. Thus, class I and II MHC-positive astrocytes might play a role in local antigen presentation to T cells. In addition, the simultaneous presence of high numbers of class I MHC-positive astrocytes and CD8+ cells in acute lesions suggests the possibility that CD8+ cells play a role as cytotoxic T cells during early development of the lesion. The final consequence—that is, demyelination—in chronic active plaques may be attributable to several immunologic mechanisms, including receptor-mediated endocytosis by macrophages, cytotoxicity by T cells, or lymphokine release.

The central nervous system is unique because MHC antigens normally are not present on neurons and glial cells.8 In MS, however, class I and class II MHC-positive astrocytes are found with high frequency in active lesions. The class I-reactive glia are primarily associated with T-cell infiltrates, whereas class II-reactive astrocytes are found in many lesions, independently of the composition of inflammatory cells. Thus, class I and II MHC-positive astrocytes might play a role in local antigen presentation to T cells. In addition, the simultaneous presence of high numbers of class I MHC-positive astrocytes and CD8+ cells in acute lesions suggests the possibility that CD8+ cells play a role as cytotoxic T cells during early development of the lesion. The final consequence—that is, demyelination—in chronic active plaques may be attributable to several immunologic mechanisms, including receptor-mediated endocytosis by macrophages, cytotoxicity by T cells, or lymphokine release. IMMUNOGENETICS AND IMMUNOLOGY One piece of evidence that provides an important clue to the pathogenesis of MS is the association between susceptibility and specific MHC haplotypes.9 Northern Caucasians with MS have an overrepresentation of the A3, B7, DR2, and Dw2 histocompatibility alleles with relative risks of 2 to 3 for the class I MHC alleles (A3, B7) and 4 to 5 for class II MHC alleles (DR2, Dw2). Because linkage disequilibria exist between these class I alleles and DR2, the possible increased representation of one group of alleles may merely reflect this phenomenon.

d Dw2 histocompatibility alleles with relative risks of 2 to 3 for the class I MHC alleles (A3, B7) and 4 to 5 for class II MHC alleles (DR2, Dw2). Because linkage disequilibria exist between these class I alleles and DR2, the possible increased representation of one group of alleles may merely reflect this phenomenon. The indefinite association between susceptibility and MHC haplotypes suggests that either more than one gene is involved or a strong environmental agent “breaks through” to disease in the absence of the MS susceptibility allele. The frequency of occurrence of A2, B12, DR7, and Dw7 is decreased in patients with MS.9 The data that pertain to this occurrence are in much better agreement, suggesting that some MHC alleles may protect against MS. Investigators have also reported that some MHC alleles (DR2) are associated with more progressive disease whereas others (DR3) are associated with more benign disease.10 Studies in various populations (American blacks, Japanese, Arabs, Israeli Jews) have also shown an association with MHC but with different alleles in each case.

ors have also reported that some MHC alleles (DR2) are associated with more progressive disease whereas others (DR3) are associated with more benign disease.10 Studies in various populations (American blacks, Japanese, Arabs, Israeli Jews) have also shown an association with MHC but with different alleles in each case. The risk of MS developing among first-degree relatives of patients with MS is increased 15- to 20-fold over the risk in the general population.9 This finding may reflect either genetic factors or shared environmental agents. Attempts to analyze linkage between disease and HLA haplotypes in siblings affected by MS have substantiated a loose link between MS and MHC but do not permit conclusions about the mode of inheritance.11 For more distant relatives, concordance for MS is lower but exceeds chance expectation. In contrast, for non-blood-relatives living together (for example, husband and wife), the concordance for MS is not increased above chance. Studies in twins have shown greater concordance between monozygotic twins than between dizygotic twins.12, 13, 14, 15 Many monozygotic pairs, however, are discordant for MS, a strong argument that genetic influence is insufficient for the development of MS. Also, the severity and expression of the disease vary greatly between members of concordant pairs.

concordance between monozygotic twins than between dizygotic twins.12, 13, 14, 15 Many monozygotic pairs, however, are discordant for MS, a strong argument that genetic influence is insufficient for the development of MS. Also, the severity and expression of the disease vary greatly between members of concordant pairs. Diseases that have been linked to the HLA complex have numerous similar features, including chronic course, inflammatory component, and weak genetic predisposition that does not obey mendelian genetics. One theory is that these disorders may have an autoimmune basis. The development of experimental autoimmune encephalomyelitis (EAE) as an animal model of MS has prompted investigation of the autoimmune basis of human demyelinating diseases.16 EAE can be induced by injection of central nervous system myelin or its components along with adjuvants. From the EAE model has evolved the concept that the primary target in MS may be myelin and not the oligodendrocyte.17 In addition, the disease can be transferred to naive animals with cells enriched for T lymphocytes reactive to the basic protein component of myelin.17, 18, 19 Therefore, attempts have been made to determine whether an immune response to normal myelin develops in patients with MS. To date, efforts to measure such a response in patients with MS have failed even though these responses can be detected in patients with postinfectious encephalomyelitis.20

nent of myelin.17, 18, 19 Therefore, attempts have been made to determine whether an immune response to normal myelin develops in patients with MS. To date, efforts to measure such a response in patients with MS have failed even though these responses can be detected in patients with postinfectious encephalomyelitis.20 Although certain immunologic abnormalities have been reported in MS, many of the findings are still controversial.21 CD8+ lymphocytes apparently are decreased in the blood of patients with active MS and in those with a progressive course,22, 23, 24, 25 a situation that leads to a relative increase in the CD4/CD8 ratio. Disease activity is not always associated with these T-cell changes, however. The data on T-cell subsets in the cerebrospinal fluid are more discordant.26, 27, 28 Some investigators have reported a corresponding decrease in CD8+ cells in the cerebrospinal fluid,28 whereas others have found no change.26, 27 Some investigators have argued that the loss of CD8+ cells from the blood represents a disorder of immunoregulation.22 Others have suggested that the imbalance is the result of preferential sequestration of CD8+ cells in the central nervous system or lymphoid organs.25

