Browse the corpus
Walk the evidence base by book and chapter — the raw source passages that ground Ask, Differential, and the rest.
476 passages
Introduction Asthma still causes considerable morbidity and mortality globally [1]. The recent Lancet commission [2] highlighted that our concept of the asthma is too simplified i.e., that all asthma is considered the same and should be treated the same way. This belief has limited medical professionals to move forward and make significant progress in asthma management [2]. Recognition of the diversity of asthma and of the information that can be learned from outliers is leading us into management in the twenty-first century.
ed the same and should be treated the same way. This belief has limited medical professionals to move forward and make significant progress in asthma management [2]. Recognition of the diversity of asthma and of the information that can be learned from outliers is leading us into management in the twenty-first century. Recognition of Asthma Phenotype: Need for Individualized Approach Whereas asthma is often considered as one entity, the term should instead be used as a descriptive label for a collection of symptoms. It is important to understand the heterogeneity of the disease. Asthma is characterized by reversible airflow limitation, an oversensitive cough reflex and mucus hypersecretion. It may have no inflammatory component or there may be different patterns of inflammation, as there will be contributions from bacterial and viral infections that vary over time [2]. The Lancet commission suggested the importance of recognizing and defining the pathophysiology for an individual patient, e.g., eosinophilic airway inflammation and airway obstruction, with a focus on personalizing diagnosis and targeting care for treatable traits or pathology [2]. Fixed airflow limitation can be due to early life factors leading to structural changes or extramural causes [2]. Reversible limitation is due to an intramural cause: repeated contraction of airway smooth muscle, inflammatory mural edema or intraluminal airway secretions. Multiple forms of airway hyperresponsiveness exist and can even be present at birth with no evidence of allergy or inflammation. Airway inflammation in asthma is also heterogeneous. Eosinophilic inflammation has two known pathways; Early onset allergic eosinophilic airway inflammation (extrinsic asthma) and Late onset non-allergic eosinophilic airway inflammation (intrinsic asthma). Other pathways may exist and are yet to be discovered. Neutrophilic airway inflammation is another profile where at least two pathways have been found [2].
pathways; Early onset allergic eosinophilic airway inflammation (extrinsic asthma) and Late onset non-allergic eosinophilic airway inflammation (intrinsic asthma). Other pathways may exist and are yet to be discovered. Neutrophilic airway inflammation is another profile where at least two pathways have been found [2]. Phenotypic classifications vary globally and often cause confusion based on how the word phenotype has been defined. It is used to describe [3]:Any observable trait (morphological, biochemical, physiological, behavioral), Clinical grouping for wheeze/asthma (Tuscon grouping - early, late, persistent) (difficult/severe asthma) Specific disease entities (Atopic asthma, Viral-induced wheeze) In this article authors have used the first definition of phenotype as any observable trait as it is the most encompassing. Box 1 shows classifications of asthma phenotypes [4].Box 1 Classification of asthma phenotypes in children [4] Symptom based • Age at onset • Natural history • Severity Trigger based • Allergic vs. non-allergic • Exercise induced • Viral triggered vs. multi triggered. Response to treatment • Corticosteroid responsive Inflammatory features (based on biopsy, induced sputum and bronchoalveolar lavage) • Eosinophilic • Neutrophilic Non-invasive markers • Exhaled nitric oxide • Exhaled breath condensate Pulmonary function tests • Fixed vs. bronchodilator-reversible airway obstruction • Bronchial responsiveness to exercise, cold air, chemical challenge.
tures (based on biopsy, induced sputum and bronchoalveolar lavage) • Eosinophilic • Neutrophilic Non-invasive markers • Exhaled nitric oxide • Exhaled breath condensate Pulmonary function tests • Fixed vs. bronchodilator-reversible airway obstruction • Bronchial responsiveness to exercise, cold air, chemical challenge. It is appreciated that invasive tests may not always be suitable for an asthma workup in children. However the more information that the clinician can obtain, the more targeted management can be. The recent Lancet commission [2] has advocated precision medicine where we should identify the pathophysiology and treatable aspects in an individual child or adolescent and personalize treatment rather than using a one size fits all approach to the treatment and secondary prevention of the asthma attacks. New in the Diagnosis of Asthma – The Diagnostic Accuracy of Fractional Exhaled Nitric Oxide Testing Diagnosing asthma in children is challenging and multiple tests including bronchodilator response and bronchial provocation challenge are used to help in the diagnosis of asthma in children with compatible symptoms, such as shortness of breath, wheezing, and cough. It is important to note that the asthma diagnosis remains clinical. No single diagnostic test exists.
d multiple tests including bronchodilator response and bronchial provocation challenge are used to help in the diagnosis of asthma in children with compatible symptoms, such as shortness of breath, wheezing, and cough. It is important to note that the asthma diagnosis remains clinical. No single diagnostic test exists. Fractional exhaled nitric oxide (FeNO) concentration has been proposed to aid asthma diagnosis. A recent systematic review with meta-analyses evaluated the diagnostic accuracy of FeNO testing in children with suspected asthma [5]. They evaluated 43 observational studies addressing this question and concluded the FeNO concentration has moderate accuracy to diagnose asthma in individuals aged 5 y and older. The 2011 American Thoracic Society guidelines [6] recommended <20 ppb in children for low FeNO and > 35 ppb in children for high FeNO as the most useful cutoffs to make the determination that eosinophilic inflammation and response to corticosteroids would be unlikely or likely, respectively. Although different varieties of lower airway inflammation found in asthma have already been discussed, the fact remains that atopy is a significant risk factor in most childhood asthma [7]. Thus, FeNO measurement is likely to be particularly useful in diagnosis and management of asthma in children and adolescents. In summary, asthma can sometimes be difficult to diagnose, and FeNO can be helpful. The first diagnostic test in patients with suspected asthma should be spirometry with an assessment of bronchodilator response. If this test does not confirm the diagnosis, second-line tests (measurement of FeNO and bronchoprovocation studies) are recommended. Moreover, FeNO is sensitive to corticosteroid treatment and can therefore be used as a method to monitor treatment adherence or to guide choice(s) of pharmacotherapy.
chodilator response. If this test does not confirm the diagnosis, second-line tests (measurement of FeNO and bronchoprovocation studies) are recommended. Moreover, FeNO is sensitive to corticosteroid treatment and can therefore be used as a method to monitor treatment adherence or to guide choice(s) of pharmacotherapy. Dysfunctional Breathing Before, and repeatedly during, treatment escalation for poorly controlled asthma, one must always re-evaluate presence of potential co-morbidities (Box 2) and should never forget that persistent symptoms may not be due to asthma. Frequently breathless patients have often learned a maladaptive breathing strategy causing, or perceived as, dyspnea – termed dysfunctional breathing [8]. A recent general review of the topic described some of these breathing strategies [9]. Dysfunctional breathing can co-exist with asthma [10, 11] and recognition of this condition is vital to (a) avoid iatrogenic, adverse effects from pharmacotherapy; and (b) open a path for non-pharmacologic intervention(s) [12, 13].Box 2 Comorbidities of asthma It is important to assess for the comorbidities as if underdiagnosed or undertreated, comorbid conditions can influence quality of life and asthma control. • Rhinitis • Rhinosinusitis • Nasal polyposis • Obesity • Obstructive sleep apnea • Gastro-esophageal reflux disease • Psychological stress, anxiety symptoms, depression • Dysfunctional breathing • Exercise induced laryngeal obstruction
undertreated, comorbid conditions can influence quality of life and asthma control. • Rhinitis • Rhinosinusitis • Nasal polyposis • Obesity • Obstructive sleep apnea • Gastro-esophageal reflux disease • Psychological stress, anxiety symptoms, depression • Dysfunctional breathing • Exercise induced laryngeal obstruction Perhaps the best known among the various types of dysfunctional breathing is exercise induced laryngeal obstruction (EILO) [14], formerly known as vocal cord dysfunction (among other synonyms). EILO is relatively easy to identify, but the clinician must first distinguish “wheeze” reported by patient or parent from stridor. Patients with EILO and asthma typically report difficulty with inhalation, so this feature in the history does not help differentiate these conditions, which becomes important since EILO can co-exist with asthma [10, 11]. Patients typically report a sensation of unsatisfied inhalation or “can’t get enough air” and may clutch their throat when saying so. Others may localize the site of “block” in the neck/throat if specifically asked. History is the key to identifying such patients, but the gold standard diagnostic test has become continuous laryngoscopy during exercise. Identification of other forms of dysfunctional breathing is not straightforward, and patients suspected of having it are best triaged and diagnosed via referral to a physiotherapist or speech-language therapist with requisite expertise. It is for this reason that obtaining as much objective information as possible, i.e., seeking evidence of reversible obstruction on spirometry, demonstrating airway hyperreactivity with bronchial provocation challenge, looking for evidence of lower airway inflammation (e.g., measurement of FeNO), and even chest imaging by CT scan showing mosaic attenuation, may be required. The true value of these tests lies in negative/normal results, which allows one to zero in on dysfunctional breathing as the culprit.
chial provocation challenge, looking for evidence of lower airway inflammation (e.g., measurement of FeNO), and even chest imaging by CT scan showing mosaic attenuation, may be required. The true value of these tests lies in negative/normal results, which allows one to zero in on dysfunctional breathing as the culprit. New in the Management of Acute Asthma – Improving Treatment of Acute Asthma Attacks An asthma attack should not be viewed as a temporary inconvenience but rather an event that may be associated with permanent damage to the lung [2]. It is important to understand the impact of terminology and asthma specialists recommend replacing the term exacerbation or flare up with attack as this will convey severity, future risk, and potential for death [2]. The presence of previous severe asthma attacks, psychological factors, and non-adherence to maintenance therapy are known factors contributing to “high risk” patients with asthma [15].
commend replacing the term exacerbation or flare up with attack as this will convey severity, future risk, and potential for death [2]. The presence of previous severe asthma attacks, psychological factors, and non-adherence to maintenance therapy are known factors contributing to “high risk” patients with asthma [15]. GINA (Global Institute of Asthma) guidelines [16] and BTS (British Thoracic Society)/SIGN (Scottish Intercollegiate Guidelines) guidelines [17] provide clear guidance on the management of acute asthma. Box 3 contains recent updates in GINA guidance. Briefly, there must be efficient assessment using objective measurements, appropriate use of delivery devices, not to hold back on oxygen use, and regular monitoring for response to treatment [18]. It is imperative that symptoms and signs are accurately assessed and differentiated between moderate, severe and life-threatening asthma attack. Treatment of a severe attack must include all of short acting β2-agonists, oxygen and steroids. Spacer devices have been shown to be equally if not more effective in mild to moderate attacks [19] and homemade spacers have been shown to be as good as commercial ones in some studies [20]. It is important to recognize that inhaled β2-agonist bronchodilators can occasionally exacerbate hypoxemia in patients with asthma, regardless of how they are administered. Hypoxemia can be lethal and pulse oximeters are advised particularly in primary care settings. These may be obtained cheaply and easily with probes appropriate for every age group [18].Box 3 Recent updates in GINA guidance
casionally exacerbate hypoxemia in patients with asthma, regardless of how they are administered. Hypoxemia can be lethal and pulse oximeters are advised particularly in primary care settings. These may be obtained cheaply and easily with probes appropriate for every age group [18].Box 3 Recent updates in GINA guidance • A continuous cycle of assessment, treatment, and review. • Asthma management to include self-monitoring of symptoms and peak flow, a written asthma action plan to recognize and respond to worsening asthma, and regular review of asthma control in partnership with a healthcare professional • Treatment with low dose ICS for most patients with asthma, even those with infrequent symptoms, to reduce the risk of serious exacerbations. • Sublingual or Subcutaneous immunotherapy to aeroallergens is not recommended for treatment of asthma in children. • When stepping down from low dose ICS, add on LTRA may help. There is insufficient evidence to step down to intermittent ICS with SABA. • When prescribing short-term OCS, remember to advise patients about common side-effects (sleep disturbance, increased appetite, reflux, mood changes) • Height should be checked at least yearly, as poorly-controlled asthma can affect growth and growth velocity may be lower in the first 1–2 y of ICS treatment • Effects of ICS on growth velocity are not progressive or cumulative. • Update of adherence strategies effective in real-life settings. ICS Inhaled corticosteroids; LTRA Leukotriene receptor antagonist; OCS Oral corticosteroids; SABA Short acting beta agonists
velocity may be lower in the first 1–2 y of ICS treatment • Effects of ICS on growth velocity are not progressive or cumulative. • Update of adherence strategies effective in real-life settings. ICS Inhaled corticosteroids; LTRA Leukotriene receptor antagonist; OCS Oral corticosteroids; SABA Short acting beta agonists Research continues into additional bronchodilator therapy [inhaled magnesium sulphate (MgSO4) and intravenous MgSO4], and intravenous short-acting β2 agonists. Despite the overall lack of evidence, both forms of MgSO4 are widely used as part of the management of acute asthma in children. One meta-analysis involving three trials for intravenous MgSO4 in ED (Emergency department) indicated a number needed to treat (NNT) of 5 to prevent one hospital admission [21]. It is important to note the studies reviewed are difficult to compare directly with each other. Irazuzta et al. reviewed high dose MgSO4 continuous infusion vs. bolus MgSO4 in a prospective randomized ED study; this showed the high dose infusion group had lower lengths of stay and earlier discharges [21]. A Cochrane review in 2017 looked at 25 trials of varying quality which included both adults and children. Some individual studies suggest that those with more severe attacks of shorter duration may experience a greater benefit. Regardless, the Cochrane review concluded treatment with nebulized MgSO4 has not shown clinical benefit in recent well-designed trails [22]. Nebulised MgSO4 does not appear to be associated with an increase in serious adverse events [22].
se with more severe attacks of shorter duration may experience a greater benefit. Regardless, the Cochrane review concluded treatment with nebulized MgSO4 has not shown clinical benefit in recent well-designed trails [22]. Nebulised MgSO4 does not appear to be associated with an increase in serious adverse events [22]. One pilot study has shown the benefit of high-flow nasal cannula oxygen therapy compared to face mask oxygen therapy in the emergency department. They showed a reduction in respiratory distress measured via pulmonary score and hypoxemia, within the first 2 h of treatment and that it was safe and effective [23]. More research is required in this area. Prednisolone is well used in the management of acute asthma, there has been research to assess the use of dexamethasone as an alternative based on its longer biologic half-life and improved palatability. It also appears to be better tolerated with reduced emesis. Research needs to continue to understand optimum dosing, duration and relative adverse effects [24]. Every asthma attack that a clinician encounters may be viewed as treatment failure and therefore should also trigger a structured review and focused strategy to reduce the risk of further attacks [18].
Prednisolone is well used in the management of acute asthma, there has been research to assess the use of dexamethasone as an alternative based on its longer biologic half-life and improved palatability. It also appears to be better tolerated with reduced emesis. Research needs to continue to understand optimum dosing, duration and relative adverse effects [24]. Every asthma attack that a clinician encounters may be viewed as treatment failure and therefore should also trigger a structured review and focused strategy to reduce the risk of further attacks [18]. New in Long Term Management of Asthma Asthma treatment goals in children and adolescents are to minimize the short term effects (day-to-day symptoms, disturbed sleep, and activity limitation) and the risk of adverse asthma outcomes (attacks, persistent airflow limitation, and medication side-effects) [1]. It is imperative to optimize maintenance therapies, assess for the independent significant risk predictors at least once a year, like short acting β2-agonist overuse, not receiving inhaled corticosteroids (not prescribed, poor adherence, or poor inhaler technique), tobacco exposure, ongoing allergen exposure, psychosocial issues, comorbidities (Box 2) and poor lung function. Ensuring good quality, consistent parental education is vital.
a year, like short acting β2-agonist overuse, not receiving inhaled corticosteroids (not prescribed, poor adherence, or poor inhaler technique), tobacco exposure, ongoing allergen exposure, psychosocial issues, comorbidities (Box 2) and poor lung function. Ensuring good quality, consistent parental education is vital. Pharmacological Management Should Inhaled Corticosteroids be Used Alongside Short Acting β2 Agonists in Initial Treatment for Asthma? Asthma is an inflammatory condition and should be treated with anti-inflammatory agents (i.e., inhaled corticosteroids). Early treatment with inhaled corticosteroid is associated with better outcomes, reduced risk of asthma exacerbations and reduced risk of asthma related death. That said, it remains to be shown whether early (or later) intervention with anti-inflammatory treatment alters the natural history of the disease [25]. It is also important to recognize that regular short acting β2-agonist use leads to tachyphylaxis, rapid receptor tolerance, rebound bronchoconstriction, reduced response to short acting β2-agonist, as well as increased inflammation and responses to allergens [1].
eatment alters the natural history of the disease [25]. It is also important to recognize that regular short acting β2-agonist use leads to tachyphylaxis, rapid receptor tolerance, rebound bronchoconstriction, reduced response to short acting β2-agonist, as well as increased inflammation and responses to allergens [1]. Long Acting Muscarinic Antagonist Tiotropium is a long acting muscarinic antagonist (LAMA), which is well established for the treatment of chronic obstructive pulmonary disease (COPD). Acetylcholine, a chemical messenger is released from the cholinergic parasympathetic nerves in the lungs and causes airway smooth muscle contraction, proliferation of airway smooth muscles, mucus production, increase of ciliary beat frequency, and release of proinflammatory mediators by airway epithelial cells, proliferation of fibroblasts and vasodilation [26]. Tiotropium binds equally well to M1, M2, and M3 cholinergic receptors, but dissociates slowly from the M1 and M3 cholinergic receptors, hence the long duration of bronchodilator effect. It can be given once daily as the effect lasts for 35 h with maximum effect within 60 min [26, 27].
fibroblasts and vasodilation [26]. Tiotropium binds equally well to M1, M2, and M3 cholinergic receptors, but dissociates slowly from the M1 and M3 cholinergic receptors, hence the long duration of bronchodilator effect. It can be given once daily as the effect lasts for 35 h with maximum effect within 60 min [26, 27]. Tiotropium has shown promising results in five recent pediatric randomised controlled trials studies. Tiotropium delivered via the Respimat® Soft Mist™ inhaler has recently been approved for use as once-daily maintenance therapy for children with asthma over the age of 6 y in the USA (February 2017). GINA guidelines recommend tiotropium as an add-on therapy option at Steps 4 and 5 with a history of exacerbations, in patients aged 12 y and above. Findings of the large clinical trial program in children and adolescents across the spectrum of asthma severity have demonstrated that tiotropium Respimat® as add-on to inhaled corticosteroids, is a well-tolerated and efficacious bronchodilator, resulting in improved lung function [18, 27]. The safety of tiotropium delivered via Respimat® has recently been investigated in large clinical trials in adolescents and children with asthma [27, 28]. The efficacy of Tiotropium delivered via Respimat® is summarized in Table 1.Table 1 Key efficacy findings from studies with tiotropium Respimat® in adolescents and children with asthma
opium delivered via Respimat® has recently been investigated in large clinical trials in adolescents and children with asthma [27, 28]. The efficacy of Tiotropium delivered via Respimat® is summarized in Table 1.Table 1 Key efficacy findings from studies with tiotropium Respimat® in adolescents and children with asthma Study program Reference Age Asthma severity Baseline therapy Primary and key secondary endpoints Key efficacy findings RubaTinA-asthma® [29] (NCT01257230) Hamelmann E, Bateman ED, Vogelberg C, et al. Tiotropium add-on therapy in adolescents with moderate asthma: a 1-year randomized controlled trial. J Allergy Clin Immunol. 2016;138:441–50. e8. 12–17 y Symptomatic moderate At least ICS Peak FEV1 Trough FEV1 • Tiotropium add-on therapy improves lung function. • Improvement in peak FEV1 at wk 24 was statistically significant • 5mcg of tiotropium, adjusted mean difference 174 mL [95% confidence interval (CI) 76–272; p < 0.001]; 2.5 mcg of tiotropium, 134 mL (95% CI 34–234; p < 0.01). • Improvement was also noted in the trough FEV1 for tiotropium 5 mcg compared with placebo. PensieTinA-asthma® [30] (NCT01277523) Hamelmann E, Bernstein JA, Vandewalker M, et al. A randomised controlled trial of tiotropium in adolescents with severe symptomatic asthma. Eur Respir J. 2017;49:1601100. 12–17 y Symptomatic severe ICS + ≥1 controller Peak FEV1 Trough FEV1 Mean FEF (Forced expiratory flow) (between 25 and 75% of forced vital capacity) • Tiotropium 5mcg provided numerical improvements in peak FEV1 compared with placebo but was not statistically significant [90 mL (95% CI - 19 to 198; p = 0.104)]. • Statistically significant improvement in peak FEV1(0–3 h) response with the 2.5 mcg dose [111 mL (95% CI 2–220; p = 0.046)] • The primary endpoint of the trial was not met as the efficacy of tiotropium 5mcg over placebo could not be demonstrated. CanoTinA-asthma® [31] (NCT01634139) Schmidt O, Hamelmann E, Vogelberg C, et al. Late-breaking abstract: once-daily tiotropium Respimat® add-on therapy improves lung function in children with moderate symptomatic asthma. Eur Respir J. 2016;48:PA4398. 6–11 y Symptomatic moderate At least ICS Peak FEV1 Trough FEV1 • Significant improvement in peak FEV1 at wk 24 was observed with both doses of tiotropium (5 and 2.5 mcg), • Adjusted mean differences of 164 mL (95% CI 103–225) and 170 mL (95% CI 108–231) vs. placebo, respectively (p < 0.0001 for both comparisons).