luid,28 whereas others have found no change.26, 27 Some investigators have argued that the loss of CD8+ cells from the blood represents a disorder of immunoregulation.22 Others have suggested that the imbalance is the result of preferential sequestration of CD8+ cells in the central nervous system or lymphoid organs.25 Recent experiments suggest a decrease in the suppressor/inducer subset (CD4+, 2H4+) in serum of patients with progressive MS.29 These suppressor/inducer cells are not found in the cerebrospinal fluid, an indication that the loss of such cells is not due to migration into the central nervous system. Suppressor T-cell function is also defective during active disease, as measured by concanavalin A-induced T-cell suppression30, 31 or by polyclonal IgG stimulation of peripheral blood mononuclear cells by pokeweed mitogen.32 Natural killer cell activity against tumor or virally infected targets may be decreased in MS,33 but these results have not been confirmed.34, 35

g active disease, as measured by concanavalin A-induced T-cell suppression30, 31 or by polyclonal IgG stimulation of peripheral blood mononuclear cells by pokeweed mitogen.32 Natural killer cell activity against tumor or virally infected targets may be decreased in MS,33 but these results have not been confirmed.34, 35 VIRUSES Attempts to identify a single infectious agent as the cause of MS have been unsuccessful thus far.36 Many infectious agents have been isolated in cultures of specimens from patients with MS, but the majority represent contaminants or noncausal agents. In addition, direct inoculation of brain material into primates, so successful in identifying a transferable agent in Creutzfeldt-Jakob disease, has been negative or inconclusive. The more sensitive technique of looking for “footprints” of virus infection in brain tissue by nucleic acid hybridization with radiolabeled DNA probes or RNA probes (riboprobes) complementary to viral genomes has suggested that some brains of subjects with MS harbor measles virus.37 The finding of measles virus genome in several control subjects without MS, however, suggested that viruses may reside in the nervous system without causing disease.37

olabeled DNA probes or RNA probes (riboprobes) complementary to viral genomes has suggested that some brains of subjects with MS harbor measles virus.37 The finding of measles virus genome in several control subjects without MS, however, suggested that viruses may reside in the nervous system without causing disease.37 Analysis of the cerebrospinal fluid of patients with MS shows increased IgG levels along with oligoclonal Ig bands.38, 39, 40 Attempts to identify the antigen to which the IgG is directed have been unsuccessful.40 In serum samples from patients with MS, titers of antibody to measles virus are increased.40, 41 In many patients with MS, however, antibody titers to two or more viruses are increased in the cerebrospinal fluid. In diseases that are known to be caused by a virus (subacute sclerosing panencephalitis [measles] and mumps meningitis), IgG and oligoclonal bands in the cerebrospinal fluid are directed almost exclusively against the infectious agent.42, 43 Because this is not the case with MS, some investigators have suggested that, in MS, the IgG in the central nervous system is “nonsense antibody” that represents a dysfunction in immune regulation. The alternative hypothesis is that the humoral immune response is to an unrecognized infectious agent that is the cause of MS.

use this is not the case with MS, some investigators have suggested that, in MS, the IgG in the central nervous system is “nonsense antibody” that represents a dysfunction in immune regulation. The alternative hypothesis is that the humoral immune response is to an unrecognized infectious agent that is the cause of MS. Two approaches to distinguish whether antibody is “nonsense” or “sense” have been used: analysis of banding patterns of IgG eluted from different MS plaques in the same patient44 and study of idiotypes (combining sites of antibody molecules) of the oligoclonal IgG in cerebrospinal fluid from multiple patients.45, 46 The first approach showed that each MS plaque may have unique IgG banding patterns. The second approach showed that anti-idiotypic antisera raised against cerebrospinal fluid IgG fail to cross-react with cerebrospinal fluid from other patients with MS. These results are consistent with the possibility that the antibody is, indeed, a “nonsense antibody.”

MS plaque may have unique IgG banding patterns. The second approach showed that anti-idiotypic antisera raised against cerebrospinal fluid IgG fail to cross-react with cerebrospinal fluid from other patients with MS. These results are consistent with the possibility that the antibody is, indeed, a “nonsense antibody.” An important impetus to continuation of the search for a viral cause for MS has come from study of several naturally occurring model diseases in animals in which viruses cause demyelination.47 These diseases include canine distemper virus (paramyxovirus) in dogs,48 visna virus (nononcogenic retrovirus) in sheep,49 JHM virus (coronavirus) in mice50 and rats,51 Semliki Forest virus (togavirus) in mice,52 and Theiler's virus (picornavirus) in mice.53 The mechanisms of the demyelination in these viral models are beginning to be understood. For example, in JHM virus infection in mice the demyelination seems to be the result of direct cytopathic injury of oligodendrocytes, the myelin-producing cells.50 In contrast, in rats the demyelination by JHM may be a consequence of autoimmune mechanisms by which sensitized T cells recognize myelin antigens.51 In visna virus, macrophages that are persistently infected are actively involved in the demyelinating process.53 With infection by Theiler's virus, viral antigens have been detected on the inner and outer glial loops of oligodendrocytes such that an immune response seems to be directed against viral or “novel” antigens on the surface of these glial cells.54, 55, 56 These experiments emphasize that viruses from different “families” may induce primary demyelination, probably by unique mechanisms.44

on the inner and outer glial loops of oligodendrocytes such that an immune response seems to be directed against viral or “novel” antigens on the surface of these glial cells.54, 55, 56 These experiments emphasize that viruses from different “families” may induce primary demyelination, probably by unique mechanisms.44 The recent discovery, in Japan57 and in the Caribbean,58 that chronic progressive myelopathy may be the result of persistent infection with human T-lymphotropic virus type I (HTLV-I) has stimulated speculation that viruses may be implicated in MS. Koprowski and associates59 reported that serum and spinal fluid samples from patients with MS in Sweden and in Key West, Florida, contained antibodies reactive with viral protein (p24) of HTLV-I. Others have failed to detect any antibody to HTLV-I, II, or III in patients with MS.60, 61 In Japan, however, investigators62 found that 11 of 46 patients with MS reacted to purified HTLV-I proteins by Western blot analysis. The discrepancies in the results may be due to differences in sensitivity of various methods. Recently, Reddy and associates63 amplified and molecularly cloned HTLV-I sequences from DNA of lymphocytes from patients with MS. Confirmation of these results by other investigators will be necessary before a firm statement can be made about its role in pathogenesis.

e to differences in sensitivity of various methods. Recently, Reddy and associates63 amplified and molecularly cloned HTLV-I sequences from DNA of lymphocytes from patients with MS. Confirmation of these results by other investigators will be necessary before a firm statement can be made about its role in pathogenesis. IMMUNE HYPOTHESES FOR THE CAUSE OF MS Several hypotheses have been proposed to explain the clinical and experimental features of this demyelinating disorder, three of which will be discussed. They are relevant to the possibility of an immune-mediated demyelination triggered by viral infection. Autoimmunity. The most widely considered hypothesis is that MS is the result of an immune reaction directed against self myelin antigens.64 T cells are thought to enter the central nervous system through endothelial cells and to react with normal white matter. The myelin antigens may be presented to helper T cells (CD4+) by endothelial cells65 or astrocytes,66 which are known to carry class II MHC antigens in MS lesions. As a result of T-cell activation, lymphokines and macrophages could mediate myelin destruction.3

gh endothelial cells and to react with normal white matter. The myelin antigens may be presented to helper T cells (CD4+) by endothelial cells65 or astrocytes,66 which are known to carry class II MHC antigens in MS lesions. As a result of T-cell activation, lymphokines and macrophages could mediate myelin destruction.3 This hypothesis is supported by elegant experiments, using EAE, that demonstrated that T-cell clones (CD4+) sensitized to myelin proteins can mediate demyelination in the central nervous system.18, 19 In addition, the linkage of the disease with class II MHC gene products (DR2) is further evidence that this mechanism may be important. A series of crucial experiments by Hafler and associates20 on T-cell clones isolated from the cerebrospinal fluid of patients with MS, however, failed to identify a single clone that was reactive for myelin antigens despite the ongoing demyelination. In contrast, myelin-reactive clones were demonstrated in patients with postinfectious encephalomyelitis.

Hafler and associates20 on T-cell clones isolated from the cerebrospinal fluid of patients with MS, however, failed to identify a single clone that was reactive for myelin antigens despite the ongoing demyelination. In contrast, myelin-reactive clones were demonstrated in patients with postinfectious encephalomyelitis. “Bystander” Hypothesis. One important hypothesis being considered is that in MS the myelin is an “innocent bystander” that is destroyed as a consequence of an immune response occurring within the nervous system.47 This hypothesis may help explain why different viruses can induce demyelination in the nervous system of rodents and why different “etiologic” agents have been isolated from MS-involved brains. The scenario would be that viruses or other infectious agents frequently invade the central nervous system. During the defense against this infection, T lymphocytes and macrophages are recruited to the lesion. Subsequently, in the process of clearance of virus by T cells, myelin is destroyed nonspecifically by lymphokines or neutral proteases released by activated macrophages.

ts frequently invade the central nervous system. During the defense against this infection, T lymphocytes and macrophages are recruited to the lesion. Subsequently, in the process of clearance of virus by T cells, myelin is destroyed nonspecifically by lymphokines or neutral proteases released by activated macrophages. Experiments by Wisniewski and Bloom67 support this hypothesis by demonstrating that animals previously sensitized to purified protein derivative (PPD) of tuberculin will undergo demyelination if challenged by this antigen in the nervous system. In addition, myelin basic protein can be degraded by neutral proteases in vitro.68 The concept of bystander demyelination, however, is not supported by the observation that demyelination is a rare consequence of an immune response to viral or fungal encephalitides. If bystander demyelination were more prominent, then demyelination would occur each time the immune system interacts with viruses that infect the central nervous system (that is, measles, mumps, and herpes). It may be argued, however, that genetic factors control whether specific lymphokines that could induce demyelination are released.

lination were more prominent, then demyelination would occur each time the immune system interacts with viruses that infect the central nervous system (that is, measles, mumps, and herpes). It may be argued, however, that genetic factors control whether specific lymphokines that could induce demyelination are released. Immune Destruction of Persistently Infected Oligodendrocytes. On the basis of the paradigm of demyelination in mice induced by Theiler's virus, Rodriguez and colleagues56 proposed that the demyelination in MS may be the result of immune-mediated destruction of virus-infected oligodendrocytes. This hypothesis would incorporate epidemiologic data (exogenous agent) and a contribution of immunogenetics to pathogenesis. Immunogenetic data in MS implicate that specific genes within the MHC protect against the development of MS. Genes may play a role in host resistance against the exogenous agent that is acquired early in life. In resistant hosts, viral antigens would be recognized in the context of class I or class II MHC gene products, and viral replication would be limited as a consequence of a protective immune response. Virus would be cleared from the central nervous system without long-term sequelae.