4398. 6–11 y Symptomatic moderate At least ICS Peak FEV1 Trough FEV1 • Significant improvement in peak FEV1 at wk 24 was observed with both doses of tiotropium (5 and 2.5 mcg), • Adjusted mean differences of 164 mL (95% CI 103–225) and 170 mL (95% CI 108–231) vs. placebo, respectively (p < 0.0001 for both comparisons). • Statistically significant improvements were also seen in trough FEV1 at wk 24 for both doses (p < 0.01). VivaTinA-asthma® [32] (NCT01634152) Szefler SJ, Murphy K, Harper T 3rd, et al. A phase III randomized controlled trial of tiotropium add-on therapy in children with severe symptomatic asthma. J Allergy Clin Immunol. 2017;140:1277–87. 6–11 y Symptomatic severe ICS + ≥1 controller Peak FEV1 Trough FEV1 Mean FEF (Forced expiratory flow) (between 25 and 75% of forced vital capacity) • Tiotropium 5mcg add-on therapy significantly improved peak FEV1 [139 mL (95% CI 75–203; p < 0.001)]. • A significant difference was observed in improvements in trough FEV1 response vs. placebo for the 5mcg dose. NinoTinA-asthma® [33] (NCT01634113) Vrijlandt EJLE, El Azzi G, Vandewalker M, et al. Safety and efficacy of tiotropium in children aged 1–5 years with persistent asthmatic symptoms: a randomised, double-blind, placebo-controlled trial. Lancet Respir Med. 2018;6:127–37. 1–5 y Persistent asthmatic symptoms At least ICS Peak FEV1 Trough FEV1 Mean FEF (Forced expiratory flow) (between 25 and 75% of forced vital capacity) • First study to assess the safety and efficacy of tiotropium in asthmatic children aged 1–5 y. • Tolerability of tiotropium was similar to that of placebo. • Interestingly, tiotropium showed the potential to reduce asthma exacerbation risk compared with placebo. ICS Inhaled corticosteroids; FEV1 Forced expiratory volume in 1 s
tudy to assess the safety and efficacy of tiotropium in asthmatic children aged 1–5 y. • Tolerability of tiotropium was similar to that of placebo. • Interestingly, tiotropium showed the potential to reduce asthma exacerbation risk compared with placebo. ICS Inhaled corticosteroids; FEV1 Forced expiratory volume in 1 s In summary, clinical trials have shown improved lung function where tiotropium Respimat™ is used as add-on therapy to ICS (Inhaled corticosteroids) in patients with poorly controlled asthma. Tiotropium may be a useful and novel add-on treatment option, especially in patients where moderate-to-high ICS with or without a LABA (Long acting beta agonist) does not result in sufficient asthma control.
Respimat™ is used as add-on therapy to ICS (Inhaled corticosteroids) in patients with poorly controlled asthma. Tiotropium may be a useful and novel add-on treatment option, especially in patients where moderate-to-high ICS with or without a LABA (Long acting beta agonist) does not result in sufficient asthma control. Allergen-Specific Immunotherapy for Pediatric Asthma Subcutaneous immunotherapy (SCIT) requires repeated injections with an allergen extract and is available for allergens such as grass and tree pollen and house dust mite. Sublingual immunotherapy (SLIT) is also available but is more effective as a high dose preparation than a low dose preparation. It has now become available with grass pollen allergen extract in a daily sublingual tablet [34]. Its steroid-sparing effect is an important benefit for patients who have to use these drugs in high doses and in long-term regimens. However, uncontrolled asthma remains a significant risk factor for side effects, and allergen specific immunotherapy should not be considered on safety grounds for patients who cannot achieve reasonably good control of symptoms with pharmacotherapy alone. Using GRADE (Grading of Recommendations Assessment, Development and Evaluation) criteria [34] van de Griendt et al. found limited benefit of SCIT and SLIT [23] and perhaps for this reason both GINA and BTS/SIGN asthma guidelines [16, 17] do not recommend allergen specific immunotherapy for treatment of asthma in children.
ng GRADE (Grading of Recommendations Assessment, Development and Evaluation) criteria [34] van de Griendt et al. found limited benefit of SCIT and SLIT [23] and perhaps for this reason both GINA and BTS/SIGN asthma guidelines [16, 17] do not recommend allergen specific immunotherapy for treatment of asthma in children. Vitamin D for the Management of Asthma There is considerable interest in the potential of administration of vitamin D to reduce exacerbation risk and improve asthma symptom control. The combination of antimicrobial, antiviral, and anti-inflammatory activity of vitamin D might decrease the risk of exacerbations, which are often precipitated by respiratory infection, is one theory to explain its efficacy. Evidence shows inadequate vitamin D status has been reported in children with asthma in a variety of settings [35]. Lower vitamin D levels in children are associated with worse asthma control, lung function and increased risk of exacerbations [36]. Gupta et al. demonstrated a negative relationship between airway smooth muscle mass and serum vitamin D levels in children with severe therapy resistant asthma [36]. Moreover, lower vitamin D levels were associated with lower lung function and increased asthma symptoms. Children with low serum vitamin D also had lower bronchoalveolar (BAL) levels of the anti-inflammatory mediator IL-10 [37]. When peripheral blood mononuclear cells (PBMC) from children with severe therapy-resistant asthma were stimulated with dexamethasone, release of IL-10 was significantly lower than that from control PBMC. However, addition of both dexamethasone and vitamin D3 resulted in a significant increase in IL-10 secretion [37]. These in vitro data suggest vitamin D enhances steroid sensitivity in severe therapy resistant asthma, and supplementation may not only help to improve steroid responsiveness, but also may impact airway smooth muscle remodeling. A recent meta-analysis in people with predominantly mild to moderate asthma suggests that vitamin D is likely to reduce both the risk of severe asthma exacerbation and health care utilization [38].
supplementation may not only help to improve steroid responsiveness, but also may impact airway smooth muscle remodeling. A recent meta-analysis in people with predominantly mild to moderate asthma suggests that vitamin D is likely to reduce both the risk of severe asthma exacerbation and health care utilization [38]. Biological Monoclonal Antibody Treatment Omalizumab, an anti-IgE, is the first monoclonal antibody therapy for severe asthma and is now licensed for moderate-to-severe allergic asthma in adults and children aged at least 6 y with IgE greater than 30 IU/L. Omalizumab has been shown to reduce exacerbations and hospital admissions in adults and children [39, 40]. The true mechanism of action for Omalizumab in children is not known but its response is predicted by elevated high type 2 biomarkers, and reduces virus-associated exacerbations [1, 40, 41]. Mepolizumab is licensed for neutralising antibodies that target interleukin-5. Mepolizumab has recently been approved for severe eosinophilic asthma in adults and, in some regions, adolescents. In adults, Mepolizumab has been shown to reduce severe asthma exacerbations [42] and reduce need for oral corticosteroid therapy [43]. It is important to note Mepolizumab is not licensed for children (<12 y) but is licensed for adolescents (aged 12–18 y) in some regions, though very few have been included in randomized controlled trials.
mab has been shown to reduce severe asthma exacerbations [42] and reduce need for oral corticosteroid therapy [43]. It is important to note Mepolizumab is not licensed for children (<12 y) but is licensed for adolescents (aged 12–18 y) in some regions, though very few have been included in randomized controlled trials. Within the next few years there might be 5 new classes of type 2 directed biologics available. However, a need exists to identify the most appropriate pediatric and adolescent severe asthma patients for these treatments and to better understand how to measure response [1]. Macrolide Antibiotics Macrolide antibiotics reduce exacerbation frequency in bronchiectasis by either their antibiotic or anti-inflammatory effects. Brusselle et al. [44] suggested benefits of macrolide antibiotics only in adults with non-eosinophilic inflammation. However, a recent study by Gibson et al. on 420 adults with persistent uncontrolled moderate-to-severe asthma, showed oral azithromycin decreased the frequency of moderate and severe asthma exacerbations [45]. Non-eosinophilic asthma has been described in children but is still poorly understood [1]. In children and young adults with asthma, the role of macrolide antibiotics is uncertain and use of long-term macrolides is not recommended at present.
cin decreased the frequency of moderate and severe asthma exacerbations [45]. Non-eosinophilic asthma has been described in children but is still poorly understood [1]. In children and young adults with asthma, the role of macrolide antibiotics is uncertain and use of long-term macrolides is not recommended at present. Temperature-Controlled Laminar Airflow (TLA) Device The temperature-controlled laminar airflow (TLA) is a device which can be employed over a bed in a domestic environment and can result in massive reductions in allergen/particulate exposure. The device works by controlling nocturnal exposure to particulate exposure by delivering cooled and filtered air overhead of an individual with asthma during sleep. The greater density of the cooled air reverses the normal convection current, and displaces allergen-bearing particles out of the breathing zone [46]. Boyle et al. in a parallel group study for 12 mo in 282 subjects, aged between 7 and 70 y with house dust mite (HDM), cat or dog allergy showed significant improvement in asthma-specific quality of life (mini AQLQ and Pediatric AQLQ) and significantly decreased FeNO [47]. Importantly, there was a progressively greater significance of difference as the severity of asthma increased. In a post hoc analysis, patients with poorly controlled asthma [Asthma Control Test (ACT) score < 18] despite GINA stage 4 therapy had significant improvements in both symptom and sleep components of the AQLQ (Asthma Quality of Life Questionnaire) [46, 47].
ignificance of difference as the severity of asthma increased. In a post hoc analysis, patients with poorly controlled asthma [Asthma Control Test (ACT) score < 18] despite GINA stage 4 therapy had significant improvements in both symptom and sleep components of the AQLQ (Asthma Quality of Life Questionnaire) [46, 47]. Electronic Monitoring and Adherence Devices It is very well known that children do not want to and/or do not remember to take inhalers or medicines if they are feeling well, and so exacerbations on a background of poor adherence can be even more severe. Guideline based asthma care is associated with good asthma control in majority of children when adhered to [48]. Adherence in asthma remains a major barrier to effective control [49, 50] as objective reviews (using electronic adherence monitoring) show majority of studies reporting mean adherence rates of 50% [50]. Multiple studies have shown that adherence rates of at least 75%–80% are required to significantly improve asthma control particularly in difficult to control asthma [48, 51, 52]. Reasons for non-adherence are intentional from children and families and non-intentional. They evolve from illness perceptions, medication beliefs, and practical adherence barriers [50].
es of at least 75%–80% are required to significantly improve asthma control particularly in difficult to control asthma [48, 51, 52]. Reasons for non-adherence are intentional from children and families and non-intentional. They evolve from illness perceptions, medication beliefs, and practical adherence barriers [50]. With digital technology becoming prominent within healthcare, electronic monitoring devices appear to be a good novel approach to management. The device itself is a small electronic component which can be attached onto a metered dose inhaler or that is designed as part of the inhaler. Currently developed models can record that an actuation has occurred and the time, give an audio reminder for the child and parent, and transmit this data wirelessly, such that readings can be reviewed in real time and subsequently analyzed. It can be used in conjunction with a mobile device app which can measure other asthma triggers. Several randomized controlled trials have used an electronic monitoring device to assess adherence [53–57]. All showed a statistically significant increase in adherence for children that used the monitoring device.
analyzed. It can be used in conjunction with a mobile device app which can measure other asthma triggers. Several randomized controlled trials have used an electronic monitoring device to assess adherence [53–57]. All showed a statistically significant increase in adherence for children that used the monitoring device. Directly observed therapy and feedback via a mobile device is a new concept in inhaler technique monitoring [58]. Shields et al. noted no previous use of Mobile Direct Observation of Therapy (MDOT) in inhaler technique monitoring [58]. They conducted a pilot study using MDOT over a 6-wk period in 22 children with difficult to control asthma. Healthcare professionals evaluated inhaler technique using uploaded videos onto a secure platform and provided telephone instruction on improving inhaler use. Outcomes showed improvement in inhaler technique, asthma control and reduction in FeNO. In summary, there is certainly a role for these technologies to assist monitoring, encourage adherence and differentiate poor response from poor adherence.
Directly observed therapy and feedback via a mobile device is a new concept in inhaler technique monitoring [58]. Shields et al. noted no previous use of Mobile Direct Observation of Therapy (MDOT) in inhaler technique monitoring [58]. They conducted a pilot study using MDOT over a 6-wk period in 22 children with difficult to control asthma. Healthcare professionals evaluated inhaler technique using uploaded videos onto a secure platform and provided telephone instruction on improving inhaler use. Outcomes showed improvement in inhaler technique, asthma control and reduction in FeNO. In summary, there is certainly a role for these technologies to assist monitoring, encourage adherence and differentiate poor response from poor adherence. Summary There are important developments in the management of asthma that clinicians should be aware of and the authors have aimed to summarize them in this review. The authors have placed an emphasis on good clinical knowledge and primary prevention, understanding the heterogenic nature of asthma pathophysiology, and therefore the importance of personalized care and treatment plans. The outcomes of recent research on pharmacological treatments are beneficial when considering new or alternative treatment options particularly for severe or difficult to control asthma and authors have highlighted other alternative methods of management upon which there is much ongoing research. Author Contributions GB drafted the initial draft. PP and AG reviewed the initial draft and wrote the subsequent draft. AG will act as guarantor for this paper.
Summary There are important developments in the management of asthma that clinicians should be aware of and the authors have aimed to summarize them in this review. The authors have placed an emphasis on good clinical knowledge and primary prevention, understanding the heterogenic nature of asthma pathophysiology, and therefore the importance of personalized care and treatment plans. The outcomes of recent research on pharmacological treatments are beneficial when considering new or alternative treatment options particularly for severe or difficult to control asthma and authors have highlighted other alternative methods of management upon which there is much ongoing research. Author Contributions GB drafted the initial draft. PP and AG reviewed the initial draft and wrote the subsequent draft. AG will act as guarantor for this paper. Compliance with Ethical Standards Conflict of Interest None.
Introduction Body composition is a valuable indicator for assessing the adiposity of an individual. Anthropometric measurements are still widely used to assess the body composition in many fields and epidemiological investigations [1]. The amount of body fat differs with age, sex, genetic, environmental and socio-economic conditions and is very useful for assessing the health and nutritional status of a community [2–4]. Body composition status reflects nutritional intakes, losses and needs over time [i.e., fat-free mass (FFM) and FFM index] along with the prevalence of undernutrition. Percent of body fat (PBF) is considered to be a relatively better measure of excess adiposity or obesity. There are several socially deprived communities in India, among which tribal communities are the most vulnerable ones. India has a variety of tribal communities that constitute about 8.6% of the total population [5]; probably the largest tribal community population in the world. A few studies are available on fat mass, fat-free mass and fat-mass index in India [6–12] and from the state of Tripura almost no significant study has been reported. So, the present study has been taken to examine the body composition characteristics including fat distribution among Chakma tribal and non-tribal Bengali girls living in rural areas of Tripura, North-East India.
fat-mass index in India [6–12] and from the state of Tripura almost no significant study has been reported. So, the present study has been taken to examine the body composition characteristics including fat distribution among Chakma tribal and non-tribal Bengali girls living in rural areas of Tripura, North-East India. Materials and Methods A cross-sectional study was carried out among 744 school going Chakma tribal and non- tribal Bengali girls (366 Chakma tribal and 378 Bengali girls) aged 6 to 12 y residing in North, Dhalai, Unokoti and South districts of Tripura. Tripura is one of the North- Eastern states of India which is the main homeland of a number of tribes. Geographically, it lies between 22°56′ & 24°32′, North longitude & between 91°10′ & 92°21′, East longitude with a total area of 10,491 Sq.km. According to 2011 census, in Tripura, out of the territories’ total population of 36,71,032, Scheduled tribes numbered 11,66,813, which constitute 31.78% of the total population. The subjects were selected from rural areas (villages) of the state of Tripura, which is the habitat of the Chakma tribal and non-tribal Bengali populations. The school going girls were selected using a stratified multistage clustered random sampling method. Initially 871 girls (Chakma: 423 and Bengali girls: 448) in the age group of 6-12 y were identified and approached to participate in the study. The age of each student was recorded from the school register and their birth certificates. Mothers of the children were included as respondents. Apart from the anthropometric measurements of the children, information on various factors that directly or indirectly affect the nutritional outcome was also obtained. A semi-structured questionnaire was developed which included some baseline information of the parents and the children in regard to nutrition. The questionnaire was finalized by pretest and consultation prior to beginning of the study. All the data were collected after getting the consent from their parents and school authorities. Decimal age calendar is used to determine the student’s decimal age by subtracting the date of birth from the date of data collected. The subjects in various age groups were classified by following the same principle. Children suffering from any systemic disease or those who had undergone any major surgical operation were excluded from the study.
to determine the student’s decimal age by subtracting the date of birth from the date of data collected. The subjects in various age groups were classified by following the same principle. Children suffering from any systemic disease or those who had undergone any major surgical operation were excluded from the study. Of these 871 girls, 127 of them (Chakma: 42 and Bengali: 85) were excluded from the study as their date of birth were either not valid or they were not in the age group of 6-12 y. This study was conducted in accordance with the ethical guidelines for human experiments, as laid down the Helsinki Declaration of 2000 [13]. The data were collected during the period from August 2015 through April 2016. Other general information regarding their socio-economic condition, parent’s occupation and education, family income, size, structure and property etc., was also recorded. According to the modified Kuppusswamy scale, the socio-economic status of all the children was low [14].
Of these 871 girls, 127 of them (Chakma: 42 and Bengali: 85) were excluded from the study as their date of birth were either not valid or they were not in the age group of 6-12 y. This study was conducted in accordance with the ethical guidelines for human experiments, as laid down the Helsinki Declaration of 2000 [13]. The data were collected during the period from August 2015 through April 2016. Other general information regarding their socio-economic condition, parent’s occupation and education, family income, size, structure and property etc., was also recorded. According to the modified Kuppusswamy scale, the socio-economic status of all the children was low [14]. The anthropometric measurements like height, body weight and triceps skinfold thickness (TRSF) and subscapular skinfold thickness (SBSF) of each girl were measured using standard technique [15]. Height was measured by an anthropometer rod (GPM Swiss made) with the head held in the Frankfort horizontal plane and recorded to the nearest 0.1 cm. Weight of the subject, wearing minimum clothing and with bare feet, was taken in the early morning (empty stomach) using a portable weighing machine (Libra) to the nearest 0.5 kg. Body mass index (BMI) was calculated by dividing body weight with standing height (kg/m2). Skinfold thickness was measured using the Holtain skinfold caliper with a constant spring pressure of 10 g mm−2 on the right side of the body. Mean of the three readings in single location was accepted.
ra) to the nearest 0.5 kg. Body mass index (BMI) was calculated by dividing body weight with standing height (kg/m2). Skinfold thickness was measured using the Holtain skinfold caliper with a constant spring pressure of 10 g mm−2 on the right side of the body. Mean of the three readings in single location was accepted. The intra-observer technical error of measurement (TEM) was calculated to determine the accuracy of the measurements by the standard procedure of Ulijaszek and Kerr in 1999 [16]. The TEM was calculated using the following equation: TEM=√ΣD2/2n,D=difference between the measurementsn=number of individuals. Double measurements from the same number of subjects (n = 10) had been taken by the same measurer (SS) with six hours of difference. The corresponding calculated values of intra observer showed that, all the measurements were within the normal range of errors reported in literatures [16–18]. Mean and standard error of mean were computed for each anthropometric variable according to the age and ethnicity. Skinfold equation for estimating percentage of body fat (%BF) of Chakma tribal and Bengali girls was used from the method developed by Slaughter et al., in 1988 [19] by using multicomponent model reference measures. This equation uses the sum of triceps and subscapular skinfold thickness (mm) to predict body fat. %Bodyfat=1.33(TRSF+SBSF)–0.013(TRSF+SBSF)2–2.5 Fatmass(kg)=Bodyweight(kg)x%BF/100
al and Bengali girls was used from the method developed by Slaughter et al., in 1988 [19] by using multicomponent model reference measures. This equation uses the sum of triceps and subscapular skinfold thickness (mm) to predict body fat. %Bodyfat=1.33(TRSF+SBSF)–0.013(TRSF+SBSF)2–2.5 Fatmass(kg)=Bodyweight(kg)x%BF/100 Fat-free mass (FFM) was calculated by subtracting fat mass (FM) from weight. FM and FFM each were then divided by height-squared to produce the fat-mass index (FMI) and fat-free mass index (FFMI), respectively. Person’s correlation coefficient was used to evaluate the relationship between the anthropometric variables. Student’s t test has been applied to calculate the level of significance. The statistical analysis was performed using statistical package for social science (SPSS) software.
ree mass index (FFMI), respectively. Person’s correlation coefficient was used to evaluate the relationship between the anthropometric variables. Student’s t test has been applied to calculate the level of significance. The statistical analysis was performed using statistical package for social science (SPSS) software. Results Sample size for each age group, mean and standard error of mean of height, weight, BMI, SBSF and TRSF of Chakma tribal and non-tribal Bengali girls are presented in Table 1. Height, weight, BMI, SBSF and TRSF (except in 9 y for Chakma tribal girls) between the two populations increased with advances in age. The Chakma girls were observed to be heavier than the Bengali girls. The age specific mean skinfold thickness (e.g., TRSF and SBSF) values were observed to be statistically higher among Chakma tribal girls compared to Bengali girls (p < 0.01). The age-specific body composition variables like PBF, FM, FFM, FMI and FFMI of two populations are represented in Table 2.Table 1 Age-specific descriptive statistics of height, weight, BMI, Subscapular (SBSF) and triceps (TRSF) skinfold thickness of Chakma tribal and Bengali non-tribal girls of Tripura
irls (p < 0.01). The age-specific body composition variables like PBF, FM, FFM, FMI and FFMI of two populations are represented in Table 2.Table 1 Age-specific descriptive statistics of height, weight, BMI, Subscapular (SBSF) and triceps (TRSF) skinfold thickness of Chakma tribal and Bengali non-tribal girls of Tripura Age (years) N Height (cm) Weight (kg) BMI (kg/ m)2 SBSF (mm) TRSF (mm) Chakma tribal girls 6 55 117.58 ± 0.81 19.85 ± 0.31 14.32 ± 0.10 6.04 ± 0.12 7.76 ± 0.14 7 54 122.40 ± 0.77 22.50 ± 0.32 14.87 ± 0.10 6.29 ± 0.13 7.97 ± 0.18 8 51 127.46 ± 0.72 24.38 ± 0.40 14.95 ± 0.13 7.86 ± 0.19 8.22 ± 0.20 9 52 131.33 ± 0.86 26.16 ± 0.44 15.11 ± 0.13 7.17 ± 0.23 7.73 ± 0.21 10 53 133.62 ± 0.69 29.44 ± 0.66 16.40 ± 0.24 7.72 ± 0.29 8.29 ± 0.34 11 51 138.01 ± 0.88 33.57 ± 0.73 17.53 ± 0.23 8.44 ± 0.32 8.77 ± 0.31 12 50 142.95 ± 0.91 36.36 ± 0.77 17.69 ± 0.21 9.87 ± 0.28 9.65 ± 0.21 Bengali non-tribal girls 6 55 114.66 ± 0.75 17.32 ± 0.29 13.12 ± 0.07 5.14 ± 0.14 6.20 ± 0.17 7 55 119.78 ± 0.72 18.93 ± 0.25 13.17 ± 0.05 5.26 ± 0.11 6.56 ± 0.17 8 54 124.18 ± 0.75 20.85 ± 0.27 13.49 ± 0.05 6.29 ± 0.19 7.35 ± 0.19 9 54 127.76 ± 0.77 22.93 ± 0.35 14.01 ± 0.10 6.49 ± 0.25 7.67 ± 0.24 10 52 131.63 ± 0.69 27.53 ± 0.58 15.82 ± 0.23 7.57 ± 0.22 8.50 ± 0.31 11 55 136.24 ± 0.66 31.14 ± 0.65 16.71 ± 0.25 8.52 ± 0.25 8.64 ± 0.34 12 53 141.75 ± 0.86 34.90 ± 0.82 17.29 ± 0.30 9.84 ± 0.39 9.42 ± 0.44 Values: Mean ± SE; N Number of girls
0.19 9 54 127.76 ± 0.77 22.93 ± 0.35 14.01 ± 0.10 6.49 ± 0.25 7.67 ± 0.24 10 52 131.63 ± 0.69 27.53 ± 0.58 15.82 ± 0.23 7.57 ± 0.22 8.50 ± 0.31 11 55 136.24 ± 0.66 31.14 ± 0.65 16.71 ± 0.25 8.52 ± 0.25 8.64 ± 0.34 12 53 141.75 ± 0.86 34.90 ± 0.82 17.29 ± 0.30 9.84 ± 0.39 9.42 ± 0.44 Values: Mean ± SE; N Number of girls Table 2 Age-specific descriptive statistics: mean and standard error (in parenthesis) of anthropometric variables of body composition in Chakma tribal and Bengali non-tribal girls of Tripura
0.19 9 54 127.76 ± 0.77 22.93 ± 0.35 14.01 ± 0.10 6.49 ± 0.25 7.67 ± 0.24 10 52 131.63 ± 0.69 27.53 ± 0.58 15.82 ± 0.23 7.57 ± 0.22 8.50 ± 0.31 11 55 136.24 ± 0.66 31.14 ± 0.65 16.71 ± 0.25 8.52 ± 0.25 8.64 ± 0.34 12 53 141.75 ± 0.86 34.90 ± 0.82 17.29 ± 0.30 9.84 ± 0.39 9.42 ± 0.44 Values: Mean ± SE; N Number of girls Table 2 Age-specific descriptive statistics: mean and standard error (in parenthesis) of anthropometric variables of body composition in Chakma tribal and Bengali non-tribal girls of Tripura Age (years) N PBF (%) FM (kg) FFM (kg) FMI (kg /m)2 FFMI (kg /m)2 Chakma girls Bengali girls Chakma girls Bengali girls Chakma girls Bengali girls Chakma girls Bengali girls Chakma girls Bengali girls Chakma girls Bengali girls 6 55 55 13.34 (0.23) 10.84 (0.30) 2.65 (0.07) 1.92 (0.08) 17.19 (0.27) 15.41 (0.21) 1.91 (0.04) 1.43 (0.04) 12.41 (0.09) 11.69 (0.05) 7 54 55 13.77 (0.27) 11.36 (0.26) 3.11 (0.09) 2.17 (0.07) 19.39 (0.26) 16.76 (0.20) 2.05 (0.04) 1.50 (0.04) 12.82 (0.08) 11.67 (0.05) 8 51 54 15.43 (0.33) 13.14 (0.34) 3.78 (0.12) 2.77 (0.10) 20.60 (0.32) 18.07 (0.19) 2.32 (0.06) 1.78 (0.05) 12.64 (0.10) 11.71 (0.05) 9 52 54 14.33 (0.39) 13.58 (0.44) 3.80 (0.15) 3.18 (0.14) 22.35 (0.34) 19.75 (0.23) 2.18 (0.07) 1.91 (0.07) 12.93 (0.10) 12.10 (0.09) 10 53 52 15.21 (0.51) 15.34 (0.46) 4.60 (0.26) 4.34 (0.21) 24.84 (0.45) 23.19 (0.39) 2.53 (0.12) 2.47 (0.10) 13.86 (0.16) 13.35 (0.15) 11 51 55 16.32 (0.48) 16.27 (0.47) 5.57 (0.25) 5.20 (0.25) 28.00 (0.54) 25.94 (0.43) 2.89 (0.11) 2.76 (0.11) 14.64 (0.17) 13.95 (0.17) 12 50 53 18.39 (0.36) 17.90 (0.59) 6.75 (0.23) 6.45 (0.34) 29.61 (0.58) 28.44 (0.52) 3.27 (0.08) 3.16 (0.14) 14.43 (0.16) 14.14 (0.20) FFM Fat-free mass; FFMI Fat-free mass index; FM Fat mass; FMI Fat-mass index; PBF Percent body fat
.20 (0.25) 28.00 (0.54) 25.94 (0.43) 2.89 (0.11) 2.76 (0.11) 14.64 (0.17) 13.95 (0.17) 12 50 53 18.39 (0.36) 17.90 (0.59) 6.75 (0.23) 6.45 (0.34) 29.61 (0.58) 28.44 (0.52) 3.27 (0.08) 3.16 (0.14) 14.43 (0.16) 14.14 (0.20) FFM Fat-free mass; FFMI Fat-free mass index; FM Fat mass; FMI Fat-mass index; PBF Percent body fat Age specific mean values of FM and FFM were observed to progressively increase with age among both tribal and non-tribal communities. PBF, FMI and FFMI did not exhibit any particular trend between the two communities. The age specific mean value of TRSF was higher at the age of 12 y (9.65 and 9.42 mm) and lowest in 9 y (7.73 mm) and 6 y (6.20 mm) for the Chakma tribal and Bengali girls respectively. The age-specific mean value of SBSF was ranged 6.04 mm to 9.87 mm and 5.14 mm to 9.84 mm among Chakma tribal and Bengali girls, respectively. Age-specific mean BMI values were observed to be significantly (p < 0.01) higher among Chakma girls than the Bengalis, especially in the early ages (6-9 y). The age-specific mean BMI values ranged from 14.32 kg/m2 to 17.69 kg/m2 and 13.12 kg/m2 to 17.29 kg/m2 among Chakma and Bengali girls, respectively. PBF and FFM values of Chakma girls was significantly (p < 0.01) higher than that of Bengali girls. SBSF and TRSF thickness were significantly (p < 0.01) higher in Chakma tribal girls than in Bengali girls only between the ages 6-8 y.
.69 kg/m2 and 13.12 kg/m2 to 17.29 kg/m2 among Chakma and Bengali girls, respectively. PBF and FFM values of Chakma girls was significantly (p < 0.01) higher than that of Bengali girls. SBSF and TRSF thickness were significantly (p < 0.01) higher in Chakma tribal girls than in Bengali girls only between the ages 6-8 y. Figure 1 shows that both the tribal and non-tribal girls gained more PBF between ages between 10 to 12 y, but the Chakma tribal girls gained more fat at early ages (6-9 y). But similar pattern was happening in case of FFM. FFM showed an almost linear positive increment from 6 to 12 y in both the populations (Fig. 2).Fig. 1 Changes in percent body fat (PBF) of Chakma tribal and Bengali girls Fig. 2 Changes in fat-free mass (FFM) of Chakma tribal and Bengali girls Figure 3 shows skinfold ratio of triceps to subscapular between the two populations. Pattern of the subscapular to triceps skinfold ratio, except in ages 8-10 y, was almost same in both the study populations. The ratios for the Chakma tribal and Bengali non-tribal populations showed progressive increment (except in age 9 y) with advancement of age. Chakma tribal girls possessed significantly higher subscapular to triceps ratios than Bengali girls at the age between 8 and 10 y, while the Bengali girls shows slightly higher ratio at the age 6,7,11 and 12 y.Fig. 3 Subscapular to triceps skinfold ratio of Chakma tribal and Bengali girls
9 y) with advancement of age. Chakma tribal girls possessed significantly higher subscapular to triceps ratios than Bengali girls at the age between 8 and 10 y, while the Bengali girls shows slightly higher ratio at the age 6,7,11 and 12 y.Fig. 3 Subscapular to triceps skinfold ratio of Chakma tribal and Bengali girls Graph of FMI showed that body fatness of Chakma girls increases up to the age of 8 y and thereafter a steep fall occurs at the age 9 y and after that it increases up to the age of 12 y. Body fatness of Bengali girls increased with advances in age (Fig. 4). FFMI of Bengali girls showed a steady increase with age, while the Chakma girls showed a different shape of adiposity with a one small dip at the age 12 y. Maximum difference in FFMI between the two populations was found at early adolescence (6-9 y) period (Fig. 5).Fig. 4 Changes in fat-mass index (FMI) of Chakma tribal and Bengali girls Fig. 5 Changes in Fat-free mass index (FFMI) of Chakma tribal and Bengali girls Correlation studies show that PBF and FFM were highly correlated (p < 0.01) with all anthropometric parameters (Table 3). In both the study populations, the patterns between PBF and anthropometric traits were the same. BMI was also highly correlated with PBF (r = 0.8, r = 0.9; p < 0.01) and FFM (r = 0.9; p < 0.01) in both the populations.Table 3 Pearson’s correlation between anthropometric measurements of tribal and non-tribal girls of Tripura
th the study populations, the patterns between PBF and anthropometric traits were the same. BMI was also highly correlated with PBF (r = 0.8, r = 0.9; p < 0.01) and FFM (r = 0.9; p < 0.01) in both the populations.Table 3 Pearson’s correlation between anthropometric measurements of tribal and non-tribal girls of Tripura Height Weight BMI SBSF TRSF FFM Chakma tribal girls PBF 0.90 0.92 0.86 0.99 0.97 0.91 FFM 0.98 0.99 0.98 0.91 0.87 – Bengali girls PBF 0.99 0.99 0.96 0.87 0.99 0.99 FFM 0.98 0.99 0.98 0.89 0.97 – All correlation are significant at p < 0.01 level BMI Body mass index; FFM Fat-free mass; PBF Percent body fat; SBSF Subscapular skinfold thickness; TRSF Triceps skinfold thickness Discussion The distribution and amount of body fat (e.g., FM) and composition of muscle mass (e.g., lean body mass or FFM) are important to understand the health outcomes in body composition assessment in infants and children [12, 20–22]. Studies have reported marked ethnic differences in the relationship of visceral and peripheral adiposity [1, 9–11]. But the differences in distribution of fat are evident during early childhood with differences in total body adiposity onset before puberty [23, 24]. Such differences in body fat distribution are mediated by the hormonal fluctuations [25].
differences in the relationship of visceral and peripheral adiposity [1, 9–11]. But the differences in distribution of fat are evident during early childhood with differences in total body adiposity onset before puberty [23, 24]. Such differences in body fat distribution are mediated by the hormonal fluctuations [25]. Several studies have authenticated different skinfold equations with alternate methods of estimation and recommended the use of the equations of Slaughter et al., in 1988 [19] for the evaluation of body fat among pre-pubertal children [26, 27]. The present study was carried out to evaluate PBF content in order to evaluate the body composition of rural school-going tribal and non-tribal girls of Tripura using this equation of Slaughter et al., 1988 [19]. Furthermore, several studies have assessed body composition characteristics in children utilizing these equations for estimation of PBF among children from both non-Indian [8, 27–29] and Indian ethnic populations [6, 7, 10–12]. The results indicated pronounced ethnic differences in adiposity and body composition measures (e.g., PBF, FM, FMI, FFMI) between Chakma tribal and Bengali non-tribal girls (p < 0.01) of Tripura. The differences in adiposity measures (PBF, FM and FFM) were also observed to be more prominent with the advancement of age between the two populations.
nced ethnic differences in adiposity and body composition measures (e.g., PBF, FM, FMI, FFMI) between Chakma tribal and Bengali non-tribal girls (p < 0.01) of Tripura. The differences in adiposity measures (PBF, FM and FFM) were also observed to be more prominent with the advancement of age between the two populations. Present study also suggested a characteristic spurt in the growth of the PBF and FFM. This spurt has been found to coincide with the peak velocities in height and weight [30]. Height is more strongly related to the indicator of lean body mass than to the indicator of adiposity [31]. It is interesting to note that the present study also shows the similar pattern. An age specific FM value observed in the present study was higher than those obtained from Santal [7], Nepalese [8], Bengalese [1] and Indian [32] girls. The indices of FMI and FFMI therefore suggest a powerful outline for evaluating inter and intra-population variability in body composition and address physique (FFMI) as well as relative adiposity (FMI). The ethnic variation might be attributed to genetic adaptations to ancestral environment and exposure to more existing ecological stresses, as it has been reported that variations in PBF, FM, FMI and FFMI between populations could be due to their ethnic elements [10, 33, 34].
(FFMI) as well as relative adiposity (FMI). The ethnic variation might be attributed to genetic adaptations to ancestral environment and exposure to more existing ecological stresses, as it has been reported that variations in PBF, FM, FMI and FFMI between populations could be due to their ethnic elements [10, 33, 34]. Correlation study suggests that increased PBF and FFM are accompanied by an increase in anthropometric measurements between the two populations. Significant relationship between BMI and PBF, and BMI and FFM, indicate that changes in BMI represent changes in PBF and FFM [35]. Again, the significant correlation between PBF and FFM highlights that the developing pattern of PBF and FFM are similar in tribal and non-tribal populations. Conclusions The present cross-sectional study recommends the evaluation of body composition including fat pattern to improve screening for malnutrition in school children in field and clinical settings in order to reduce chronic malnutrition related morbidity and mortality. The findings of the present study are important for future investigations in the field of epidemiological settings to identify the risk of lower or higher adiposity status and to improve human health through proper intervention programmes. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Conclusions The present cross-sectional study recommends the evaluation of body composition including fat pattern to improve screening for malnutrition in school children in field and clinical settings in order to reduce chronic malnutrition related morbidity and mortality. The findings of the present study are important for future investigations in the field of epidemiological settings to identify the risk of lower or higher adiposity status and to improve human health through proper intervention programmes. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements The researchers acknowledge all the school authorities for providing permission to carry out this work. We would like to thank all participating subjects of the present study fortheir cooperation. We also thank Dr Parasmani Dasgupta, Professor, Indian Statistical Institute, Kolkata and Mr. Samrat Hore, Assistant Professor, Department of Statistics, Tripura University, for their guidance and valuable suggestions during the work. Authors’ Contributions SS and SKS have equally contributed to the conception and design of the study, acquisition of data, analysis and interpretation of data, drafting the manuscript and revising it critically for important intellectual content and the final approval of the version to being submitted. Dr. Parasmani Dasgupta, Professor, Biological Anthropology Unit, ISI kolkata, will act as guarantor for this paper. Compliance with Ethical Standards Conflict of Interest None.
Authors’ Contributions SS and SKS have equally contributed to the conception and design of the study, acquisition of data, analysis and interpretation of data, drafting the manuscript and revising it critically for important intellectual content and the final approval of the version to being submitted. Dr. Parasmani Dasgupta, Professor, Biological Anthropology Unit, ISI kolkata, will act as guarantor for this paper. Compliance with Ethical Standards Conflict of Interest None. Source of Funding Tripura University funded this study.
To the Editor: Childhood undernutrition continues to be a significant health problem in resource-limited settings, contributing to morbidity, mortality and a frequent cause of hospitalization [1]. Children with severe acute malnutrition (SAM) die early, generally within 48 h of hospital admission [2, 3], before the impact of nutritional rehabilitation is visible in them [4]. Better understanding of risk factors of mortality will be helpful in reducing the mortality by timely recognition and specific intervention in these children. There is paucity of studies on predictors of early death in hospitalized SAM children in India.
the impact of nutritional rehabilitation is visible in them [4]. Better understanding of risk factors of mortality will be helpful in reducing the mortality by timely recognition and specific intervention in these children. There is paucity of studies on predictors of early death in hospitalized SAM children in India. We conducted an observational study from September 2016 through May 2018 to identify risk factors of mortality in hospitalized children, aged 6 to 60 mo, fulfilling the WHO criteria of SAM. Children with preterm birth or intrauterine growth retardation (IUGR) at birth, inborn error of metabolism, congenital anomalies, chronic renal failure, cerebral palsy, chronic liver disease, and chromosomal abnormalities were excluded. One hundred and twenty two children with SAM were assessed for eligibility. One hundred and ten children met the inclusion criteria and 12 were excluded. Of these 110 children, 57 (51.8%) had edematous malnutrition and 53 (48.1%) had non edematous malnutrition. Out of total children, 90 (81.8%) were discharged from the hospital, 18 (16.6%) died and 2 (1.8%) left against medical advice (LAMA, excluded from the analysis). Males constituted 72 (65.5%) of the children; 51 (46.6%) of the children were in age group of 13 to 36 mo. Nine (50%) children died within 3 d and 16 (88.9%) within 5 d of hospitalization. More children died in edematous group than in non edematous group [12 (21%) vs. 6 (11.3%); OR, 2.18]. More than half (n = 10) of the deaths occurred in age group 13–16 mo. Risk factors of mortality were analyzed on binary logistic regression for independent association, and it was found that children with fatal outcome were 11.29 times more likely to have shock (p = 0.001), 10.2 times more likely to have dehydration (p < 0.001), 17.2 times more likely to have acute kidney injury (p < 0.001) and 7.1 times more likely to have hyponatremia (p = 0.01). The presence of acute diarrhea had six times the odds of mortality (p < 0.001).
utcome were 11.29 times more likely to have shock (p = 0.001), 10.2 times more likely to have dehydration (p < 0.001), 17.2 times more likely to have acute kidney injury (p < 0.001) and 7.1 times more likely to have hyponatremia (p = 0.01). The presence of acute diarrhea had six times the odds of mortality (p < 0.001). In this study we found that features of shock, severe dehydration, oliguria and hyponatremia were independent predictors of mortality. The presence of one or more of these risk factors in children with SAM should alert the physician of increased mortality risk in these children and requires early stabilization, close monitoring, and appropriate therapy. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of Interest None.