Immune Destruction of Persistently Infected Oligodendrocytes. On the basis of the paradigm of demyelination in mice induced by Theiler's virus, Rodriguez and colleagues56 proposed that the demyelination in MS may be the result of immune-mediated destruction of virus-infected oligodendrocytes. This hypothesis would incorporate epidemiologic data (exogenous agent) and a contribution of immunogenetics to pathogenesis. Immunogenetic data in MS implicate that specific genes within the MHC protect against the development of MS. Genes may play a role in host resistance against the exogenous agent that is acquired early in life. In resistant hosts, viral antigens would be recognized in the context of class I or class II MHC gene products, and viral replication would be limited as a consequence of a protective immune response. Virus would be cleared from the central nervous system without long-term sequelae. In susceptible hosts, absence of specific MHC gene products may result in failure of clearance of the virus; thus, the virus persists in glial cells. During the course of infection, the virus could infect oligodendrocytes in a manner such that novel antigens are present on the surface of these cells (Fig. 1 ). These novel antigens may be virus antigens or “up-regulated” normal host antigens that are seen as foreign in the context of specific MHC alleles. The virus itself may be capable of inducing demyelination by interfering with the function of the myelin-producing cell. The current evidence suggests, however, that immune cells must also play a role in demyelination because immunosuppression seems to have a favorable effect on the course of MS. The presence of a novel antigen on an oligodendrocyte or on myelin could result in immunoglobulin-directed killing (injury by complement, antibody-dependent cell-mediated cytotoxicity, or activation of macrophages). Processed viral antigens may be recognized by CD8+ cells (class I-restricted cytotoxic T cells) or CD4+ cells (class II-restricted cytotoxic T cells), which could be effectors in demyelination.Fig. 1 Hypothesis by which immune cells injure persistently infected oligodendrocytes and produce primary demyelination. During the course of viral infections of the central nervous system, specific viruses in “susceptible” patients may not be cleared by the immune system. Viruses may then persist in oligodendrocytes (myelin-producing cells) and injure these cells either by direct effects or by becoming targets of immune-mediated destruction. Oligodendrocytes infected by virus may express viral antigen (V), processed viral antigen (P), or novel antigens (N) on their surfaces. Immunoglobulins secreted by B cells may be directed at viral or novel antigens and thus result in injury to oligodendrocytes by complement, antibody-dependent cell-mediated cytotoxicity, or receptor-mediated phagocytosis by macrophages. Processed viral antigens (peptides) may be expressed on surface of oligodendrocytes and be presented to CD4+ cells in context of class II major histocompatibility complex (MHC) antigens (la antigens).

rocytes by complement, antibody-dependent cell-mediated cytotoxicity, or receptor-mediated phagocytosis by macrophages. Processed viral antigens (peptides) may be expressed on surface of oligodendrocytes and be presented to CD4+ cells in context of class II major histocompatibility complex (MHC) antigens (la antigens). These CD4+ cells (class II-restricted cytotoxic T cells or “helper” T cells) could directly injure oligodendrocytes or help B cells. Novel virus-induced antigens may be expressed on surface of oligodendrocytes and be seen in context of class I MHC antigens by CD8+ cells (cytotoxic T cells). These CD8+ cells may injure oligodendrocytes in an effort to clear viral infection or by interacting with normal host proteins. The final consequence of these mechanisms would be injury to the oligodendrocyte. The initial pathologic process could be in the inner and outer glial loops of myelin-producing cells such that destruction of myelin would occur before visible structural damage to the oligodendrocyte (“dying-back gliopathy”). This process would result in primary demyelination. Therapeutic strategies to deplete B cells, CD4+ cells, or CD8+ cells and to “down-regulate” expression of class I or class II MHC gene products may prove beneficial.

f myelin would occur before visible structural damage to the oligodendrocyte (“dying-back gliopathy”). This process would result in primary demyelination. Therapeutic strategies to deplete B cells, CD4+ cells, or CD8+ cells and to “down-regulate” expression of class I or class II MHC gene products may prove beneficial. The final result would be injury to the myelin-producing cell or to the myelin sheath. This result may occur as a dying-back gliopathy,69, 70 the alteration being noted first in the most distal extension of the oligodendrocytes (that is, the glial loops and myelin sheaths) and interfering with the differential function of the oligodendrocyte (that is, the maintenance of myelin). CONCLUSION The evidence suggests that an exogenous agent (that is, a virus) may be important in triggering demyelination in MS. If multiple exogenous agents are able to induce this pathologic process, however, then identifying the offending agent may prove to be difficult. If common pathogens can produce demyelination, then distinguishing these etiologic agents from the viruses that “normally” reside in the central nervous system may be impossible. Alternatively, attempts to interfere specifically with various arms of the immune response by use of monoclonal antibody therapy may be beneficial without the requirement of knowing the causative agent. The scheme proposed in Figure 1 may provide the basis for designing specific immunotherapy to interfere with demyelination. ACKNOWLEDGMENT The artwork for Figure 1 was done by Floyd E. Hosmer, Section of Medical Graphics.

CONCLUSION The evidence suggests that an exogenous agent (that is, a virus) may be important in triggering demyelination in MS. If multiple exogenous agents are able to induce this pathologic process, however, then identifying the offending agent may prove to be difficult. If common pathogens can produce demyelination, then distinguishing these etiologic agents from the viruses that “normally” reside in the central nervous system may be impossible. Alternatively, attempts to interfere specifically with various arms of the immune response by use of monoclonal antibody therapy may be beneficial without the requirement of knowing the causative agent. The scheme proposed in Figure 1 may provide the basis for designing specific immunotherapy to interfere with demyelination. ACKNOWLEDGMENT The artwork for Figure 1 was done by Floyd E. Hosmer, Section of Medical Graphics. This investigation was supported in part by Grants NS 849 and NS 24180 from the National Institutes of Health, Public Health Service, and Grant RG 1878 A-1 from the Multiple Sclerosis Society. Individual reprints of this article are not available. The entire Symposium on Multiple Sclerosis will be available for purchase as a bound booklet from the Proceedings Circulation Office in July.

CME Activity Target Audience: The target audience for Mayo Clinic Proceedings is primarily internal medicine physicians and other clinicians who wish to advance their current knowledge of clinical medicine and who wish to stay abreast of advances in medical research. Statement of Need: General internists and primary care physicians must maintain an extensive knowledge base on a wide variety of topics covering all body systems as well as common and uncommon disorders. Mayo Clinic Proceedings aims to leverage the expertise of its authors to help physicians understand best practices in diagnosis and management of conditions encountered in the clinical setting. Accreditation: Mayo Clinic College of Medicine is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. Credit Statement: Mayo Clinic College of Medicine designates this journal-based CME activity for a maximum of 1.0 AMA PRA Category 1 Credit(s).™ Physicians should claim only the credit commensurate with the extent of their participation in the activity. Learning Objectives: On completion of this article, you should be able to (1) identify the epidemiology of Middle East Respiratory Syndrome Coronavirus (MERS-CoV), (2) identify infection control practices that limit the spread of MERS-CoV, and (3) provide advice to persons planning travel to the Middle East.