Apps in medicine are based on algorithms and are getting increasingly used, specially in critical care [1, 2]. Some of these apps are time sensitive and thus have given rise to the concept of “golden minute” and have helped reduce mortality. Unfortunately, these algorithms are still not very easily available at bedside, specially on devices like mobile phones. In contrast to its competitors e.g., Algomed, Algoman allows the user to create algorithms. There is no denying that there is a e-revolution in medical education and practice [3]. The era of artificial intelligence in medicine is approaching fast [4]. ALGOMAN is a timely intervention to gear up the “net generation” of medical students, medical educators and clinicians. Algoman creates algorithms that turn into an app on the smartphones that can act like “pocket brains”. This waives off the need to navigate through the increasing volumes of medical literature before making life critical decisions in time limited settings of the intensive care unit (ICU) [2]. The process of creating algorithm is as follows: After you login to the website, go to create algorithms. Click on the boxes, key in the text. The four dots on each of the box turn green when clicked, connect one dot to the other dot on another box by clicking on the latter. If you add step/ block, additional boxes get added, thus creating an algorithm (Fig. 1).Fig. 1 The working of an Algoman
ite, go to create algorithms. Click on the boxes, key in the text. The four dots on each of the box turn green when clicked, connect one dot to the other dot on another box by clicking on the latter. If you add step/ block, additional boxes get added, thus creating an algorithm (Fig. 1).Fig. 1 The working of an Algoman Algorithms have one major problem and that is they are vulnerable to changes and these are a corollary to ongoing research, for every change one needs to go through the process of coding and this means cost and time spent on going through the whole process repeatedly. Algoman is a simple solution to the complex problem of changing algorithms, and makes it easy to make an app on smartphones. Computerized health diagnostics and decision making algorithms can provide timely clinical decision support at bedside and improvise the process of adherence to evidence based guidelines, and be a source for education and research [2]. Moreover, these algorithms can be integrated with hardware, and embedded with machine learning modules, to develop a fully functional artificial intelligence-based medico bot. Thus, to conclude, Algoman can imbibe algorithmic learning which will be the future of medicine. Algorithms would create precision in diagnosis and management [4]. The future would be to add checklist to Algoman. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Resistance to antibiotics is as old as antibacterial therapy itself. The mechanisms of resistance and the implications thereof are same in all parts of the world and in all patient populations. The Indian Journal of Pediatrics invited the two editors to assemble a series of articles on the current status of resistance to antibacterial agents for its readership.
bacterial therapy itself. The mechanisms of resistance and the implications thereof are same in all parts of the world and in all patient populations. The Indian Journal of Pediatrics invited the two editors to assemble a series of articles on the current status of resistance to antibacterial agents for its readership. In order to put the subject matter in perspective, the first three chapters discuss information related to antibacterial agents in general. The two part review “Antibiotics: from the beginning to the future” contributed by the three US authors discusses where we are, how we got here, and what are the potential avenues to improve the gloomy prospects [1, 2]. The third article “Diagnostic microbiology from the beginning to the future: Regional antibiogram as public health tools” contributed by US authors is complementing the first two by emphasizing the role of diagnostic microbiology in management of bacterial infections [3]. The article deals with the public health relevance of microbiology and discusses in detail the generation and utilization of cumulative antibiograms at the institutional and regional levels. The pitfalls and shortcomings in large national databases on antibiotic resistance with respect to day-to-day patient care have been out into perspective. The fourth article “Controversies in treating asymptomatic bacteriuria and urinary tract infection”, also from US authors, uses a case based approach to highlight the overuse of antibiotics for a very common scenario in everyday clinical practice [4]. The next chapter by Ashok Rattan from India “How to treat sepsis in the background of resistance” focuses on the impact of pharmacodynamics and pharmacokinetics on the effectiveness of antimicrobial therapy with special reference to pediatric age groups [5].
for a very common scenario in everyday clinical practice [4]. The next chapter by Ashok Rattan from India “How to treat sepsis in the background of resistance” focuses on the impact of pharmacodynamics and pharmacokinetics on the effectiveness of antimicrobial therapy with special reference to pediatric age groups [5]. The subsequent chapters provide data generated by authors in India. “Neonatal Sepsis part 1: Mortality and Morbidity in Neonatal Sepsis due to MDR (multidrug-resistant) organisms” is contributed by the editor from India and Neelam Kler, J K Oberoi, Anurag Fursule, Anup Kumar and Anup Thakur. Presence of multidrug resistant organisms in NNU in India is discussed in detail. The mortality due to MDRO sepsis is significantly higher as compared to infections caused by susceptible bacteria. Morbidities in neonates include prolonged use of total parenteral nutrition, need for central venous catheter, invasive ventilation, increased duration of hospital stay and neurologic sequelae [6]. “Neonatal Sepsis part 2: Treatment of Neonatal sepsis in MDRO infections” is contributed by Sankalp Dudeja and discusses all the possible therapeutic options in the background of multidrug resistance [7].
The subsequent chapters provide data generated by authors in India. “Neonatal Sepsis part 1: Mortality and Morbidity in Neonatal Sepsis due to MDR (multidrug-resistant) organisms” is contributed by the editor from India and Neelam Kler, J K Oberoi, Anurag Fursule, Anup Kumar and Anup Thakur. Presence of multidrug resistant organisms in NNU in India is discussed in detail. The mortality due to MDRO sepsis is significantly higher as compared to infections caused by susceptible bacteria. Morbidities in neonates include prolonged use of total parenteral nutrition, need for central venous catheter, invasive ventilation, increased duration of hospital stay and neurologic sequelae [6]. “Neonatal Sepsis part 2: Treatment of Neonatal sepsis in MDRO infections” is contributed by Sankalp Dudeja and discusses all the possible therapeutic options in the background of multidrug resistance [7]. “Paediatric Intensive Care Unit Blood Culture isolates and the antibiograms generated over a period of five years” is contributed by Chand Wattal and Neeraj Goel. Specimens of blood from patients with serious infections are the most sacrosanct samples received by a bacteriology laboratory. This article adds to the scarce data from pediatric intensive care units (PICU) in India. The cumulative data reproduced here can be of use for making an antibiogram. The data clearly indicate the significant presence of MDROs in this setting [8]. The editors gratefully acknowledge the expertise and effort by the contributing authors. Publisher’s Note
“Paediatric Intensive Care Unit Blood Culture isolates and the antibiograms generated over a period of five years” is contributed by Chand Wattal and Neeraj Goel. Specimens of blood from patients with serious infections are the most sacrosanct samples received by a bacteriology laboratory. This article adds to the scarce data from pediatric intensive care units (PICU) in India. The cumulative data reproduced here can be of use for making an antibiogram. The data clearly indicate the significant presence of MDROs in this setting [8]. The editors gratefully acknowledge the expertise and effort by the contributing authors. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of Interest None
Introduction Multi-drug-resistant (MDR) infections in the pediatric age group, especially due to gram-negative bacteria (GNB) are increasing world over with higher mortality [1]. Overall mortality in Indian PICU due to hospital-acquired infections (HAIs) has been estimated to be 26%. Bloodstream infections (BSI) are considered as the most serious infections in pediatric intensive care units (PICU) and carry the highest mortality with an estimated attributable mortality of 3% and crude mortality of 18% [2, 3]. Many risk factors, especially in PICU, for HAIs are common for adults and children which include exposure to invasive devices including intravascular catheters, intubation, hyper-alimentation, and other comorbidities like immune-suppression. Additional risk factors in the pediatric population include immature innate and adaptive immunity which further affects the severity and duration of infections [4, 5]. Infectious Diseases Society of America (IDSA) guidelines on Antimicrobial stewardship program (AMSP) recommends the provision of institute specific etiology and antibiogram for various HAIs for formulating appropriate antibiotic policy for effective treatment within first few hours to decrease the mortality with BSI [6]. In spite of the above fact, there is scarce data available from India on the etiology of BSI and its susceptibility pattern in pediatric population.
ology and antibiogram for various HAIs for formulating appropriate antibiotic policy for effective treatment within first few hours to decrease the mortality with BSI [6]. In spite of the above fact, there is scarce data available from India on the etiology of BSI and its susceptibility pattern in pediatric population. Surveillance of HAIs Surveillance in a pediatric healthcare facility is usually dependent on the national, regional or institutional health requirements, along with the commitment and resources available. Information technology (IT) support is recognized as an essential important resource to generate reliable HAI surveillance data [6]. The patchy data on the incidence of HAIs in developing countries is mostly due to lack of national or regional AMR surveillance network, compared to the western countries [4]. In India AMR data is plagued by the absence of major National AMR surveillance network. Earlier initiatives included Indian Clinical Epidemiological Network (INCLEN) & Indian Network for Surveillance of Antimicrobial Resistance (INSAR) [7, 8]. More recently, the Indian Council of Medical Research (ICMR) has launched a national level the Anti-Microbial Resistance Surveillance and Research Network (AMRSN) across the country in 2013 for generating data on HAIs and AMR, but has not stratified the data as per the age [9]. However, resistance patterns can significantly differ in adults and children [10], therefore this data cannot be extrapolated to the pediatric age group. Therefore as of now, we have patchy institution-specific data available for assessing the etiology and AMR data. The authors here have done the review of isolates from pediatrics patients from the year 2014 through 2018. This document will review the literature from other centers from India, as well. In this review, only pediatric blood culture isolates will be discussed, since this is the sample that remains the most sacrosanct among the bacteriological samples sent for culture and sensitivity and remains most representative of the BSI.
is document will review the literature from other centers from India, as well. In this review, only pediatric blood culture isolates will be discussed, since this is the sample that remains the most sacrosanct among the bacteriological samples sent for culture and sensitivity and remains most representative of the BSI. Blood Culture Positivity The positivity rate of blood culture in pediatrics from India varies from 7.2% to 88.5% with median of 35.4% [11]. The wide variation in the positivity of blood culture can be attributed to many variables like the etiology of BSI, prior intake of antibiotics, volume and methods of blood culture practices. BSI due to endocarditis, meningitis and septic shock, are associated with high organism load as compared to other BSI, therefore such patients have high positivity as compared to BSI due to other reasons [12].
ariables like the etiology of BSI, prior intake of antibiotics, volume and methods of blood culture practices. BSI due to endocarditis, meningitis and septic shock, are associated with high organism load as compared to other BSI, therefore such patients have high positivity as compared to BSI due to other reasons [12]. The volume of blood is an important determinant in the positivity of blood cultures. Clinical & Laboratory Standard Institute (CLSI) recommends 10 ml (adults) and 3 ml (Pediatrics) blood in two sets of two bottles each with one of the bottles in the set as an anerobic one amounting to 40 ml blood in adults and 12 ml blood in pediatrics being subjected to culture. This can detect 90–95% of bacteremia [13, 14]. Studies suggest that of the multiple 20 ml blood cultures drawn in 24 h in adults, approximately 70% will have positive cultures after the first draw, 85% at second and 97% after 3rd and 99% after fourth [15, 16]. In-spite of the above CLSI guidelines, it is a common practice in India to obtain only one blood culture bottle (5 ml) for diagnosing BSI. The authors presume increased cost maybe the hindrance in the implementation of CLSI guidelines. At authors’ institute, they have the policy to collect at least 1 set of blood cultures (2 blood cultures bottles of 5 ml each) from 2 different peripheral sites and an additional 1 blood culture bottle (5 ml) if there is a central line. This practice also aids in differentiating coagulase negative Staphylococcus (CONS) as colonizers or pathogens as per CDC guidelines [17].
t least 1 set of blood cultures (2 blood cultures bottles of 5 ml each) from 2 different peripheral sites and an additional 1 blood culture bottle (5 ml) if there is a central line. This practice also aids in differentiating coagulase negative Staphylococcus (CONS) as colonizers or pathogens as per CDC guidelines [17]. Most modern laboratories nowadays utilize automated incubation and detection system that has higher efficiency and lower contamination rate. Most of such automated systems have a shorter incubation time to positivity as compared to the non-automated conventional systems. Addition of resins and charcoal help in improving the positivity of blood cultures provided by automated systems by absorbing/neutralizing the presence of antibiotics [18]. Etiology of BSI/Blood Culture Isolates Enteric fever in India affects children and adolescents of almost all age groups but the highest numbers of cases are reported in school going children between 5 and 15 y of age followed by preschool children (2–5 y) [19]. Enteric fever due to S. typhi and Paratyphi A remains the most common cause of community-acquired BSI in the pediatric age group at authors’ hospital (Fig. 1).Fig. 1 Etiology of BSI in pediatric age group in OPD samples (2014–2018)
ol going children between 5 and 15 y of age followed by preschool children (2–5 y) [19]. Enteric fever due to S. typhi and Paratyphi A remains the most common cause of community-acquired BSI in the pediatric age group at authors’ hospital (Fig. 1).Fig. 1 Etiology of BSI in pediatric age group in OPD samples (2014–2018) In a study by Iyer et al., the prevalence of enteric fever at a pediatric tertiary care hospital from South India during the ten-year study period from 2007 to 2016, was found to be 0.5% and 0.1% for S. typhi and S. paratyphi A, respectively [20]. On the other hand, in a systematic review and meta-analysis in adults and children in India, a prevalence of 9.7% of S. typhi and 0.9% of S. paratyphi A was observed [21]. At authors’ center too they have observed a similar higher prevalence of S. typhi (6.3%) compared to S. paratyphi A (1.98%) (Fig. 1).
ectively [20]. On the other hand, in a systematic review and meta-analysis in adults and children in India, a prevalence of 9.7% of S. typhi and 0.9% of S. paratyphi A was observed [21]. At authors’ center too they have observed a similar higher prevalence of S. typhi (6.3%) compared to S. paratyphi A (1.98%) (Fig. 1). MDR in Salmonella is estimated to vary between 1.9% to 4.1% [20–22]. Multiple reports from all over India have also shown improved susceptibility to ampicillin, co-trimoxazole, and chloramphenicol (ACCo) [20, 22]. Similarly, at authors’ center too they noted a low ACCo resistance of 2.3% [22]. The decline in the ACCo resistance could be attributed to limited use of these antibiotics due to the availability of better alternatives like 3rd generation cephalosporins. On the other hand, there has been an increasing trend of resistance to quinolones in Salmonella and now almost 90–100% quinolone resistance in S. typhi & Paratyphi A has been reported especially after British Society of Antimicrobial & Chemotherapy (BSAC) revised its breakpoint guidelines in the year 2011 [20]. At authors’ center, they have also observed a high resistance to quinolones (96%) and nil resistance to ceftriaxone in the pediatric population during the years 2014–2018. However, few cases of ceftriaxone resistance have been reported from Bangladesh, Nepal, United Arab Emirates and Germany [23–26]; therefore a strict vigilance on the emergence of ceftriaxone resistance in salmonella needs to be maintained. Azithromycin is recommended as an alternative therapy to ceftriaxone in the case of resistance to quinolones as per WHO guidelines and the current scarce literature on azithromycin shows little resistance to this drug [20, 27]. Therefore, nowadays, ceftriaxone and azithromycin remain the drugs of choice for the empiric treatment of enteric fever although treatment may be modified based on susceptibility report of the isolates.
s per WHO guidelines and the current scarce literature on azithromycin shows little resistance to this drug [20, 27]. Therefore, nowadays, ceftriaxone and azithromycin remain the drugs of choice for the empiric treatment of enteric fever although treatment may be modified based on susceptibility report of the isolates. The etiology of BSI in PICU has been changing over the last few years of authors’ surveillance. Instead of GNBs being commonly reported as the predominant bacterial isolates in many studies [4, 11, 28], now Candida spp. have become the predominant pathogens in the pediatric ICUs. In a 5 y study period on the etiology of BSI in PICU at Sir Ganga Ram Hospital, authors processed 4307 blood samples, out of which 408 (9.5%) isolates were obtained. CONS (25.5%), were the commonest bacteria isolated, followed by Candida spp. (13.5%), Klebseilla pneumoniae (10.8%), Staphylococcus aureus (6.4%), Acinetobacter baumannii (4.6%), Pseudomonas aeruginosa (18%) and E. coli (15%) (Fig. 2). Few other studies have also shown CONS as a common organism isolated in BSI [28, 29]. CONS are normally considered as skin contaminants but can be a cause of BSI in cases of indwelling central lines, supported by two positive cultures from two different sites accompanied by specific clinical signs and symptoms of BSI [17]. In authors’ case, they did not have adequate data to differentiate between the two. In one study CONS from a single positive culture are considered as contaminant in 75% to 95% [14]. An important finding in present study was the emergence of Candida spp. as the 2nd most common cause of BSI in PICU. Observed candidemia rates in authors’ setting were probably due to the greater use of broad-spectrum antibacterial agents, invasive devices, more extensive surgical procedures and the use of advanced life support in various critical and immunosuppressed patients as has been shown in a previous studies [30, 31]. Similar to authors’ findings, HAIs due to Candida spp. are increasingly reported worldwide and are considered as major pathogens among immunosuppressed and critically ill patients [4, 22, 29, 31].Fig. 2 Isolates of BSI in Pediatric ICU (2014–2018)
unosuppressed patients as has been shown in a previous studies [30, 31]. Similar to authors’ findings, HAIs due to Candida spp. are increasingly reported worldwide and are considered as major pathogens among immunosuppressed and critically ill patients [4, 22, 29, 31].Fig. 2 Isolates of BSI in Pediatric ICU (2014–2018) Additionally, there was an emergence of non albicans candidemia at authors’ centre. C. albicans constituted just 12.7% of the total candidemia. Most common Candida spp. isolated were Candida tropicalis (38.2%), followed by Candida pelliculosa (16.4%) and Candida albicans (12.7%) (Fig. 3). Similar to authors’ data, in an another study by Lakshmi et al., on BSI in PICU, there was a shift to non-Candida albicans species with the majority (77.8%) of them being C. tropicalis [28]. The emergence of non albicans candida at authors’ centre has been shown to correlate with increasing use of fluconazole in authors’ previous study [31].Fig. 3 Various species of Candida isolated in BSI from PICU (2014–2018)
hift to non-Candida albicans species with the majority (77.8%) of them being C. tropicalis [28]. The emergence of non albicans candida at authors’ centre has been shown to correlate with increasing use of fluconazole in authors’ previous study [31].Fig. 3 Various species of Candida isolated in BSI from PICU (2014–2018) K. pneumoniae was the commonest GNB isolated; the possible source could be respiratory tract infections as it was the most common isolate in pediatric pneumonia in PICU. The finding of S. aureus as the commonest pathogen in gram-positive cocci (GPCs) makes empirical treatment of BSI in pediatric ICU difficult as it would involve treatment against candida, GNBs and GPCs as per the etiology of authors’ PICU. One important observation in authors’ study was the presence of central lines as a major risk factor for candidemia in the PICU, and in the absence of central lines, GNB was the commonest bacterial isolate. Other studies from Indian PICU have shown higher rates of BSI due to GNBs as compared to GPCs and Candida spp. [11, 29, 32]. In a retrospective study of nosocomial infections in PICU between 1994 and 2003, Singhi et al. observed GNB as the predominant isolates, common being Klebsiella pneumoniae (20.1%) Enterobacter spp. (16.6%) and Acinetobacter spp. (8.6%) [32]. In a study by Thacker et al., it was shown that overall enterobacteriaceae isolates constituted more than half of the GNBs in pediatric BSI and twice that of Pseudomonas spp. [33].
d GNB as the predominant isolates, common being Klebsiella pneumoniae (20.1%) Enterobacter spp. (16.6%) and Acinetobacter spp. (8.6%) [32]. In a study by Thacker et al., it was shown that overall enterobacteriaceae isolates constituted more than half of the GNBs in pediatric BSI and twice that of Pseudomonas spp. [33]. In another Indian study on 285 children admitted in PICU, the incidence of BSI was observed as 31.2 episodes/ 1000 patient days with the mean age of BSI as 3.7 ± 3.5 y. GNBs were the major isolates (53.5%) with Klebsiella pneumoniae being the most prevalent (24.4%), followed by S. aureus (20.9%). CONS (8.1%) and Candida spp. (10.5%) were the other predominant isolates in this study [28]. Dharmapalan et al., reviewed the published data of Indian Neonatal and pediatric population during 2000–2015 from India. After an extensive electronic search, 89 papers were reviewed; this 15-year data reported bacteremia caused by GNB to be around 53.3% whereas gram-positive organisms caused infection in 30.9% of the pediatric population [11]. The data from developing countries is in contrast to the western countries, where GPCs are the predominant isolates from nosocomial infections in PICU. In a National Healthcare Safety Network (NHSN) by Centers for Disease Control and Prevention from 2011 to 2014 in 1003 hospitals, 20,390 pediatric HAIs were reported. Staphylococcus aureus (17%), followed by CONS (17%), Escherichia coli (11%), Klebsiella pneumoniae (9%), and Enterococcus faecalis (8%) were the commonest organisms isolated [34].
afety Network (NHSN) by Centers for Disease Control and Prevention from 2011 to 2014 in 1003 hospitals, 20,390 pediatric HAIs were reported. Staphylococcus aureus (17%), followed by CONS (17%), Escherichia coli (11%), Klebsiella pneumoniae (9%), and Enterococcus faecalis (8%) were the commonest organisms isolated [34]. Emerging Antimicrobial Resistance The authors studied the antibiogram of BSI of the important bacteria during the last five years at PICU of their tertiary care centre. Methicillin-resistant Staphylococcus aureus (MRSA) prevalence of 46% and clindamycin resistance of 23% was observed in 26 isolates of S. aureus. Similar to authors’ data, in one of the largest data from Indian Network for Surveillance of Antimicrobial Resistance (INSAR) group on the prevalence of MRSA across 15 centres from India in a mixed population of pediatrics and adults, an overall MRSA prevalence of 41% was found from a total of 26,310 S. aureus isolates [8]. Although the majority of the S. aureus isolates were from skin and soft tissue infections followed by BSI. There was significantly higher rates of resistance in MRSA (erythromycin: 70.8%, clindamycin: 46.6%, gentamicin: 58.3%) as compared to methicillin-susceptible Staphylococcus aureus (MSSA) (erythromycin: 26.3%, clindamycin: 14.7%, gentamicin: 17.4%). There was no documented resistance to vancomycin or teicoplanin and linezolid. High rates of MRSA (50%) among the pediatric population has also been reported from another study as well [11]. Due to the high prevalence of MRSA in PICU, it appears that vancomycin should be used for suspected GPC infection pending susceptibility reports.
umented resistance to vancomycin or teicoplanin and linezolid. High rates of MRSA (50%) among the pediatric population has also been reported from another study as well [11]. Due to the high prevalence of MRSA in PICU, it appears that vancomycin should be used for suspected GPC infection pending susceptibility reports. In GNBs, authors’ observed a very low susceptibility of 3rd generation cephalosporins in GNBs ranging from 7% to 33% (Table 1). Such a high level of resistance to cephalosporins renders them ineffective for the empirical treatment of BSIs. Similarly, they observed a low susceptibility to beta lactam-beta lactamase inhibitors (BL-BLI) like piperacillin/tazobactum and cefoperazone/sulbactum (16% to 67%) and quinolones (13% to 64%). What is most worrisome is that even the carbapenems, considered as the last resort drugs, show low susceptibility in A. baumannii (21%), K. pneumoniae (42%), while E. coli (71%), and P. aeruginosa (67%) had relatively higher susceptibility. Fortunately, the authors have not seen much resistance to colistin in GNBs except in K. pneumoniae (2%) and Enterobacter spp. (4%).Table 1 Percentage susceptibility of GNBs isolated from PICU from blood
mannii (21%), K. pneumoniae (42%), while E. coli (71%), and P. aeruginosa (67%) had relatively higher susceptibility. Fortunately, the authors have not seen much resistance to colistin in GNBs except in K. pneumoniae (2%) and Enterobacter spp. (4%).Table 1 Percentage susceptibility of GNBs isolated from PICU from blood GNBs No. of isolates Ampicillin Cefuroxime Ceftriaxone Ceftazidime Cefepime Piperacillin+Tazobactum Cefoperazone+Sulbactum Quinolones Gentamicin Amikacin Netilmicin Ertapenem Imipenem/Meropenem Colistin E. coli 15 0 0 0 – 6 44 44 40 60 88 60 60 71 100 Klebseilla pneumoniae 44 3 5 7 – 16 27 33 24 31 47 33 36 42 98 Pseudomonas aeruginosa 18 – – – 67 67 67 67 64 67 67 69 – 73 100 Acinetobacter baumannii 19 – 0 5 – 16 16 17 13 16 21 17 – 21 100 Enterobacter spp. 15 0 13 33 – 40 53 53 47 53 73 70 53 67 96 GNB Gram-Negative Bacteria
5 0 0 0 – 6 44 44 40 60 88 60 60 71 100 Klebseilla pneumoniae 44 3 5 7 – 16 27 33 24 31 47 33 36 42 98 Pseudomonas aeruginosa 18 – – – 67 67 67 67 64 67 67 69 – 73 100 Acinetobacter baumannii 19 – 0 5 – 16 16 17 13 16 21 17 – 21 100 Enterobacter spp. 15 0 13 33 – 40 53 53 47 53 73 70 53 67 96 GNB Gram-Negative Bacteria Similar to authors’ data, other centers are also reporting high resistance in GNBs from PICU. Dharmapalan et al., observed more than 90% resistance for ampicillin in GNBs, whereas resistance to amikacin ranged from 22.4% to 50%. Similarly, high resistance to cephalosporins of 62.6% in K. pneumoniae and 47.5% in E.coli was observed. High rates of resistance in the GNBs were also noted for piperacillin-tazobactum varying between 16.7% to 42% [11]. Other studies have also reported high resistance to commonly used first-line antibiotics, ampicillin (94.9%–90.6%%), cefotaxime (92.4%–71.4%), piperacillin-tazobactum (31.2%–27.5%) and levofloxacin (42.4%–39.8%) [35]. Since cephalosporins are the first-line antibiotics recommended in India in pediatrics practice for enteric fever, meningitis, and pneumonia [11], its high rate of resistance is worrisome on the efficacy of these antibiotics. Resistance to carbapenems too is now commonly reported from different centers in India. In an analysis of 82 published literature from different Indian NICU and PICU, a median carbapenem resistance of 1% in K. pneumoniae, 9% in E. coli, 16.7% in P. aeruginosa and 11.5% in A. baumannii was seen [11]. A similar resistance of 11.1% to imipenem was seen in enterobacteriaceae from tertiary care centers from South-India from years 2012 to 2014 [28]. Higher resistance to carbapenems in PICU at authors’ centre could be due to the fact that it is a tertiary care center where many critical cases are referred with high case mix index (CMI) [36], who are either already colonized with multidrug resistant organisms (MDROs) or require higher prescription of antibiotics which may contribute to the emergence of MDROs [37].
rs’ centre could be due to the fact that it is a tertiary care center where many critical cases are referred with high case mix index (CMI) [36], who are either already colonized with multidrug resistant organisms (MDROs) or require higher prescription of antibiotics which may contribute to the emergence of MDROs [37]. There is little data from India on the type of carbapenemase prevalence in carbapenem resistant enterobacteriaceae (CRE). The authors could only find one study from South India, Vellore on the type of carbapenemases in BSI from PICU. In this study bla NDM (72.7%) was shown to be the predominant plasmid in CRE, followed by bla OXA (9.1%), and a combination of bla NDM/bla OXA (9.1%) [37]. Therefore, bla KPC has got replaced by the above two plasmids. The treatment of BSI with CRE is challenging as it is accompanied by up to 90% resistance to other drugs like amikacin [37]. Often, colistin is used as the last resort drug to treat CRE infections. But this is further complicated by the lack of robust data on pharmacokinetics/pharmacodynamics of this drug. Further, questions on the efficacy of colistin monotherapy or combination therapy are still not resolved. Therefore clinicians are forced to often use unproven therapies, including colistin, in cases of CRE which is associated with high mortality of up to 52% [37]. Expectedly, the rampant use of colistin has led to the emergence of its resistance in GNBs. A median resistance to colistin resistance from different pediatric centers across India has been shown to be as: E.coli (8.8%), K. pneumoniae (3.8%), A. baumaanii (0%), and P. aeruginosa (0%) [11]. Similarly, in adult ICUs at authors’ hospital, they observed colistin resistance only in K. pneumoniae BSI, albeit at a much higher rate of 17% [22]; therefore it remains a grave concern for its potential spread to PICU too. The recent increase in the resistance to colistin in GNBs across the world has been associated with the emergence of plasmid-mediated gene mcr-1 in the year 2016 [38]. Colistin resistance was previously associated with only chromosomal mutations but now it is feared that mcr-1 may emulate NDM-1 in its rapid global widespread. Colistin resistance in GNBs has resulted in the emergence of pan drug-resistant (PDR) bugs with no antibiotics left for the treatment. Although not so common in PICUs, PDR bugs are now a common scenario in adult ICUs [22].
somal mutations but now it is feared that mcr-1 may emulate NDM-1 in its rapid global widespread. Colistin resistance in GNBs has resulted in the emergence of pan drug-resistant (PDR) bugs with no antibiotics left for the treatment. Although not so common in PICUs, PDR bugs are now a common scenario in adult ICUs [22]. Therefore it would be prudent to implement AMSP on an urgent basis in the PICUs to salvage whatever little is left of the remaining antibiotics. Emergence of non-albicans Candida spp. at authors’ center has resulted in increased resistance to the first-line anti-fungal drug, fluconazole. Low fluconazole susceptibility of 90.5% and 47.6% was noted for C. tropicalis and C. pelliculosa, respectively from authors’ centre [39]. Even C. albicans which was showing 100% susceptibility to fluconazole in the year 2012 is now showing reduced susceptibility of 88.9% [39]. This reduced susceptibility was partly due to revision in the break points of fluconazole for C. albicans in 2012 [40]. C. auris is an emerging multi-drug resistant candida spp. in ICU settings and has shown 0%, 7.6% and 7.6%, 79.5% susceptibility to fluconazole, amphotericin, voriconazole and caspofungin, respectively, which make these difficult to treat PDR bugs [39].
on in the break points of fluconazole for C. albicans in 2012 [40]. C. auris is an emerging multi-drug resistant candida spp. in ICU settings and has shown 0%, 7.6% and 7.6%, 79.5% susceptibility to fluconazole, amphotericin, voriconazole and caspofungin, respectively, which make these difficult to treat PDR bugs [39]. To conclude, this review of BSI in the Indian pediatric population highlights that Salmonella continues to be the major etiology of community-acquired BSI. In such cases, empirical treatment with ceftriaxone remains the most pragmatic approach. Azithromycin can be considered as an alternative to ceftriaxone while ACCo sensitivity has returned. On the other hand, BSI related to Indian PICU is a complex scenario. The etiology can be ranging from candida to GNBs and GPCs. In the presence of central lines, it would be prudent to give antifungals empirically for the treatment of BSI, otherwise, treatment with carbapenem or combination of carbapenem and colistin is advisable due to high resistance to the first-line therapy. In the absence of a national network of AMR surveillance for pediatrics infections, institute specific hospital-based surveillance of AMR is essential for formulating antibiotic policy for the judicious use of the antibiotics. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of interest None.
Introduction Neonatal sepsis is a clinical syndrome characterized by systemic signs and symptoms of infection and is accompanied by bacteremia in the first month of life [1]. Early-onset sepsis (EOS) is defined as sepsis occurring in the first 72 h of life and that occurring beyond 72 h is defined as late-onset sepsis (LOS) [2]. As per World Health Organization (WHO), neonatal sepsis is the third most frequent etiology of neonatal mortality [3]. In the year 2013, a systematic analysis of global, national and regional causes of child mortality found neonatal sepsis to be the leading cause of neonatal deaths in India [4, 5]. The National Neonatal Perinatal Database network (NNPD, 2002–03) comprising of 18 tertiary care neonatal units across India reported sepsis (septicemia/meningitis) as the commonest cause of neonatal mortality, causing 23.4% of all neonatal deaths [6]. The pattern of the bacterial pathogens responsible for neonatal sepsis has changed temporally and geographically. There is a difference in the causative organisms for neonatal sepsis between the developed and developing countries [2, 7]. As per NNPD, Klebsiella pneumoniae and Staphylococcus aureus are the commonest causative organisms for EOS and LOS in India [6]. On the contrary, data from developed countries shows that gram-positive organisms are the predominant causes of EOS as well as LOS [2, 8].
tween the developed and developing countries [2, 7]. As per NNPD, Klebsiella pneumoniae and Staphylococcus aureus are the commonest causative organisms for EOS and LOS in India [6]. On the contrary, data from developed countries shows that gram-positive organisms are the predominant causes of EOS as well as LOS [2, 8]. The ability of bacteria to resist or to become tolerant to several structurally and functionally distinct drugs simultaneously is known as multidrug resistance [9]. Simpler definitions quote “multidrug-resistant organisms (MDROs) are labelled as such because of their in-vitro resistance to more than one antimicrobial agent”. On the other hand, definitions vary as per specific organism [10]. It is estimated that in India, 56,524 neonatal deaths each year are attributed to isolates resistant to first-line antibiotics [11].
stant organisms (MDROs) are labelled as such because of their in-vitro resistance to more than one antimicrobial agent”. On the other hand, definitions vary as per specific organism [10]. It is estimated that in India, 56,524 neonatal deaths each year are attributed to isolates resistant to first-line antibiotics [11]. Multidrug Resistance: Global Picture A recent point prevalence study – Antibiotic Resistance and Prescribing in European Children (ARPEC) was conducted in 226 hospitals (41 countries) which also included NICU data from our institute (Sir Ganga Ram Hospital, New Delhi). This survey showed that most commonly used regimen for neonatal sepsis was combination of ampicillin/amoxicillin/benzyl penicillin and aminoglycoside. It further reported that 40% pathogens isolated were resistant to first-line antibiotics prescribed by WHO [12]. Though this survey had paucity of data from low- and middle-income countries (LMICs), it provided important insights on emergence of antibiotic resistance. The resistance to first-line antibiotics in different WHO regions and is given in Table 1 [13].Table 1 Resistance to first-line antibiotics in different WHO regions Region as defined by WHO [14] Resistance to Ampicillin (%) Resistance to Gentamicin (%) SEARO 97 83 AFRO 93 43 EURO 64 13 SEARO WHO South East Asian region; AFRO WHO Africa region; EURO WHO Europe region
Multidrug Resistance: Global Picture A recent point prevalence study – Antibiotic Resistance and Prescribing in European Children (ARPEC) was conducted in 226 hospitals (41 countries) which also included NICU data from our institute (Sir Ganga Ram Hospital, New Delhi). This survey showed that most commonly used regimen for neonatal sepsis was combination of ampicillin/amoxicillin/benzyl penicillin and aminoglycoside. It further reported that 40% pathogens isolated were resistant to first-line antibiotics prescribed by WHO [12]. Though this survey had paucity of data from low- and middle-income countries (LMICs), it provided important insights on emergence of antibiotic resistance. The resistance to first-line antibiotics in different WHO regions and is given in Table 1 [13].Table 1 Resistance to first-line antibiotics in different WHO regions Region as defined by WHO [14] Resistance to Ampicillin (%) Resistance to Gentamicin (%) SEARO 97 83 AFRO 93 43 EURO 64 13 SEARO WHO South East Asian region; AFRO WHO Africa region; EURO WHO Europe region Estimates of MDRO burden have also been reported from other countries. In a systematic review from five countries of South Asia (India, Pakistan, Sri Lanka, Bangladesh and Nepal) comprising of 109 studies, a high proportion of MDRO was reported. The pooled estimated data from hospital and community showed that Klebsiella pneumoniae, E. coli and Acinetobacter baumannii were multidrug resistant in 70.7%, 54%, 78.7% of isolates respectively [15]. A retrospective single centre study from Jordan evaluated 4 y data of 68 episodes of culture positive neonatal sepsis. Gram negative organisms were the commonest and 69% of these were multidrug resistant [16]. In another cohort study from Taiwan, conducted over 8 y, 1106 episodes of culture positive sepsis were reported. Of these, one-third were caused by gram negative bacilli and 70 (18.6%) were multidrug resistant [17]. A meta-analysis of 71 studies reported from China showed that 50% of gram negative organisms were resistant to third-generation cephalosporins [18].
ed over 8 y, 1106 episodes of culture positive sepsis were reported. Of these, one-third were caused by gram negative bacilli and 70 (18.6%) were multidrug resistant [17]. A meta-analysis of 71 studies reported from China showed that 50% of gram negative organisms were resistant to third-generation cephalosporins [18]. Multidrug Resistance: Scenario in India A study of microbiological profile of E. coli from three NICUs in India which included 67 neonates with E. coli sepsis reported that majority of the isolates were resistant to cefotaxime (87%), ciprofloxacin (70%) and trimethoprim/sulfamethoxazole (76%). Phenotypic tests demonstrated that 87% of isolates were extended β lactamases (ESBL) producers and 6% were metallo β lactamases (MBL) producers. Nine isolates which were meropenem resistant possessed New Delhi metallo β lactamases-1 (NDM-1) [19]. In another study from Kolkata, carbapenem resistance in neonatal sepsis was evaluated over 5 y. Fourteen percent of isolates were carbapenemese resistant and in all of them, NDM-1 was identified [20]. Similarly, Chatterjee et al. observed that 56% of Acinetobacter baumannii isolated in blood culture were carbapenem resistant and 22% had NDM-1 [21].
carbapenem resistance in neonatal sepsis was evaluated over 5 y. Fourteen percent of isolates were carbapenemese resistant and in all of them, NDM-1 was identified [20]. Similarly, Chatterjee et al. observed that 56% of Acinetobacter baumannii isolated in blood culture were carbapenem resistant and 22% had NDM-1 [21]. A recent study, Delhi Neonatal Infection Study (DeNIS) reported clinical and microbiological data from three large tertiary care NICUs on 1005 culture positive cases [22]. Two-third of isolates were gram-negative. Commonest organisms isolated were Acinetobacter baumannii (22%) followed by Klebsiella pneumoniae (17%) and Escherichia coli (14%). There were high rates of multidrug resistance (resistance to any three of five antibiotic classes) in Acinetobacter baumannii (82%), Klebsiella pneumoniae (54%), and Escherichia coli (38%) isolates. In another cohort study from Delhi, multi-drug resistance rates in Klebsiella pneumoniae, A. baumannii, E. coli, E. cloacae were reported to be 65.4%, 71.4%, 78.7% and 66.0 respectively [23]. In a recent randomized controlled trial conducted at Sir Ganga Ram Hospital, New Delhi, out of 50 infants with gram negative sepsis, 54% isolates were MDROs. Fifty eight percent of Klebsiella pneumoniae, 62.5% of Burkholderia cepacia and 66.6% of Acinetobacter baumanii were multidrug resistant.
A recent study, Delhi Neonatal Infection Study (DeNIS) reported clinical and microbiological data from three large tertiary care NICUs on 1005 culture positive cases [22]. Two-third of isolates were gram-negative. Commonest organisms isolated were Acinetobacter baumannii (22%) followed by Klebsiella pneumoniae (17%) and Escherichia coli (14%). There were high rates of multidrug resistance (resistance to any three of five antibiotic classes) in Acinetobacter baumannii (82%), Klebsiella pneumoniae (54%), and Escherichia coli (38%) isolates. In another cohort study from Delhi, multi-drug resistance rates in Klebsiella pneumoniae, A. baumannii, E. coli, E. cloacae were reported to be 65.4%, 71.4%, 78.7% and 66.0 respectively [23]. In a recent randomized controlled trial conducted at Sir Ganga Ram Hospital, New Delhi, out of 50 infants with gram negative sepsis, 54% isolates were MDROs. Fifty eight percent of Klebsiella pneumoniae, 62.5% of Burkholderia cepacia and 66.6% of Acinetobacter baumanii were multidrug resistant. Risk Factors for Development of Antimicrobial Resistance Global consumption of antibiotics has risen by 36% from 2000 to 2010. BRICS countries (Brazil, Russia, India, China, and South Africa) contributed to 75% of this increase inspite of overall representation of only 40% of the world’s population [24]. In India, poor enforcement of regulations of over-the-counter sales of antibiotics, its low cost and an increase in consumption due to economic growth and prosperity are important factors implicated in rise of antibiotic resistance [24].
ease inspite of overall representation of only 40% of the world’s population [24]. In India, poor enforcement of regulations of over-the-counter sales of antibiotics, its low cost and an increase in consumption due to economic growth and prosperity are important factors implicated in rise of antibiotic resistance [24]. The major factors responsible for emergence and propagation of antimicrobial resistance (AMR) are overuse and empiric use of antibiotics, poor infection control in clinics and hospitals [25], lack of knowledge regarding organisms and its inherent antibiogram and rampant use of unreasonable fixed drug combinations [25–28]. Understaffing of NICUs are a major concern in resource limited developing countries [29]. Recent extensive use of antibiotics in agriculture has compounded the already existing problem of AMR. Antimicrobial growth promotors play a crucial role in this industry since they improve feed conversion, animal growth and reduce morbidity and mortality due to clinical and subclinical diseases [30]. Outcomes in MDRO Sepsis Mortality Various studies conducted globally have reported higher case fatality rates (CFR) due to MDRO sepsis. A study from Jordan reported that sepsis due to MDROs was associated with significantly higher mortality rate as compared to non-MDRO sepsis (60% vs. 13%) [16]. Similarly, another study from Taiwan reported mortality rate of 26.3% due to MDR Acinetobacter baumanni [17].
her case fatality rates (CFR) due to MDRO sepsis. A study from Jordan reported that sepsis due to MDROs was associated with significantly higher mortality rate as compared to non-MDRO sepsis (60% vs. 13%) [16]. Similarly, another study from Taiwan reported mortality rate of 26.3% due to MDR Acinetobacter baumanni [17]. From India, the DeNIS study reported that the population attributable risk of mortality was 15.7% in culture-positive sepsis by MDRO vs. 12.0% in culture-positive sepsis by non-MDRO [22]. Another study from Delhi reported CFR of culture-positive and culture negative sepsis to be 23.0% and 6.8% respectively. The CFR among MDRO was higher than sensitive isolates. Among the neonates with MDR sepsis, only half survived [23]. In a recent data (2018–2019) from Sir Ganga Ram Hospital, New Delhi 64 culture positive extramural neonates cases had high mortality in MDRO as compared with non-MDRO [34.4% vs. 8%, p = 0.028, OR = 6.02 (C.I; 1.1–30.3)]. Morbidities In a study done in Taiwan, 376 episodes of gram negative bacteremia (GNB) were analysed. Underlying neurologic sequelae (22.9% vs. 13.4%), renal disease (12.9% vs. 1.3%), previous episode of bacteremia (35.7% vs. 23.5%), use of total parenteral nutrition (80% vs. 67.6%), use of central venous catheter (87.1% vs. 73.2%) were significantly high in MDR GNB as compared to non-MDR GNB cohort [31].