Credit Statement: Mayo Clinic College of Medicine designates this journal-based CME activity for a maximum of 1.0 AMA PRA Category 1 Credit(s).™ Physicians should claim only the credit commensurate with the extent of their participation in the activity. Learning Objectives: On completion of this article, you should be able to (1) identify the epidemiology of Middle East Respiratory Syndrome Coronavirus (MERS-CoV), (2) identify infection control practices that limit the spread of MERS-CoV, and (3) provide advice to persons planning travel to the Middle East. Disclosures: As a provider accredited by ACCME, Mayo Clinic College of Medicine (Mayo School of Continuous Professional Development) must ensure balance, independence, objectivity, and scientific rigor in its educational activities. Course Director(s), Planning Committee members, Faculty, and all others who are in a position to control the content of this educational activity are required to disclose all relevant financial relationships with any commercial interest related to the subject matter of the educational activity. Safeguards against commercial bias have been put in place. Faculty also will disclose any off-label and/or investigational use of pharmaceuticals or instruments discussed in their presentation. Disclosure of this information will be published in course materials so that those participants in the activity may formulate their own judgments regarding the presentation.

t in place. Faculty also will disclose any off-label and/or investigational use of pharmaceuticals or instruments discussed in their presentation. Disclosure of this information will be published in course materials so that those participants in the activity may formulate their own judgments regarding the presentation. In their editorial and administrative roles, William L. Lanier, Jr, MD, Terry L. Jopke, Kimberly D. Sankey, and Nicki M. Smith, MPA, have control of the content of this program but have no relevant financial relationship(s) with industry. The authors report no competing interests. Method of Participation: In order to claim credit, participants must complete the following:1. Read the activity. 2. Complete the online CME Test and Evaluation. Participants must achieve a score of 80% on the CME Test. One retake is allowed. Visit www.mayoclinicproceedings.com, select CME, and then select CME articles to locate this article online to access the online process. On successful completion of the online test and evaluation, you can instantly download and print your certificate of credit. Estimated Time: The estimated time to complete each article is approximately 1 hour. Hardware/Software: PC or MAC with Internet access. Date of Release: 7/14/2014 Expiration Date: 7/31/2016 (Credit can no longer be offered after it has passed the expiration date.) Privacy Policy: http://www.mayoclinic.org/global/privacy.html Questions? Contact dletcsupport@mayo.edu.

Estimated Time: The estimated time to complete each article is approximately 1 hour. Hardware/Software: PC or MAC with Internet access. Date of Release: 7/14/2014 Expiration Date: 7/31/2016 (Credit can no longer be offered after it has passed the expiration date.) Privacy Policy: http://www.mayoclinic.org/global/privacy.html Questions? Contact dletcsupport@mayo.edu. Middle East respiratory syndrome (MERS) is a newly described viral disease that causes severe respiratory illness and is associated with high mortality. The disease is caused by a coronavirus that has been named MERS-CoV. The spread of human cases of MERS internationally, and the sharp increase in cases reported from Saudi Arabia since May 2014, are global public health concerns. As health care facilities worldwide are assessing their readiness to deal with MERS-CoV, this summary is aimed at providing perspective and practical advice for preparation.

human cases of MERS internationally, and the sharp increase in cases reported from Saudi Arabia since May 2014, are global public health concerns. As health care facilities worldwide are assessing their readiness to deal with MERS-CoV, this summary is aimed at providing perspective and practical advice for preparation. The first case of MERS-CoV infection was described in a 60-year-old Saudi businessman who was previously healthy except for obesity (body mass index of 35).1 He was hospitalized in June 2012 with fever, cough, shortness of breath, and progressive respiratory and renal failure. He died on hospital day 11. The causative agent was identified as a novel beta-coronavirus in September 2012. Subsequently, the virus, named MERS-CoV, has been linked to clusters of respiratory illnesses in Jordan dating back to March 2012. All reported cases of MERS-CoV infection to date have been directly or indirectly linked to travel or residence in 7 countries in the Arabian Peninsula: Saudi Arabia, United Arab Emirates, Qatar, Oman, Jordan, Kuwait, and Yemen. Cases in travelers from this region have been imported to Europe (France, Germany, Greece, Italy, the Netherlands, and the United Kingdom), Africa (Tunisia, Egypt, and Algeria), Asia (Malaysia and the Philippines), and the United States. In June, Lebanon and Iran reported cases related to travel to Saudi Arabia. As of June 9, 2014, 699 laboratory-confirmed cases of infection with MERS-CoV have officially been reported to the World Health Organization (WHO), including 209 deaths. An additional 113 cases were reported by the Saudi Arabian Ministry of Health on June 3; these cases have not yet been verified by the WHO.2 Since April 2014, the rate at which cases are being reported has risen rapidly, and more than half the reported cases have occurred since April 2014 (Figure ). It is not clear that these official numbers represent the true picture because there is concern that there is considerable underreporting of cases, particularly from Saudi Arabia.Figure Epidemic curve of MERS-CoV cases as of June 9, 2014 (n=699). This number does not include 113 cases announced by Saudi Arabia on June 3, 2014, as these cases are still being verified by WHO. Source: WHO MERS-CoV summary update June 11, 2014.2