ere analysed. Underlying neurologic sequelae (22.9% vs. 13.4%), renal disease (12.9% vs. 1.3%), previous episode of bacteremia (35.7% vs. 23.5%), use of total parenteral nutrition (80% vs. 67.6%), use of central venous catheter (87.1% vs. 73.2%) were significantly high in MDR GNB as compared to non-MDR GNB cohort [31]. Financial Implications Though limited data exists on cost analysis, however, data from our institute (2010) from 59 episodes of culture proven sepsis (20 multidrug resistant isolates) showed prolonged duration of hospital stay in MDRO sepsis (27.6 d) vs. non-MDRO sepsis (20.7 d). The mean cost of therapy for MDRO sepsis was INR 4,99,840 vs. INR 180,592 for non-MDRO sepsis. On subgroup analysis of infants <1000 g birth weight, the mean cost of therapy in MDRO sepsis vs. non-MDRO sepsis showed further difference (INR 7,34,798 vs. 2,50,558) [32]. A study from USA reported escalation of cost of therapy due to ESBL Klebsiella outbreak in NICU to be 3,41,751 dollars, with major fraction of increase in cost due to health care provider time engaged in patient care [33]. Gandra et al. estimated the economic burden due to antibiotic resistance. Despite methodological limitation and difference in ways of estimation of disease burden, excess cost attributable due to infection caused by resistant organism vs. sensitive organism was much higher (Table 2) [34].Table 2 Surplus expenditure in MDRO
ra et al. estimated the economic burden due to antibiotic resistance. Despite methodological limitation and difference in ways of estimation of disease burden, excess cost attributable due to infection caused by resistant organism vs. sensitive organism was much higher (Table 2) [34].Table 2 Surplus expenditure in MDRO Resistant Organism Control Range of Excess Cost MRSA MSSA $695–$29,030 Vancomycin resistant Enterococcus Vancomycin susceptible Enterococcus $16,711–$60,988 Resistant Pseudomonas aeruginosa Susceptible P. aeruginosa $627–$45,256 Resistant Acinetobacter baumannii Susceptible A.baumannii $5336–$126,856 Multiple organisms Susceptible $9372–$18,990 ESBL producing Enterobacteriaceae Non-ESBL producing Enterobacteriaceae $3658–$4892 ESBL Extended β lactamases; MRSA Methicillin resistant Staphylococcus aureus; MSSA Methicillin sensitive Staphylococcus aureus Tackling Antimicrobial Resistance Adherence to optimum hand hygiene practice is a cardinal step to prevent infection with MDRO. Antimicrobial stewardship programs help to optimize clinical outcomes, reducing untoward consequences of antibiotic use like toxicity and the emergence of resistance [35]. In a recent study in a single NICU, Jinka et al. found that implementation of antimicrobial policy based on microbiology information for neonatal sepsis resulted in increased use of first-line agents and reduced use of third-generation cephalosporins without effecting patient outcomes [36].
mergence of resistance [35]. In a recent study in a single NICU, Jinka et al. found that implementation of antimicrobial policy based on microbiology information for neonatal sepsis resulted in increased use of first-line agents and reduced use of third-generation cephalosporins without effecting patient outcomes [36]. Regulation for over-the-counter drugs sale laid down by Central Drugs Standard Control Organization (CDSCO) has been a step to tackle AMR in India [37]. The Indian National Action Plan on AMR (2017–21) aims to gradually eliminate animal use of critically important antibiotics used on humans [38]. Other measures include optimizing antenatal care, intrapartum care, postnatal care and reducing use in suspected viral infections [15]. Conclusions Resistance is surging rapidly in LMIC countries. Infection with MDRO leads to higher mortality and morbidity in neonates. The economic burden is exponentially increased in MDRO sepsis. Risk factors for spread of MDRO include indiscriminate use of antibiotics, lack of hand hygiene, poor antibiotic stewardship and other socioeconomic factors including poor sanitation, lack of nurse patient ratio and overcrowding. Tackling spread of MDRO is an emergency and recommendations of WHO/CDC should be implemented with utmost sincerity in units. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of Interest None.
Sir, The recommended treatment of lymphedema is the association of therapies such as manual and mechanical lymph drainage, compression therapy (hosiery and bandaging), exercising, myolymphokinetic activities and hygienic precautions [1–3]. In primary congenital lymphedema, the forms of treatment are the same but the treatment must be adapted for children with respect to their social reality. The objective of the current study is to report on the treatment of congenital lymphedema utilizing stockings and shoes made of a cotton–polyester material.
s [1–3]. In primary congenital lymphedema, the forms of treatment are the same but the treatment must be adapted for children with respect to their social reality. The objective of the current study is to report on the treatment of congenital lymphedema utilizing stockings and shoes made of a cotton–polyester material. Five children with primary congenital lymphedema of the lower extremities who used compression stockings made of a cotton–polyester material were evaluated in the period from 2002 to 2009 in the Godoy Clinic. This cotton–polyester material, called gorgurão in Brazil, has low elasticity (<50) across the material and is elastic along the material and thus allows low-stretch compression. The home-made stockings used in this study constantly require readjustment because of reductions in the size of the limb. Shoes are made of the same material with a rubber sole and can be made attractive to children using different colors. The diagnosis of lymphedema was clinical and by two perimetric measurements (3 and 6 cm) of the dorsum of the feet. The size of the contralateral limb was used as a comparison. The Tukey-Kramer Multiple Comparisons Test was employed for statistical analysis with an alpha error of 5% (p-value <0.05) considered acceptable. The consent form was signed by familiar responsible. The study was approved by the ethics committee in Medicine School of São Jose do Rio Preto-FAMERP-Brazil (n03375-2009)
n. The Tukey-Kramer Multiple Comparisons Test was employed for statistical analysis with an alpha error of 5% (p-value <0.05) considered acceptable. The consent form was signed by familiar responsible. The study was approved by the ethics committee in Medicine School of São Jose do Rio Preto-FAMERP-Brazil (n03375-2009) The reduction between the initial and final measurements seen with treatment was significant (two-tailed t-test: p-value <0.0001).After treatment the sizes of the two feet were within the normal range (two-tailed t-test: p-value <0.3). The longer adequate compression is used during the day the better the result. Use without adjustments is of little value as improvement will be limited or inexistent. Support of the family and of the people who live daily with young patients is important. It is possible to normalize the edema just with the use of compression stockings, but as edema is an incurable disease treatment is life long. The association of other forms of treatment, such as manual and mechanical lymph drainage and cervical stimulation, provides a synergic effect. Thus an association of techniques is recommended to control the edema faster. The independence that the family achieves with this alternative changes the history of the therapy of lymphedema as the family is able to treat their own child.
Introduction Fanconi-Bickel Syndrome (FBS), a rare genetic disorder of carbohydrate metabolism, was first described by Fanconi and Bickel in 1949 [1]. The authors report a case of FBS presenting at 4 y of age whose correct diagnosis led to avoidance of the liver transplant.
Introduction Fanconi-Bickel Syndrome (FBS), a rare genetic disorder of carbohydrate metabolism, was first described by Fanconi and Bickel in 1949 [1]. The authors report a case of FBS presenting at 4 y of age whose correct diagnosis led to avoidance of the liver transplant. Case Report A 4-year-old boy, born to third degree consanguineous couple (first cousins), from Maharashtra presented with failure to thrive, delayed mile stones and progressive abdominal distention since infancy. There was no history of seizures or jaundice. The child had cherubic facies, height of 81 cm (<3rd percentile) and weight 10.8 kg (<3rd percentile). Features of active rickets (wrist widening, frontal bossing and hypotonia) were present (Fig. 1). His developmental age corresponded to 2 y. Soft hepatomegaly was observed with liver span of 15 cm; no splenomegaly or evidence of ascites was noted. Systemic examination was otherwise unremarkable. Investigations revealed normal blood counts, including absolute neutrophils, metabolic acidosis (pH 7.23, bicarbonate 16.9 mmol/L), hyperchloremia (113.9 mmol/L) and normal anion gap. GSD Ia was ruled out after gene sequencing. Evidence of proximal renal tubular acidosis (RTA) was noted (generalized aminoaciduria on thin layer chromatography, glucosuria +++ and proteinuria ++). Total cholesterol was 249 mg/dl (normal: <195) and triglycerides were 681 mg/dl (<145). Post-prandial and post glucose hyperglycemia was documented on two occasions (246 mg/dl and 252 mg/dl) after episode of hypoglycemia (40 mg/dl). Fasting plasma lactate was 10.2 mg/dl (4.5–20 mg/dl). Liver function tests (serum proteins, bilirubin, ALT, AST) including prothrombin time were normal. Blood urea nitrogen, creatinine and uric acid were normal (10, 0.6 and 2.9 mg/dl, respectively). Serum calcium was 8.5 mg/dl, phosphorus was 2.0 mg/dl (2.5–4.6) and alkaline phosphatase level was high 1044 (117–390). Wrist radiograph showed features of rickets. His abdominal ultrasonography revealed hepatomegaly with coarse echotexture. Liver biopsy showed accumulation of glycogen in hepatocytes with no disturbance in liver architecture. In view of features of RTA, rickets, hepatomegaly, fasting hypoglycemia and postprandial hyperglycemia, glycogen accumulation in liver, a diagnosis of FBS was suspected.
revealed hepatomegaly with coarse echotexture. Liver biopsy showed accumulation of glycogen in hepatocytes with no disturbance in liver architecture. In view of features of RTA, rickets, hepatomegaly, fasting hypoglycemia and postprandial hyperglycemia, glycogen accumulation in liver, a diagnosis of FBS was suspected. Sanger sequence analysis was performed for SLC2A2 gene, which revealed a previously reported homozygous mutation, c.1330T > C in exon 10, resulting in change of amino acid from Tryptophan to Arginine at 444 amino acid position (p.Trp444Arg), thus confirming the diagnosis of FBS (Fig. 2). After establishment of diagnosis, the family was counseled regarding the conservative management and liver transplant was avoided. Dietary management was started with uncooked corn starch and elimination of lactose in diet. Supplementation with Vitamin D, phosphorus, and bicarbonate were added. On follow up after 3 mo the child showed improvement in rickets and gain of weight and height (weight 12.2 kg and height 83 cm), however with persistence of aminoaciduria.Fig. 1 Patient with cherubic facies, protuberant abdomen and wrist widening Fig. 2 Sequence chromatogram showing single homozygous base pair change, c.1330T>C (p.W444R) in SLC2A2 gene Discussion FBS is a rare disease of carbohydrate metabolism (previously termed as glycogen storage disease type XI) occurring due to pathogenic mutations in GLUT 2 transporter gene, SLC2A2. Genetic defect in GLUT2 was proposed as the possible metabolic basis for FBS by Santer et al. in 1997 [2].
Fig. 2 Sequence chromatogram showing single homozygous base pair change, c.1330T>C (p.W444R) in SLC2A2 gene Discussion FBS is a rare disease of carbohydrate metabolism (previously termed as glycogen storage disease type XI) occurring due to pathogenic mutations in GLUT 2 transporter gene, SLC2A2. Genetic defect in GLUT2 was proposed as the possible metabolic basis for FBS by Santer et al. in 1997 [2]. GLUT2 is amongst family of monosaccharide transporters that transport sugars in an energy-independent manner. GLUT2 transports glucose and galactose into hepatocytes after feeding and exports free glucose out of hepatocytes during fasting [2]. The hyperglycemia and hypergalactosemia seen in postprandial state are due to reduced uptake of these monosaccharides by the liver and may be enhanced by the poor insulin response to elevated blood glucose levels demonstrated in patients with FBS. Fasting hypoglycemia results from defective export of free glucose from hepatocytes when peripheral glucose supplies have been exhausted [2]. Glycosuria is the result of failure to export glucose across the basolateral membranes of renal tubular cells. Patients of FBS typically present with combination of clinical symptoms: hepatomegaly secondary to glycogen accumulation, glucose and galactose intolerance, fasting hypoglycemia, a characteristic tubular nephropathy, and severely stunted growth [3]. Patients presenting late develop cherubic face, truncal obesity, retarded growth and puberty, bone problems associated with hypophosphatemic rickets, and dental caries.
glycogen accumulation, glucose and galactose intolerance, fasting hypoglycemia, a characteristic tubular nephropathy, and severely stunted growth [3]. Patients presenting late develop cherubic face, truncal obesity, retarded growth and puberty, bone problems associated with hypophosphatemic rickets, and dental caries. There is no specific treatment of FBS, the management for renal Fanconi syndrome includes management of RTA with maintenance of water and electrolyte balance; supplementation of vitamin D, calcium, phosphorus, and bicarbonate. Small frequent meals with uncooked cornstarch, is advocated [4]. The prognosis for this condition appears to be generally good in terms of survival, but these patients are universally short in stature. Liver transplant is not required for management of patients suffering from FBS. FBS has only been reported in a few cases from India, all from consanguineous families presenting similarly with hepatomegaly and renal dysfunction [5–8]. All mutations have been shown to be different, thus showing lack of any common mutation in India [6–8]. Genetic counseling is an integral part of management in view of autosomal recessive nature of the condition and 25 % risk of recurrence in siblings. With the knowledge of mutations prenatal diagnosis can be offered to couples in subsequent pregnancies, using mutation analysis on chorionic villous sampling at 11 wk of pregnancy. SE is a Wellcome Trust Senior Investigator; the authors acknowledge the contribution of Wellcome Trust for making this study possible.
FBS has only been reported in a few cases from India, all from consanguineous families presenting similarly with hepatomegaly and renal dysfunction [5–8]. All mutations have been shown to be different, thus showing lack of any common mutation in India [6–8]. Genetic counseling is an integral part of management in view of autosomal recessive nature of the condition and 25 % risk of recurrence in siblings. With the knowledge of mutations prenatal diagnosis can be offered to couples in subsequent pregnancies, using mutation analysis on chorionic villous sampling at 11 wk of pregnancy. SE is a Wellcome Trust Senior Investigator; the authors acknowledge the contribution of Wellcome Trust for making this study possible. Contributions MK and SB: Wrote the manuscript; SE and JH: Carried out molecular genetic testing for FBS; RS: Involved in molecular testing; SB, NW and ICV: Involved in management of case; ICV: Provided critical comments. SB will act as guarantor for this paper. Conflict of Interest None. Source of Funding Wellcome trust provided funds for molecular genetic study.
To the Editor: Two male monochorionic diamniotic twins were born at a general hospital by cesarean section delivery at 37 wk and 5 d of gestation. The antenatal period of the twins was uneventful. The birth weights were 2424 g (first twin) and 2516 g (second twin), respectively. At 9 d, they were admitted to our pediatric ward due to the mother’s social factor. They showed the upper respiratory symptoms such as cough and sneezing at day 21. The results of respiratory syncytial virus (RSV) rapid assay with RSV antigens based on immunochromatography with nasal fluid (Check RSV; Alfresa, Japan) were positive. Their respiratory distress deteriorated and they required mechanical ventilation on day 25 (first twin) and day 22 (second twin). The duration of mechanical ventilation (first twin) was 8 d and the duration of mechanical ventilation (second twin) was 23 d due to severe respiratory distress. Their nasopharyngeal aspirate samples in the acute phase were examined using real-time RT-PCR [1]. Real-Time RT-PCR analysis detected high mounts of RSV type B, 1.7 × 105 copies/viral RNA 1 μg (first twin) and 1.3 × 106 copies/viral RNA 1 μg (second twin), respectively. The levels of IL-8 were measured using a Bio-Plex suspension array (Bio-Rad Laboratories, Tokyo, Japan) in acute nasopharyngeal aspirate samples. IL-8 in the second twin (2421.59 pg/ml) was higher than that in the first twin (591.53 pg/ml).
The results of respiratory syncytial virus (RSV) rapid assay with RSV antigens based on immunochromatography with nasal fluid (Check RSV; Alfresa, Japan) were positive. Their respiratory distress deteriorated and they required mechanical ventilation on day 25 (first twin) and day 22 (second twin). The duration of mechanical ventilation (first twin) was 8 d and the duration of mechanical ventilation (second twin) was 23 d due to severe respiratory distress. Their nasopharyngeal aspirate samples in the acute phase were examined using real-time RT-PCR [1]. Real-Time RT-PCR analysis detected high mounts of RSV type B, 1.7 × 105 copies/viral RNA 1 μg (first twin) and 1.3 × 106 copies/viral RNA 1 μg (second twin), respectively. The levels of IL-8 were measured using a Bio-Plex suspension array (Bio-Rad Laboratories, Tokyo, Japan) in acute nasopharyngeal aspirate samples. IL-8 in the second twin (2421.59 pg/ml) was higher than that in the first twin (591.53 pg/ml). RSV infection induces respiratory tract neutrophil response, IL-8, which is a major chemotactic factor for neutrophils and which is supposed to be a deleterious immune molecule in RSV infection [2]. In the second twin whose clinical course was more severe, RSV copy number and IL-8 in acute nasopharyngeal aspirate samples were high. RNA copy number and IL-8 in the acute phase may have a role to assess the severity of RSV infection. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Source of Funding None.
In the second twin whose clinical course was more severe, RSV copy number and IL-8 in acute nasopharyngeal aspirate samples were high. RNA copy number and IL-8 in the acute phase may have a role to assess the severity of RSV infection. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Source of Funding None. Acknowledgements This paper has been edited and reviewed by native English-speaking medical editors from the Department of International Medical Communications of Tokyo Medical University. Conflict of Interest None.
Introduction In order to improve human resource, children deserve high quality of healthcare at all social and ethnic levels without any discrimination [1]. The futuristic model of pediatrics is likely to be greatly modified by technology boom with further erosion of doctor-parent/patient relationship [2]. The day is not far off when a patient walks in the doctor’s chamber with an electronic or digital health history on a CD or palmtop. He may be asked to walk through a screening device to decipher his genome and get baseline biochemical parameters. The child is likely to get a computer-based diagnosis with the help of apps-based algorithms and given a print out of the prescription.
mber with an electronic or digital health history on a CD or palmtop. He may be asked to walk through a screening device to decipher his genome and get baseline biochemical parameters. The child is likely to get a computer-based diagnosis with the help of apps-based algorithms and given a print out of the prescription. Human Genome Every disease and human behavior is genetically determined by human genome and epigenetics. The life events are pre-destined on the basis of genome, which is like a sophisticated horoscope or Janampatri or “subtle language of God”. Identification and decoding of human genome is the greatest achievement of 21st century [3, 4]. Human genome project (1984–2003) has identified and sequenced 25,000 genes. Around 3 billion DNA base pairs have been decoded by DNA probes. The scientists have identified 1800 diseases, which are expressed through genes. On the basis of genome, we can plan personalized strategies for prevention, diagnosis and treatment of diseases with patient-specific or tailor-made drugs. Human genome has highlighted one of the mysteries that 90 % of human DNA carries no instructions. Nature can’t be wasteful, it is unlikely to be “junk DNA”, and it seems to be the storehouse of untapped human mysteries and potential.
ntion, diagnosis and treatment of diseases with patient-specific or tailor-made drugs. Human genome has highlighted one of the mysteries that 90 % of human DNA carries no instructions. Nature can’t be wasteful, it is unlikely to be “junk DNA”, and it seems to be the storehouse of untapped human mysteries and potential. Revolution in Medical Genetics It is possible to diagnose a large number of life-threatening or disabling genetic, chromosomal and developmental diseases in the fetus and offer “selective abortions” to ensure survival of “genetically normal” human beings [5]. It is likely to reduce the burden of disability so that resources are effectively utilized for improving quality of human life. When a genetically abnormal individual is born, it will be possible to replace “bad” genes by “good” genes tagged to carrier viruses by state-of-the-art genetic engineering technology [6]. The technology is already being used for correction of genetic abnormalities in children suffering from severe combined immunodeficiency syndrome (SCID) due to adenosine deaminase deficiency (ADA), Duchenne muscular dystrophy (DMD), cystic fibrosis, hemophilia, familial hypercholesterolemia and some cancers.
ology [6]. The technology is already being used for correction of genetic abnormalities in children suffering from severe combined immunodeficiency syndrome (SCID) due to adenosine deaminase deficiency (ADA), Duchenne muscular dystrophy (DMD), cystic fibrosis, hemophilia, familial hypercholesterolemia and some cancers. Advances in genetic technologies have led to refinements of various assisted reproductive techniques (ARTs) and feasibility to produce “designer babies”. It is possible to produce clones of babies with identical genetic makeup by artificial twinning of an embryo or by a more complex technique of somatic cell nuclear transfer (SCNT). The classical example of SCNT is the production of Dolly, the sheep, by Scottish scientists. Dolly was the exact replica of the “mother sheep” whose DNA material of a somatic cell was transferred into the enucleated egg cell of another sheep in-vitro. The embryo was implanted into a surrogate mother and carried to term [7, 8]. However, the newer ARTs have raised several ethical and legal issues.