s considerable underreporting of cases, particularly from Saudi Arabia.Figure Epidemic curve of MERS-CoV cases as of June 9, 2014 (n=699). This number does not include 113 cases announced by Saudi Arabia on June 3, 2014, as these cases are still being verified by WHO. Source: WHO MERS-CoV summary update June 11, 2014.2 Coronaviruses have the ability to infect multiple species and to rapidly change through recombination. Therefore, they present a serious human health threat. There is concern that MERS-CoV infection could result in a worldwide epidemic similar to the severe acute respiratory syndrome (SARS) outbreak in 2002-2003, which caused more than 8000 infections in 29 countries and resulted in 774 deaths.3 Source of the MERS Virus The full picture on the source of the MERS virus is not yet clear. Studies suggest that the virus has been circulating in bats for a number of years.4, 5 Strains of MERS-CoV have been isolated from dromedary (single-humped) camels in Egypt, Qatar, and Saudi Arabia.6, 7, 8, 9, 10, 11, 12 Genetic sequencing shows close links between the human and camel viruses and supports the premise that camels are a likely source of infection in humans. The recent surge in cases corresponds with similar but smaller spikes in April and May in 2012 and 2013 and may be related to the camel breeding season. However, many cases report no contact at all with camels, suggesting that there may be another environmental source.

camels are a likely source of infection in humans. The recent surge in cases corresponds with similar but smaller spikes in April and May in 2012 and 2013 and may be related to the camel breeding season. However, many cases report no contact at all with camels, suggesting that there may be another environmental source. Clinical Presentation of MERS The clinical spectrum of MERS-CoV infection ranges from asymptomatic infection to rapidly progressive respiratory illness and death. The median age of persons with laboratory-confirmed MERS-CoV infection is 49 years (range, <1-94 years); 65% of patients are males. Most patients who are hospitalized with MERS-CoV infection have had chronic comorbidities such as obesity, diabetes, or end-stage renal disease.13 The case fatality rate is approximately 30%. If verified, newly reported cases from Saudi Arabia that resulted in death may push the case fatality rate closer to 40%.14

les. Most patients who are hospitalized with MERS-CoV infection have had chronic comorbidities such as obesity, diabetes, or end-stage renal disease.13 The case fatality rate is approximately 30%. If verified, newly reported cases from Saudi Arabia that resulted in death may push the case fatality rate closer to 40%.14 Initial signs and symptoms are nonspecific and include fever, chills, headache, nonproductive cough, dyspnea, and myalgia. Other symptoms can include sore throat, nausea and vomiting, dizziness, diarrhea, and abdominal pain. Atypical presentations including mild respiratory illness without fever and diarrheal illness preceding development of pneumonia have been reported. The median time from illness onset to hospitalization is approximately 4 days. Laboratory findings include lymphopenia, thrombocytopenia, and elevated lactate dehydrogenase levels. Radiographic findings may include unilateral or bilateral patchy lung infiltrates, consolidation, and pleural effusions. Renal failure has been reported frequently.15 MERS-CoV can be detected in respiratory tract secretions, with tracheal secretions and bronchoalveolar lavage specimens providing a higher yield for detection than nasopharyngeal swabs.16 The virus has also been detected in feces, serum, and urine. The duration of MERS-CoV shedding is unknown at this time.

requently.15 MERS-CoV can be detected in respiratory tract secretions, with tracheal secretions and bronchoalveolar lavage specimens providing a higher yield for detection than nasopharyngeal swabs.16 The virus has also been detected in feces, serum, and urine. The duration of MERS-CoV shedding is unknown at this time. Many patients with MERS-CoV infection require care in an intensive care unit (ICU). In a case series of 12 critically ill patients,17 the median time from onset to ICU admission was 2 days. All patients required tracheal intubation; the median time to intubation was 4.5 days, and the median duration of mechanical ventilation was 16 days. Median ICU stay was 30 days, and ICU survival was only 42%. All patients had at least one chronic condition, with diabetes being the most common (present in 67% of patients). One unique aspect of the SARS epidemic was the occurrence of superspreading events. Superspreaders were index cases that infected more than 10 contacts. Superspreaders accounted for almost three-fourths of SARS cases in Hong Kong and Singapore.18, 19 In contrast, superspreaders have not been identified for MERS-CoV infection.

que aspect of the SARS epidemic was the occurrence of superspreading events. Superspreaders were index cases that infected more than 10 contacts. Superspreaders accounted for almost three-fourths of SARS cases in Hong Kong and Singapore.18, 19 In contrast, superspreaders have not been identified for MERS-CoV infection. Treatment There is currently no effective treatment for MERS-CoV infection. Treatment consists of supportive care including mechanical ventilation and renal replacement therapy as needed. Widely disparate agents including chloroquine, chlorpromazine, loperamide, lopinavir, cyclosporine, and mycophenolic acid have in vitro activity against MERS-CoV.20, 21, 22 The combination of ribavirin and interferon alfa-2b is active against MERS-CoV in animal models. However, in one case series of 5 critically ill patients in Saudi Arabia, combination ribavirin and interferon therapy did not impact survival; all 5 patients who received this therapy died.23 Transmission of MERS The exact mode of transmission of MERS has not been elucidated. The virus seems to require close contact for transmission to occur. There have been clusters of cases in health care facilities, possibly related to inadequate infection prevention and control practices. In a description of a hospital outbreak in Jordan in April 2012, the transmission rate among exposed health care workers was 10%, despite the fact that the disease entity had not been recognized at the time and no special precautions were taken.24

ssibly related to inadequate infection prevention and control practices. In a description of a hospital outbreak in Jordan in April 2012, the transmission rate among exposed health care workers was 10%, despite the fact that the disease entity had not been recognized at the time and no special precautions were taken.24 Transmission to household contacts has also been described. In one outbreak,25 the index case was a 70-year-old man with diabetes and renal failure. Two of his sons who were smokers and a grandson who had no comorbidities developed MERS-CoV infection and required hospitalization; one person died. All the cases lived in the same household and ate meals together. Twenty-four other family contacts and 124 health care personnel (HCP) contacts of these patients were evaluated; none of them had illness or serologic evidence of infection. These reports suggest that the virus is not easily transmissible between humans. MERS in the United States Two cases of MERS-CoV infection were reported in May 2014 in the United States. They were both imported from Saudi Arabia and occurred in persons involved in health care there. Extensive contact tracing has not revealed transmission to anyone in the United States.

Transmission to household contacts has also been described. In one outbreak,25 the index case was a 70-year-old man with diabetes and renal failure. Two of his sons who were smokers and a grandson who had no comorbidities developed MERS-CoV infection and required hospitalization; one person died. All the cases lived in the same household and ate meals together. Twenty-four other family contacts and 124 health care personnel (HCP) contacts of these patients were evaluated; none of them had illness or serologic evidence of infection. These reports suggest that the virus is not easily transmissible between humans. MERS in the United States Two cases of MERS-CoV infection were reported in May 2014 in the United States. They were both imported from Saudi Arabia and occurred in persons involved in health care there. Extensive contact tracing has not revealed transmission to anyone in the United States. Case 1 The first case of MERS in the United States26 involved a male health care worker from Saudi Arabia. He began feeling unwell around April 18, 2014, with low-grade fever and myalgia. On April 24, he traveled by commercial airline from Saudi Arabia to the United Kingdom and from there to Chicago. He then traveled by bus to Indiana. On April 27, he experienced shortness of breath, nonproductive cough, fever, and rhinorrhea and was admitted to a hospital in Indiana on the following day. Chest imaging showed bilateral pulmonary infiltrates. He required supplemental oxygen but did not require mechanical ventilation. By May 9, the patient had recovered fully.

27, he experienced shortness of breath, nonproductive cough, fever, and rhinorrhea and was admitted to a hospital in Indiana on the following day. Chest imaging showed bilateral pulmonary infiltrates. He required supplemental oxygen but did not require mechanical ventilation. By May 9, the patient had recovered fully. Household contacts, a community contact, and HCP exposed to the patient before institution of infection control precautions were placed on home quarantine for 14 days after the last exposure. Nasopharyngeal and serum specimens collected from all the contacts tested negative for MERS-CoV. None of the passengers and crew on the 2 flights or the bus developed a serious respiratory syndrome. The community contact who had interacted with the patient on 2 separate occasions was initially reported to be positive for MERS-CoV on serologic testing,27 but this has since been refuted. Case 2 The second imported case of MERS in the United States was reported in Florida on May 11, 2014, in a 44-year-old health care worker from Saudi Arabia.28 The patient traveled by commercial airline from Saudi Arabia to Orlando, Florida, via the United Kingdom, Boston, and Atlanta. He began feeling unwell during the flight from Saudi Arabia to the United Kingdom, and symptoms included myalgia, fever, chills, and a slight cough. He was hospitalized on May 9, 2014, and has since recovered completely. Contact investigations have not shown transmission to others to date.

Kingdom, Boston, and Atlanta. He began feeling unwell during the flight from Saudi Arabia to the United Kingdom, and symptoms included myalgia, fever, chills, and a slight cough. He was hospitalized on May 9, 2014, and has since recovered completely. Contact investigations have not shown transmission to others to date. Laboratory Testing A polymerase chain reaction test is available for detection of MERS-CoV in respiratory samples. The test is not commercially available and can only be performed by state health department laboratories or at the Centers for Disease Control and Prevention (CDC). Lower respiratory tract samples (tracheal secretions, bronchoalveolar lavage fluid) have a higher yield than upper respiratory tract samples such as a nasopharyngeal/oropharyngeal swab. If it has been more 14 days since symptom onset, serologic testing is recommended using the CDC MERS-CoV serologic assay. Guidelines for obtaining specimens and testing are available at the CDC website.29 Commercially available coronavirus tests in the United States will not detect the MERS-CoV.

Laboratory Testing A polymerase chain reaction test is available for detection of MERS-CoV in respiratory samples. The test is not commercially available and can only be performed by state health department laboratories or at the Centers for Disease Control and Prevention (CDC). Lower respiratory tract samples (tracheal secretions, bronchoalveolar lavage fluid) have a higher yield than upper respiratory tract samples such as a nasopharyngeal/oropharyngeal swab. If it has been more 14 days since symptom onset, serologic testing is recommended using the CDC MERS-CoV serologic assay. Guidelines for obtaining specimens and testing are available at the CDC website.29 Commercially available coronavirus tests in the United States will not detect the MERS-CoV. Infection Control in Health Care Facilities Patients with MERS-CoV infection can present with mild and atypical symptoms. Therefore, using standard precautions30 for all patient encounters is crucial. Standard precautions are basic infection control practices intended to be applied to the care of all patients in all health care settings, regardless of the suspected or confirmed presence of an infectious agent. These practices are designed to both protect HCP and prevent the spread of infections among patients. They include (1) hand hygiene before and after patient contact, (2) use of appropriate personal protective equipment (gloves and gowns, masks, eye protection) when contact with body fluids is anticipated, (3) adequate cleaning, disinfection, or sterilization of patient care equipment before use on another patient, and (4) respiratory etiquette (placing a mask on patients with a cough, encouraging patients to cover their cough and to perform hand hygiene).

ks, eye protection) when contact with body fluids is anticipated, (3) adequate cleaning, disinfection, or sterilization of patient care equipment before use on another patient, and (4) respiratory etiquette (placing a mask on patients with a cough, encouraging patients to cover their cough and to perform hand hygiene). In addition to standard precautions, all patients presenting with fever and chest radiographic findings of pneumonia should be screened for (1) travel to the Arabian Peninsula or neighboring countries within the previous 2 weeks, (2) close contact with a symptomatic traveler to the Middle East, and (3) close contact with a confirmed or probable case of MERS. Patients with a febrile respiratory illness who meet one or more of these screening criteria should be placed in airborne and contact precautions, pending further evaluation. Airborne precautions require that the patient is placed in a single room that is at negative pressure to the surroundings and has a minimum of 6 air changes per hour. Health care personnel entering the room must wear a fit-tested respirator or a powered air-purifying respirator. Contact precautions require that health care workers wear gowns and gloves for room entry. In addition to airborne and contact precautions, eye protection must be used by HCP to prevent splashes to eyes or mucous membranes. The CDC has tools to assist health care facilities31 and individual health care professionals32 in assessing their readiness to deal with MERS-CoV.