sh scientists. Dolly was the exact replica of the “mother sheep” whose DNA material of a somatic cell was transferred into the enucleated egg cell of another sheep in-vitro. The embryo was implanted into a surrogate mother and carried to term [7, 8]. However, the newer ARTs have raised several ethical and legal issues. Stem Cell Banking and Transplantation Hematopoietic stem cell transplantation (HSCT) by using multipotent hematopoietic stem cells derived from bone marrow, peripheral blood or umbilical cord blood shall be increasingly exploited for treatment of hematologic cancers, non-malignant diseases like thalassemia, aplastic anemia, inborn errors of metabolism and autoimmune disorders [9, 10]. The source of stem cells may be autologous (stored patient’s own blood) or allogeneic, when stem cells are obtained from a compatible donor. In allogeneic stem cell therapy, risk of infection, mismatching, rejection and graft-versus-host disease (GVHD) is much higher. Cord blood is a rich source of stem cells. A number of companies such as Lifecell, Babycell, Cordlife, and Stemade provide services for collection and cryopreservation of cord blood, which can be used for treatment of a number of life- threatening and lifestyle diseases in the donor, siblings and parents in later life. It is possible to repair a defective organ of the body by infusing totipotent natural or cloned stem cells [11].
e provide services for collection and cryopreservation of cord blood, which can be used for treatment of a number of life- threatening and lifestyle diseases in the donor, siblings and parents in later life. It is possible to repair a defective organ of the body by infusing totipotent natural or cloned stem cells [11]. Diagnostic Marvels There will be increasing use of technology to assess, monitor and manage patients, with further depersonalization of pediatrics. The communication skills or bedside manners shall be increasingly replaced by technical interventions. The patients are likely to be increasingly fragmented into systems, organs, tissues, cells and DNA. The age old symbol of physicians, the stethoscope, is likely to be replaced by digital stethoscope powered by iPhone or Android smart phone, hand-held ultrasound device, pulse oximeter and apps -based algorithms for making a diagnosis in the ambulatory clinic. DNA and rRNA probes are likely to be increasingly used for diagnosis of infective and genetic disorders [12, 13]. It is envisaged that in due course of time, just a drop of blood will be enough to obtain values of most of the biochemical parameters. Electronic devices in the form of a smart biometric “wrist watch” are in the pipeline to monitor vital signs, some biochemical parameters, hydration status and oxygen concentration. It is based on non-invasive pulse wave data collector using a modified applanation tonometry technique for recording real -time radial artery pulse waves. It can be used as a stand-alone device or paired with your iPhone or Android smart phone [14, 15]. The work is in progress to develop sensors for assessing kidney functions and add-on displays for EKG and EEG. Intelligent scales or cutting-edge wireless smart scales are being developed to monitor body weight, body mass index (BMI), body water, bone mass, and daily caloric intake. Japan is in the forefront to develop smart loos or intelligent toilets to maintain effective bottom hygiene, assess certain body parameters and analyze body wastes.
s or cutting-edge wireless smart scales are being developed to monitor body weight, body mass index (BMI), body water, bone mass, and daily caloric intake. Japan is in the forefront to develop smart loos or intelligent toilets to maintain effective bottom hygiene, assess certain body parameters and analyze body wastes. It is hoped that in the near future “Genometers” will be available to delineate the genomic characteristics of a person to predict personality and vulnerability to various diseases during the life span of a person, akin to an Indian horoscope. Raman spectroscopy is a quick, easy and non-invasive tool that can identify a large number of objects by virtue of their molecular size and DNA characteristics. Almost every material has its own Raman pattern, based on how strongly its atoms are bonded [16]. Hand-held Raman scanners are available which can be used for identification of drugs of abuse and explosives, diagnosis of cancer, identification of pathogens and allergens and estimation of blood components.
racteristics. Almost every material has its own Raman pattern, based on how strongly its atoms are bonded [16]. Hand-held Raman scanners are available which can be used for identification of drugs of abuse and explosives, diagnosis of cancer, identification of pathogens and allergens and estimation of blood components. Nutritional Nuances Three pillars, which are crucial for maintenance of sound health and good quality of life, include sound genetic constitution, safe environment, and intake of wholesome balanced food. Food is indeed the breakthrough drug of the 21st century! Almost 2500 y ago, Hippocrates said, “Let thy food be thy medicine and thy medicine be thy food”. There is a popular Indian saying, “When diet is wrong, medicine is of no use. When diet is correct, there is no need for any medicine”. In order to tackle the widespread deficiencies of iodine, iron, zinc and vitamin A, food fortification or use of nutritional sprinklers are likely to become a reality in selected populations. Protein hydro lysates and hypoallergenic foods shall be available for prevention and treatment of food allergies, which are emerging as public health problems in certain populations. The concept of functional foods is being increasingly exploited to prevent illness, promote health and improve quality of life. These foods have potentially positive effects on health beyond nutrition [17]. They promote positive health and reduce the risk of diseases by virtue of phytonutrients, antioxidants, soluble and insoluble fiber, and probiotics [18].
increasingly exploited to prevent illness, promote health and improve quality of life. These foods have potentially positive effects on health beyond nutrition [17]. They promote positive health and reduce the risk of diseases by virtue of phytonutrients, antioxidants, soluble and insoluble fiber, and probiotics [18]. Genetically modified (GM) foods are genetically engineered to produce changes in their DNA for selective and mutation breeding. They are produced for better yield, resistance to pathogens and herbicides and for better nutrient profiles [19]. Most food modifications have primarily focused on cash crops like golden rice, BT cotton, and vegetable oils. But technology is not without travails. The safety of GM foods is controversial because their intake may be associated with greater risk of allergies, immune suppression, elaboration of toxins, emergence of antibiotic resistant super bugs and nutritional problems. The nutritional content of animal foods like milk, eggs, and meat can be improved by feeding the animal a diet rich in omega-3 fatty acids and docosahexaenoic acid (DHA) [20].
ith greater risk of allergies, immune suppression, elaboration of toxins, emergence of antibiotic resistant super bugs and nutritional problems. The nutritional content of animal foods like milk, eggs, and meat can be improved by feeding the animal a diet rich in omega-3 fatty acids and docosahexaenoic acid (DHA) [20]. Vaccines have accomplished near miracles in the fight against infections with virtual eradication of smallpox and polio from the world. However, the increasing number of vaccine shots is painful and frightening both to the children and their parents. A needleless pen-shaped device has been developed to deliver drugs and vaccines through painless supersonic waves. Oral and mucosal vaccines are being developed against rotavirus, typhoid, flu, cholera, RSV, and measles. Genes from bacteria and viruses are being inserted into the genetic makeup of fruits, vegetables and cereal grains to produce edible vaccines that are not destroyed by cooking or frying the food [21]. There is hope that in the near future, antigen-primed or transgenic bananas, potatoes, tomatoes, lettuce, rice, wheat, soybeans and corn, shall be available as child-friendly vaccines [22, 23].
of fruits, vegetables and cereal grains to produce edible vaccines that are not destroyed by cooking or frying the food [21]. There is hope that in the near future, antigen-primed or transgenic bananas, potatoes, tomatoes, lettuce, rice, wheat, soybeans and corn, shall be available as child-friendly vaccines [22, 23]. Therapeutic Advances Each human being is unique by virtue of its DNA. But in the modern system of medicine we prescribe the same medicine, in the same dose, through the same route and for the same duration for every patient, which is obviously too simplistic and naïve. X-ray crystallography can identify the atomic and molecular structure of a crystal and is being harnessed to discover and design new tailor-made or personalized drug molecules. Pharmacogenomics is being used to produce specific drugs on the basis of genomic subgroups [24]. It is possible to deliver the drug to the site of disease with the help of liposomes and carrier monoclonal antibodies. It is associated with decreased dosing, better efficacy, and reduced risk of adverse drug reactions. A number of natural biological response modifiers (BRMs) have been identified and are being exploited to control severe infections and certain malignant disorders [25]. They include interferons, interleukins, tumor necrosis factor (TNF), colony stimulating factors (CSF, G-CSF, GM-CSF), cytokines, imiquimod, and monoclonal antibodies.
ural biological response modifiers (BRMs) have been identified and are being exploited to control severe infections and certain malignant disorders [25]. They include interferons, interleukins, tumor necrosis factor (TNF), colony stimulating factors (CSF, G-CSF, GM-CSF), cytokines, imiquimod, and monoclonal antibodies. Milstein and his co-workers have combined two types of immune cells to create hybrid clones of immune cells or hybridoma in order to produce specific antibodies for a wide range of targets [26]. The availability of monoclonal antibodies has ignited the hope for prevention and treatment of life-threatening infections, for transport and delivery of drugs to the site of disease, destruction of cancer cells and identification of metastases with the help of radionuclide antibodies [27]. Efforts are being made to implant memory biochips, arrays of Nano-polymer wires and develop other neurobionic interventions to take over the functions of damaged neurons. It has been shown that electrical stimulation of tongue with the help of a portable neuromodulator stimulator (PoNS) can facilitate the repair of damaged neurons. The Chinese workers have produced progenitor cells from urine waste cells, which are useful for regeneration of neurons. It is feasible to produce cyborgs with superhuman capabilities like an IQ of a genius, eyesight of an eagle and hearing of a bat.
lator stimulator (PoNS) can facilitate the repair of damaged neurons. The Chinese workers have produced progenitor cells from urine waste cells, which are useful for regeneration of neurons. It is feasible to produce cyborgs with superhuman capabilities like an IQ of a genius, eyesight of an eagle and hearing of a bat. A large number of lasers are available for photodynamic and cosmetic dermatology for treatment of various disorders of pigmentation and birthmarks. They include carbon dioxide laser, Q-switched lasers (Ruby, Nd:YAG, and Alexandrite), Argon laser, pulse-dye and metal vapor lasers [28, 29]. Attempts are being made to produce artificial blood or blood substitute which is either hemoglobin-based or per fluorocarbon-based oxygen carriers [30]. They are likely to serve the felt need of chronic shortage of blood and eliminate the risk of transmission of blood-borne diseases, immune suppression and other adverse effects of blood transfusion. The research workers at the Massachusetts Institute of Technology (MIT), Cambridge, United States have identified double-stranded RNA activated caspase oligomerisers (DRACO), which are credited with effective antiviral activity [31]. They can serve as broad spectral antiviral agents for a variety of viral illnesses like dengue, flaviviruses, arenaviruses, H1N1 influenza and rhinoviruses.
), Cambridge, United States have identified double-stranded RNA activated caspase oligomerisers (DRACO), which are credited with effective antiviral activity [31]. They can serve as broad spectral antiviral agents for a variety of viral illnesses like dengue, flaviviruses, arenaviruses, H1N1 influenza and rhinoviruses. Surgical Wonders Imaging-guided interventions and keyhole or minimally invasive surgical procedures with fast recovery and minimal scarring have already become a reality [32]. It is possible to replace each and every defective body organ by biological (human or animals like baboons and pigs) or synthetic spare parts like hearing aids, cochlear transplants, lenses, dentures, pace makers, heart valves, silicon implants, artificial joints and limbs. Computer-aided surgical robots are being increasingly exploited to conduct routine and complex surgical procedures at a local site or a distant location. The robotic surgery is associated with advantages of smaller incision, greater precision, miniaturization, reduced blood loss, less pain and shorter duration of hospital stay. Intelligent surgical knife (iKnife) has been developed for bloodless incision and the vaporized smoke produced while cutting the tissues is analyzed by a mass spectrometer to diagnose malignancy real-time. A large number of electronically guided equipment like lasers, fiber optics, drills and staplers are being used to conduct surgical procedures more effectively and with greater safety. Smart e-pants or electric underpants are available to prevent occurrence of bedsores in chronic and comatose patients.
nancy real-time. A large number of electronically guided equipment like lasers, fiber optics, drills and staplers are being used to conduct surgical procedures more effectively and with greater safety. Smart e-pants or electric underpants are available to prevent occurrence of bedsores in chronic and comatose patients. Tele-Pediatrics Tele- or distant medicine has become a reality and Canadian workers have made outstanding contributions in this venture [33, 34]. It is possible to transfer the clinical case file through e-mail or clip stored in the cloud. Imaging scans and electro-magnetic waves from various body organs can be transmitted through a telephone line or an app. Consultations can be sought globally at the touch of a button. Teleconferences are being increasingly used for distant teaching. It is possible to provide global live coverage of complex surgical procedures through satellite [35]. Future Innovations and Developments Medicine is dynamic and pediatrics is far more dynamic with a rapid pace of developments to improve survival and quality of life. A large number of innovations have already become a reality or are likely to be introduced in the near future (Table 1).Table 1 List of future innovations and developments
s and Developments Medicine is dynamic and pediatrics is far more dynamic with a rapid pace of developments to improve survival and quality of life. A large number of innovations have already become a reality or are likely to be introduced in the near future (Table 1).Table 1 List of future innovations and developments • Better health surveillance by human and microbial genomics with greater emphasis on prevention by genetic counseling, interventions and lifestyle modifications. • Newer vaccines against HIV, SARS, bird flu, swine flu, malaria, dengue, zika, hepatitis C, CMV, Lyme disease etc. • DNA vaccines for non-infective diseases like obesity, hypertension, type 2 diabetes mellitus, addictions, multiple sclerosis, Alzheimer’s, autoimmune disorders, cancer, contraception etc. • Early diagnosis by bedside antigen-based screening tests and molecular biological techniques like DNA and rRNA probes. • Robotic and laparoscopic repair and replacement of defective body organs. • Cryogenics for storage of stem cells and organ banking by cold vitrification. • Aggressive life saving devices like sophisticated ventilators, heart-lung machine and other organ by-passers. • Implanting of memory biochips, nano-polymer wires and neurobionic interventions in the brain to take over the functions of damaged neurons. • Increased chances of survival and enhanced longevity by restoring the length of telomeres and by increasing the concentration of mitochondria, with a greater load of degenerative diseases and health issues pertaining to oldies.
and neurobionic interventions in the brain to take over the functions of damaged neurons. • Increased chances of survival and enhanced longevity by restoring the length of telomeres and by increasing the concentration of mitochondria, with a greater load of degenerative diseases and health issues pertaining to oldies. HIV Human immunodeficiency virus; SARS Severe acute respiratory syndrome; CMV Cytomegalovirus Emerging Health Catastrophes Lifestyle diseases and over nutrition among adolescents are emerging as public health problems because of intake of calorie-dense junk food, sedentary lifestyle and indulgence in excessive “screen time”. Obesity is associated with adverse health consequences such as syndrome X, adult-onset diabetes mellitus, hypertension and coronary artery disease. A large number of newer infective disorders like HIV, SARS, bird flu, swine flu, zika, Ebola, and multidrug resistant superbugs are causing serious health issues. Following control of infective diseases by better public health interventions and immunizations, newer non-infective disorders like cancers, allergies, metabolic abnormalities, psychological and stress disorders, degenerative disorders like Alzheimer’s, and diseases due to pollutants, pesticides and toxins are assuming public health proportions. Whenever man tries to improve survival and quality of life, nature tries to seek a balance by unleashing natural disasters. There is an ever-increasing scare of natural and man-made disasters like travel accidents, famines, floods, tsunamis, earthquakes, nuclear, chemical and biological wars.
public health proportions. Whenever man tries to improve survival and quality of life, nature tries to seek a balance by unleashing natural disasters. There is an ever-increasing scare of natural and man-made disasters like travel accidents, famines, floods, tsunamis, earthquakes, nuclear, chemical and biological wars. A Step Towards Immortality Man has always strived to prolong life and cheat death but despite all the technological advances, medicine can never achieve immortality! Nature is a huge recycling plant and birth-life-death-rebirth is in accordance with a pre-ordained celestial principle. Nevertheless, scientists have made attempts to upload human neocortex through cloud with the help of brain-computer interfaces to achieve singularity and digital immortality. It is hoped that by 2050, we will have new breed of computers who will have the ability to feel, perceive, interact and have artificial intelligence with the help of brain-computer interfaces [36]. It sounds fictional but attempts are being made to use cryonics technology to preserve human organs or whole body for future resurrection by using cloning nanotechnology to bring it back to life when a cure is found for the disease that caused the death [37, 38]. It appears man is trying to play god, but these attempts are most likely to prove futile. Instead of prolonging human life, it is more important to improve the vitality of health and quality of life throughout the life span of a person.
t back to life when a cure is found for the disease that caused the death [37, 38]. It appears man is trying to play god, but these attempts are most likely to prove futile. Instead of prolonging human life, it is more important to improve the vitality of health and quality of life throughout the life span of a person. Holistic Pediatrics There is an increasing awareness that technology should not be allowed to further dehumanize medicine. There is a need to provide holistic care by focusing on the “patient” having the disease and not on the “disease” per se. The patients should be viewed in totality, and that too not in isolation but in context with the dynamics of ecology, family, friends, and society. Instead of becoming passive recipients of drugs, patients and their parents, should become active participants in order to augment the process of healing. Effective communication and showing due concern, compassion and empathy can energize the psycho-neuro-immunology axis of the patient. It is desirable that all approaches to healthcare should be exploited to provide healing. The alternative approaches to health care include Ayurveda, Unani, Siddha, Homeopathy (AYUSH), Naturopathy, Acupressure, Acupuncture, Reflexology, Tai-Chi, DiGong, Reiki, Yoga, Meditation, Visualization, Magnetic therapy, Gemology, Aroma therapy, Salt therapy, Prayer and Spiritual healing. In order to improve effective utilization of all complementary therapies, Ministry of Health, Government of India has created a separate wing of Indian System of Medicine and Homeopathy (ISM and H) for effective utilization of herbal medicines and drugless therapies.
therapy, Salt therapy, Prayer and Spiritual healing. In order to improve effective utilization of all complementary therapies, Ministry of Health, Government of India has created a separate wing of Indian System of Medicine and Homeopathy (ISM and H) for effective utilization of herbal medicines and drugless therapies. Our body is suffused with a cosmic life force energy field consisting of light, heat, sound, electric and magnetic waves emanating from various “chakras”. The bio field, which is called aura, halo or corona, extends beyond the skin and forms a protective sheath. There are seven chakras, which are located along the spine adjacent to various endocrine glands. They are linked with the body Meridians, Nadis, Bhongan, and Duct system. It is believed that life energy or Prana flows into and out of our chakras. Starting from base of the spine to the top of the head, the chakras include Kundalini (coccyx), Hara (sacral), Solar plexus (navel), Heart (midback), Thyroid (base of throat), Brow (third eye), and Crown (sahasrara), which integrates all the chakras and is a source of astral energy (gold sun) or global consciousness or nonbeing. A healthy person, who has physical vitality, mental clarity, emotional, social and spiritual wellbeing, is likely to have bigger and brighter auras [39, 40]. Whenever, there is stress or dysfunction, whether physical, psychological, social or spiritual, the chakra energy field or halo is disturbed. Human chakras can be scanned by various Kirlian equipment like Polycontrast Interference Photography (PIP), Digital Aura Scanning System (DAS), Gas Discharge Visualization (GDV), Medical Thermal Imaging (MTI), Resonant Field Imaging (RFI), and Electro Interstitial Scanning (EIS). When a chakra is found to be diseased or dysfunctional, it can be energized or activated with electric current, magnetic waves, healing touch, Reiki and crystal healing.
System (DAS), Gas Discharge Visualization (GDV), Medical Thermal Imaging (MTI), Resonant Field Imaging (RFI), and Electro Interstitial Scanning (EIS). When a chakra is found to be diseased or dysfunctional, it can be energized or activated with electric current, magnetic waves, healing touch, Reiki and crystal healing. The Future Hope There is tremendous hope and scope for outstanding achievements in the field of medicine in 21st century. There will be a greater focus on public health interventions to improve social, community, and environmental factors to enhance survival and quality of life. Healthy lifestyle and improvements in the health status and quality of life in children is associated with reduced burden of adult diseases because seeds of most adult diseases are sown in childhood. Advances in clinical genetics are likely to revolutionize pediatrics. There will be no issue of survival of the fittest because everyone will survive. Individuals born with defective genes will be managed by insertion of healthy cloned genes by further refinements in genetic engineering technology. Molecular diagnostic tests are likely to be readily available with a possibility of having personalized or tailor-made medicines depending upon the genetic constitution of the patient. A number of newer vaccines for emerging infections are in the pipeline including realization of the revolutionary concept to produce vaccines for a large number of non-infective lifestyle diseases. The scientists are going to play “god” to produce designer babies but it is unlikely to become a reality because of tremendous ethical and legal issues.
emerging infections are in the pipeline including realization of the revolutionary concept to produce vaccines for a large number of non-infective lifestyle diseases. The scientists are going to play “god” to produce designer babies but it is unlikely to become a reality because of tremendous ethical and legal issues. Future pediatrics will not merely focus on diseases but will pay attention to children and their parents to energize the psycho-neuro-immunology axis and provide holistic medicine by further refinements and exploitation of a variety of complementary and alternative approaches to promote health. Medicine will become more patient-specific and less disease oriented. We shall be able to prolong life and ensure the quality of life worth living but we should not aim for immortality or resurrection of life. Nature is a huge recycling plant and no body should try to arrest the divine process of birth-life-death-rebirth… However, there is a fond hope that in the next millennium, people are likely to have an IQ of 150 and live to an average age of 120 y—but more importantly they are likely to have a good quality of life worth living. Compliance with Ethical Standards Conflict of Interest None. Source of Funding None.