In addition to standard precautions, all patients presenting with fever and chest radiographic findings of pneumonia should be screened for (1) travel to the Arabian Peninsula or neighboring countries within the previous 2 weeks, (2) close contact with a symptomatic traveler to the Middle East, and (3) close contact with a confirmed or probable case of MERS. Patients with a febrile respiratory illness who meet one or more of these screening criteria should be placed in airborne and contact precautions, pending further evaluation. Airborne precautions require that the patient is placed in a single room that is at negative pressure to the surroundings and has a minimum of 6 air changes per hour. Health care personnel entering the room must wear a fit-tested respirator or a powered air-purifying respirator. Contact precautions require that health care workers wear gowns and gloves for room entry. In addition to airborne and contact precautions, eye protection must be used by HCP to prevent splashes to eyes or mucous membranes. The CDC has tools to assist health care facilities31 and individual health care professionals32 in assessing their readiness to deal with MERS-CoV. Advice for Travelers At this point, neither the WHO nor the CDC has issued travel advisories discouraging travel to the Middle East. Travelers to the Middle East should be provided with current information on MERS-CoV and guidance on how to avoid illness while traveling, including hand hygiene, avoiding sick contacts, and avoiding ingestion of raw or undercooked animal products. They should be advised to seek medical attention if fever and cough develop within 2 weeks after return from the Middle East. Travelers should be warned that individuals with diabetes, renal insufficiency, chronic lung disease, and immunosuppression may be at increased risk of dying if they acquire MERS-CoV infection.

They should be advised to seek medical attention if fever and cough develop within 2 weeks after return from the Middle East. Travelers should be warned that individuals with diabetes, renal insufficiency, chronic lung disease, and immunosuppression may be at increased risk of dying if they acquire MERS-CoV infection. Conclusion MERS-CoV is a newly discovered coronavirus that has caused outbreaks of severe respiratory illness reminiscent of the SARS outbreak (Table ).33 Mortality rates associated with this illness are extremely high. There is concern that the virus has pandemic potential, but so far the virus shows limited human-to-human transmission. No therapies or vaccines are currently available. Good infection control practices are the primary mode of control of this illness.Table Comparison of SARS and MERS Similarities • Both are caused by coronaviruses of animal origin • Both cause a severe respiratory illness • Disease transmission to family and health care contacts has been reported • Both have spread globally through infected travelers • No effective therapies are available other than supportive care • Infection control in health care facilities plays a critical role in limiting transmission Differences • No evidence yet of sustained human-to-human transmission of MERS-CoV • No evidence of superspreaders of MERS • Slower global spread of MERS, likely due to lower infectivity • Mortality of 30%-40% for MERS, compared with 10% for SARS

• Infection control in health care facilities plays a critical role in limiting transmission Differences • No evidence yet of sustained human-to-human transmission of MERS-CoV • No evidence of superspreaders of MERS • Slower global spread of MERS, likely due to lower infectivity • Mortality of 30%-40% for MERS, compared with 10% for SARS The SARS outbreak was characterized by initial reluctance to share information, similar to what is occurring with MERs-CoV infection in some parts of the world. As SARS began to spread globally, this reluctance was replaced by unprecedented cooperation among international health authorities that led to containment of the outbreak in 4 months. One of the positive outcomes of the SARS outbreak was the adoption of the 2005 International Health Regulations (IHR).34 Worldwide, 197 countries have adopted the IHR, which provides a new framework for the coordination of the management of events that may constitute a public health emergency of international concern. The WHO hopes that when fully implemented, the IHR will improve the capacity of all countries to detect, assess, notify, and respond to public health threats. Thus, the MERS-CoV outbreak is a test of global public health preparedness and cooperation. Supplemental Online Material Video 1

Dr Lori Erickson, Associate Editor of Mayo Clinic Proceedings, discusses the articles appearing in the August 2014 issue. These include: “Sedentary Behavior, Cardiorespiratory Fitness, Physical Activity, and Cardiometabolic Risk in Men: The Cooper Center Longitudinal Study,” by Dr Kerem Shuval and colleagues; “The Chairman’s Curse: Lethal Sitting,” by Dr James A. Levine; “Body Composition and Mortality in a Large Cohort With Preserved Ejection Fraction: Untangling the Obesity Paradox,” by Dr Alban De Schutter and colleagues; “To Legitimize the Contentious Obesity Paradox,” by Dr Kamyar Kalantar-Zadeh and colleagues; “Medication Errors: An Overview for Clinicians,” by Dr Christopher M. Wittich and colleagues; “Medication Errors: What Is Their Impact?” by Drs David W. Bates and Sarah P. Slight; “Idiopathic Pulmonary Fibrosis: Evolving Concepts,” by Dr Jay H. Ryu and colleagues; “Caveat Spectator: Digital Imaging and Data Manipulation,” by Dr Somjade Songcharoen and colleagues; “The Consequences of Chronic Kidney Disease Mislabeling in Living Kidney Donors,” by Drs Colin R. Lenihan and Jane C. Tan; “Pregnancy and Postpartum Infective Endocarditis: A Systematic Review,” by Dr Kalie Y. Kebed and colleagues; “Middle East Respiratory Syndrome: What Clinicians Need to Know,” by Dr Priya Sampathkumar; “52-Year-Old Woman With Hypotension, Hypothyroidism, and Hyponatremia,” by Dr Christopher H. Blevins and colleagues; and “Facial Hair: A Newly Identified, Modifiable Risk Factor in Home Oxygen Therapy–Related Burns,” by Dr Bradley W. Anderson and colleagues. Supplemental Online Material Video Audio Audiovisual Summary Transcript