Introduction The importance of childhood community acquired pneumonia (CAP) cannot be emphasized enough. It has been, and continues to be, the single most important cause of childhood morbidity and mortality across the world [1]. In the early nineties, over 25% of the annual deaths of children in developing countries before the fifth birthday was attributable to pneumonia [2]. In 2008, it was estimated to be responsible for 1.6 million deaths among <5-y-old children around the world [3]. As recently as 2013, the worldwide Global Burden of Diseases (GBD) analysis suggested that CAP could be responsible for approximately 0.9 million childhood deaths; this translates to over 14% of all childhood deaths [4]. As expected the global burden is borne disproportionately by resource-constrained countries; where the incidence of childhood CAP is estimated to be 15 fold higher than resource rich settings [5]. Some of this is related to higher prevalence of baseline ‘risk factors’ such as malnutrition, inadequate breast feeding, exposure to household pollution, overcrowding, etc. [6]. Naturally, the addition of other risk factors, such as exposure to HIV in some settings, compounds the problem. In addition to immense public heath importance, childhood pneumonia also has serious consequences for the individual child. Besides the immediate risks of complications and mortality, emerging data shows that pneumonia in childhood can predispose to long term complications such as decreased lung function, asthma and even chronic obstructive lung disease in later life [7].
ood pneumonia also has serious consequences for the individual child. Besides the immediate risks of complications and mortality, emerging data shows that pneumonia in childhood can predispose to long term complications such as decreased lung function, asthma and even chronic obstructive lung disease in later life [7]. Thus, the determination of microbial etiology in childhood pneumonia has considerable importance. At the individual level, it impacts treatment decisions such as whether to use antibiotics (or not), choice of antibiotics, duration of therapy, etc. At the institutional level, it determines antibiotic administration policies; and at the community level, these decisions have greater implications including patterns of antimicrobial resistance. From the public health perspective, this apparently simple issue governs vaccination (and/or other prophylaxis) policies, allocation of resources to specific programmes in this direction, and to some extent, the research agenda in childhood pneumonia. Needless to mention, commercial interests (antibiotics, vaccines, delivery programmes, etc.) run into billions of dollars.
mple issue governs vaccination (and/or other prophylaxis) policies, allocation of resources to specific programmes in this direction, and to some extent, the research agenda in childhood pneumonia. Needless to mention, commercial interests (antibiotics, vaccines, delivery programmes, etc.) run into billions of dollars. Determination of Pneumonia Etiology For almost a whole century, the direct demonstration of organisms by culture (or staining methods) in lung aspirates of children with pneumonia, was the accepted approach to determine microbial etiology, in developed and developing countries [8–11], including India [12–16]. In fact, lung aspiration is regarded the gold standard for determining etiology [17, 18]. The approach was bolstered by the finding that pulmonary aspirates in a small cohort of children without clinical or radiographic pneumonia, were uniformly sterile [9], suggesting that lung aspiration had no false positivity. Some studies focusing on postmortem lung aspiration also contributed valuable data [19]. The main premise with this approach was that the lung was regarded as a sterile tissue; consequently any micro-organism found there, was regarded as pathogenic. Lung aspiration studies demonstrated the major bacteria implicated in childhood pneumonia viz. Streptococcus pneumoniae and Haemophilus influenzae; along with Staphylococcus aureus and other bacteria in some studies. A limited number of studies also attempted to identify viruses either by culture or other methods such as immunofluorescence [11, 20–23]. It should be emphasized that many of the lung aspiration analyses were undertaken in children with radiographically confirmed pneumonia and often, before antibiotic administration. Table 1 summarizes the data from an exhaustive review of lung aspirate studies [24]; this shows that developed countries stopped performing lung aspirates by the 1970s, by which time developing countries started such studies and continued till the mid-nineties. More recently, a study in Malawi using PCR in lung aspirate samples of 95 children with radiographic pneumonia, reported that while aspirate culture yielded bacteria in only 2 cases; PCR showed bacteria in 36 cases. Viruses were identified singly or in combination in 24 cases. Altogether lung aspirate PCR could identify organisms in 59 of 95 (62.3%) children [25].
lung aspirate samples of 95 children with radiographic pneumonia, reported that while aspirate culture yielded bacteria in only 2 cases; PCR showed bacteria in 36 cases. Viruses were identified singly or in combination in 24 cases. Altogether lung aspirate PCR could identify organisms in 59 of 95 (62.3%) children [25]. In another small study of 55 children with severe pneumonia; 47 of whom underwent lung aspiration; pathogens were identifiable by a combination of culture and PCR (from lung aspirates or pleural fluid) in over 90% cases [26].Table 1 Summary of lung aspirate studies around the world till 2000. Data calculated from Vuori-Holopainen [24] Europe North America South America Africa Asia Oceania Total Pre 1950 Studies 6 5 0 2 0 0 13 Sample size 2–61 13–405 52–233 1071 Bacteria identified 30–100% 18–100% 78–92% 551 (51.4%) 1951–1970 Studies 1 4 1 0 3 0 9 Sample size 51 1–32 125 17–25 272 Bacteria identified 65% 0–100% 54% 29–44% 119 (43.8%) 1971–1980 Studies 0 1 6 5 3 1 16 Sample size 27 21–530 7–88 68–193 18 1321 Bacteria identified 22% 10–57% 17–79% 53–88% 44% 455 (34.4%) 1981–1990 Studies 0 0 0 5 1 1 7 Sample size 40–108 70 83 402 Bacteria identified 33–67% 51% 61% 220 (54.7%) Post 1991 Studies 0 0 0 7 5 12 Sample size 1–99 12–100 669 Bacteria identified 38–100% 16–50% 333 (49.8%)
16 Sample size 27 21–530 7–88 68–193 18 1321 Bacteria identified 22% 10–57% 17–79% 53–88% 44% 455 (34.4%) 1981–1990 Studies 0 0 0 5 1 1 7 Sample size 40–108 70 83 402 Bacteria identified 33–67% 51% 61% 220 (54.7%) Post 1991 Studies 0 0 0 7 5 12 Sample size 1–99 12–100 669 Bacteria identified 38–100% 16–50% 333 (49.8%) Some of the studies examined blood as a surrogate sample. However studies comparing lung aspirate with blood cultures confirmed the relatively poor sensitivity of the latter. In a review of 9 such series, while lung aspirates could identify organisms in over 50% cases, blood culture could identify the etiology in only 25% [24]. Blood culture was negative in about a third of the cases; and both blood and lung aspirate cultures were positive in less than one-fifth cases.
tivity of the latter. In a review of 9 such series, while lung aspirates could identify organisms in over 50% cases, blood culture could identify the etiology in only 25% [24]. Blood culture was negative in about a third of the cases; and both blood and lung aspirate cultures were positive in less than one-fifth cases. The identification of bacteria in various studies resulted in two important developments with widespread ramifications. First, the WHO led global efforts to enhance the use of antibiotics, in order to save lives of children with pneumonia, especially in resource limited settings. For this, a highly sensitive clinical definition of pneumonia was evolved whereby field workers (note emphasis) in resource constrained settings could identify (and treat) children urgently; with the focus being to prevent mortality. The definition was based on easy to recognize clinical symptoms and signs; and did away with radiographic confirmation [27]. Global experts recognized that while this approach could ensure that no child failed to receive antibiotics, it would result in over-treatment on account of false positive diagnosis. But this trade-off was considered acceptable. An undesirable ‘side-effect’ was that health-care systems in developing countries with access to resources/ facilities, also started using the highly sensitive definition of pneumonia; both for management of individual children, as well as research studies. This spawned a series of studies on pneumonia etiology wherein unknown proportions of enrolled children probably did not actually have pneumonia.
ith access to resources/ facilities, also started using the highly sensitive definition of pneumonia; both for management of individual children, as well as research studies. This spawned a series of studies on pneumonia etiology wherein unknown proportions of enrolled children probably did not actually have pneumonia. The second development with enhanced antibiotic usage was that many studies started enrolling children (using the liberal WHO definition) even if they had received antibiotics for varying durations of time. Naturally this decreased the yield of bacteria identified by culture. Around the same time, data from a large multi-centric study (10 sites in developing countries) of acute respiratory tract infection (ARI) etiology, became available [28]. This study relied on blood and pleural fluid culture to identify bacteria; and nasopharyngeal aspirate culture to identify viruses. The study reported that viruses (especially respiratory syncytial virus) were identified more often than bacteria in children with lower respiratory infection, enrolled from the community as well as hospital (in-patient and out-patient).
ure to identify bacteria; and nasopharyngeal aspirate culture to identify viruses. The study reported that viruses (especially respiratory syncytial virus) were identified more often than bacteria in children with lower respiratory infection, enrolled from the community as well as hospital (in-patient and out-patient). In a sense, this opened the floodgates for a variety of research studies examining nasopharyngeal (swab or aspirate), or nasal or even oropharyngeal samples among children with the liberal definition of pneumonia, including those with prior receipt of antibiotics. The non-specificity of these samples vis a vis lung aspirate samples resulted in several bacteria and viruses being identified; and accorded etiologic status. In fact, this trend has continued till now; with the added layer of advanced molecular techniques such as polymerase chain reaction (PCR) replacing culture (as a faster, albeit more expensive method). PCR being highly sensitive (for detection of microbial footprints) although less specific (for determination of a cause-and-effect relationship) made it possible to detect multiple organisms (pathogenic or otherwise) and label them as etiologic agents. The major problem with this approach (in addition to the non-specific definition of pneumonia) is that almost all the bacterial species implicated in pneumonia causation (S. pneumoniae, H. influenzae, S. aureus, Mycoplasma etc) are also found in the nasopharynx of normal children; who get colonized in early life without suffering from an infection [29–32]. In such a setting, the inference that detection (of organisms) implies causality is akin to assuming that anyone detected at the scene of a crime is responsible for it.
eus, Mycoplasma etc) are also found in the nasopharynx of normal children; who get colonized in early life without suffering from an infection [29–32]. In such a setting, the inference that detection (of organisms) implies causality is akin to assuming that anyone detected at the scene of a crime is responsible for it. The problem is compounded further by other studies in recent years showing that most of the viruses identified in nasopharyngeal secretions of children with so-called pneumonia, are also identifiable in those with upper respiratory infection; and even normal (i.e., asymptomatic) infants and children [33–35]. A recent systematic review of case-control studies suggested that detection of RSV, influenza virus, human metapneumovirus, and parainfluenza virus in nasopharyngeal secretions of cases was associated with lower respiratory tract infection much more often than controls; whereas there was no such association for other viruses such as coronaviruses, bocavirus, or adenovirus [36]. However, this is not entirely helpful for individual children because there will be exceptions to the trend. A recent publication by Zar et al. [37] succinctly outlined the relative advantages and disadvantages of using various biological specimens (such as blood, naso/oro pharyngeal secretions, blood, broncho-alveolar lavage, lung aspirate) and diverse methods to identify organisms (including culture, PCR, antigen detection, serology studies etc). However, there is no single test in any biological sample that can accurately establish etiology in children with pneumonia.
blood, naso/oro pharyngeal secretions, blood, broncho-alveolar lavage, lung aspirate) and diverse methods to identify organisms (including culture, PCR, antigen detection, serology studies etc). However, there is no single test in any biological sample that can accurately establish etiology in children with pneumonia. Table 2 summarizes the major challenges in confirming microbial etiology of childhood pneumonia.Table 2 Challenges in confirming microbial etiology of childhood pneumonia Challenges with the concept of “pneumonia” •Pneumonia” is a pathologic diagnosis with clinical and radiographic correlates that can suggest (but not necessarily confirm) its presence. However, histopathologic confirmation is not feasible in individual cases or epidemiologic studies. •Surrogate definitions compromise either sensitivity (for example radiographic definition) and/or specificity (for example WHO definition) or both (for example clinician diagnosed pneumonia) •Multiplicity of definitions across studies with difficulty in comparison(s). •Studies restricted to hospitalized children create a bias associated with health-seeking behavior and/or strong referral systems and/or survival (i.e., children who die before reaching the hospital are not included). •Studies using radiographic inclusion criteria do not always use standardized criteria. Challenges with the concept of “etiology”
•Pneumonia” is a pathologic diagnosis with clinical and radiographic correlates that can suggest (but not necessarily confirm) its presence. However, histopathologic confirmation is not feasible in individual cases or epidemiologic studies. •Surrogate definitions compromise either sensitivity (for example radiographic definition) and/or specificity (for example WHO definition) or both (for example clinician diagnosed pneumonia) •Multiplicity of definitions across studies with difficulty in comparison(s). •Studies restricted to hospitalized children create a bias associated with health-seeking behavior and/or strong referral systems and/or survival (i.e., children who die before reaching the hospital are not included). •Studies using radiographic inclusion criteria do not always use standardized criteria. Challenges with the concept of “etiology” •In modern times, it is highly unlikely that Koch’s postulates (for determining etiology) can be fulfilled in any research study. •The assumption that identification of an organism indicates causality (even from lung aspirates and/or blood samples) is not necessarily correct. Challenges with biological specimens to determine etiology
•In modern times, it is highly unlikely that Koch’s postulates (for determining etiology) can be fulfilled in any research study. •The assumption that identification of an organism indicates causality (even from lung aspirates and/or blood samples) is not necessarily correct. Challenges with biological specimens to determine etiology •The ideal specimen would be lung tissue from the area with pneumonia (note emphasis) obtained at the onset of illness, but this is not feasible in routine clinical practice or research studies. •The closest to this ideal (radiographically guided lung aspirate/ biopsy; or broncho-alveolar lavage, at the onset of illness or at least at presentation) is difficult for ethical, technical and/or epidemiologic reasons. •Lung aspirates/biopsy or broncho-alveolar lavage specimens later in the course of disease, or after death; in hospitalized children can create the risk of detecting hospital acquired pathogens (especially in sick children with multiple interventions including intubation). •The lung is not necessarily a sterile tissue and has a dynamic microbiome that could be influenced by a variety of factors. •Lung aspiration is also not fool-proof and negative results have been observed despite targeting the correct area and obtaining appropriate representative samples. There are of course risks associated with the technique although it is regarded safe in expert hands. •Blood has limited sensitivity (and possibly specificity) in childhood pneumonia. •Nasal swabs/ nasopharyngeal aspirates/ nasopharyngeal swabs/ oropharyngeal swabs do not necessarily reflect the organisms in the lower airways or lungs. •Sputum is often not produced by infants and young children. •Induced sputum is a viable alternative, but requires premedication with bronchodilator and has the risk of inducing emesis. •Gastric aspirate and/or lavage samples are useful only for detecting organisms resistant to gastric acid. •The volume of blood used for culture alters the results. The ideal volume of blood required may not be obtainable in young infants and children. •Use of prior antibiotics (rampant in settings with uncontrolled access) compromises findings in blood and to some extent, lung aspirates. •There are no biomarkers that correlate with microbial etiology
r culture alters the results. The ideal volume of blood required may not be obtainable in young infants and children. •Use of prior antibiotics (rampant in settings with uncontrolled access) compromises findings in blood and to some extent, lung aspirates. •There are no biomarkers that correlate with microbial etiology Challenges with processing of biological specimens to determine etiology
r culture alters the results. The ideal volume of blood required may not be obtainable in young infants and children. •Use of prior antibiotics (rampant in settings with uncontrolled access) compromises findings in blood and to some extent, lung aspirates. •There are no biomarkers that correlate with microbial etiology Challenges with processing of biological specimens to determine etiology •Samples need to be collected, transported to the lab and processed appropriately. Although sample collection is often timely, there are delays in transport and/or processing. •Culture is the usual gold standard for bacteria but has limited sensitivity. For some organisms, PCR (or other molecular based methods) have higher sensitivity, but it is difficult to distinguish between live organisms, dead organisms, or remnants of organisms. •Molecular methods to detect organisms such as PCR are generally reported as positive or negative. However, this depends on the limits of detection (which are generally not reported). •PCR can detect only the organisms that are looked for; in other words, there is an inherent selection bias. This results in missing organisms, that were not searched for and/or novel/unexpected organisms. •Studies designed to identify one (or a limited number of selected) micro-organisms, are inherently biased. •Highly sensitive methods often reveal footprints of multiple organisms; but the contributory role of these (in etiology) is unclear. •Serology based tests for atypical organisms are unreliable for determination of etiology. •Detection of antigens in urine lacks specificity.
ted) micro-organisms, are inherently biased. •Highly sensitive methods often reveal footprints of multiple organisms; but the contributory role of these (in etiology) is unclear. •Serology based tests for atypical organisms are unreliable for determination of etiology. •Detection of antigens in urine lacks specificity. Challenges with interpretation of results •The detection of one or more organisms in various biological specimens need not mean causality. •The significance and interpretation of different organisms in different biological specimens of individual cases, is unclear. •Case control studies can only suggest pathogenicity (in the overall group), but not confirm it (in individual cases or the whole group). •Case control studies cannot factor in data from multiple specimens as invasive/painful methods are generally not used in controls. •It is unclear which children (healthy or those with non pneumonia respiratory infections) should serve as controls in case-control studies. •Statistical methods such as latent class analysis can slot cases into etiology ‘classes’, but do not confirm etiology in individual cases.
ods are generally not used in controls. •It is unclear which children (healthy or those with non pneumonia respiratory infections) should serve as controls in case-control studies. •Statistical methods such as latent class analysis can slot cases into etiology ‘classes’, but do not confirm etiology in individual cases. Pneumonia Etiology Research for Child Health (PERCH) Recognizing these problems, the Bill and Melinda Gates Foundation initiated the multi-centric PERCH (Pneumonia Etiology Research for Child Health) study in seven developing countries (contributing nine sites) to confirm the microbial etiology of childhood pneumonia [3, 38]. This was designed as a case-control study among those less than 5 y (excluding neonates), to identify pathogens in multiple biological samples (viz. blood, naso or oro pharyngeal swabs, and induced sputum, in cases) by multiple methods viz. culture and PCR. Cases were those hospitalized with WHO defined severe pneumonia and controls were age-frequency matched children (healthy as well as those with non-pneumonia respiratory symptoms). Numerous methodological refinements were introduced to enhance validity of the study including efforts to standardize definitions [39], clinical methods, sample collection [40, 41], laboratory methods [42, 43] and chest radiography (performance and interpretation) [44]. Additional refinements included documenting and studying the effect of prior antibiotic therapy (and also the volume of blood drawn), on bacterial culture results [45, 46]; the relationship between bacterial density in the upper airway and blood culture [47, 48]; and correlation of viral load in the upper airway with pneumonia [49]. In addition, tremendous emphasis has been given to appropriate data management, quality control, data analysis and interpretation [50–53]. These resource intensive (in terms of time, manpower and materials) efforts; foster the assurance of high internal and external validity of the results. A summary of the main results reported till date is shown in Table 3. However, so far the PERCH study has not reported the central question of pneumonia etiology.Table 3 Salient results available from the PERCH study till August 2017
) efforts; foster the assurance of high internal and external validity of the results. A summary of the main results reported till date is shown in Table 3. However, so far the PERCH study has not reported the central question of pneumonia etiology.Table 3 Salient results available from the PERCH study till August 2017 •PERCH enrolled 4232 cases and 5325 controls from nine sites in seven developing countries. The controls included healthy children as well as those with respiratory symptoms not fulfilling the definition of pneumonia [54]. •Serum bioassay confirmed prior antibiotic use in over 25% cases and 2.3% controls. Evaluation through combined assessment of history, referral document and bioassay, identified prior antibiotic use in 43.5% cases [45]. •Prior antibiotic exposure reduced the probability of detecting most bacteria (by culture and PCR), although the effect on S. aureus was unclear [45]. •The volume of blood obtained for culture showed a direct relationship with isolation of bacteria; with highest yield when >4 ml was taken. This effect was consistent for children with and without prior receipt of antibiotics [45]. •S. pneumoniae was identified by culture of blood, pleural fluid, or lung aspirate in only 56 cases. However none of the 4 sites in Asia had a single culture-proven case despite the absence of a Pneumococcal vaccination programme [47]. •S. pneumoniae PCR in blood was positive in 291/3995 (7.3%) cases and also 273/4987 (5.5%) controls. However, only 36 of 56 (64.3%) cases with culture confirmed Pneumococcal bacteremia, were PCR positive. In fact, 243/3832 (6.3%) children without confirmed bacterial infection also were PCR positive. These data suggest that blood PCR may not be a suitable test in Pneumococcal pneumonia [55]. •Quantitative PCR for Pneumococcus in naso/oro pharyngeal samples showed significantly higher load in cases with culture-proven Pneumococcus (n = 56), compared to cases without Pneumococcus, as well as controls. However, cut-off value >6.9 log10 copies/mL to distinguish confirmed Pneumococcal cases vs. controls had sensitivity 64% and specificity 92% [47]. •Although quantitative load of Pneumococcus (determined by PCR) was higher in culture positive cases than controls, significant overlap precluded accurate differentiation, confirming the limited utility of quantitative Pneumococcal PCR in blood for diagnosing Pneumococcal pneumonia [56]. •There were only 52 microbiologically confirmed cases with any of the following organisms: H.
) was higher in culture positive cases than controls, significant overlap precluded accurate differentiation, confirming the limited utility of quantitative Pneumococcal PCR in blood for diagnosing Pneumococcal pneumonia [56]. •There were only 52 microbiologically confirmed cases with any of the following organisms: H. influenzae, M. catarrhalis, S. aureus, or P. jirovecii. Only 2 of these were from the 4 Asian sites. Quantitative PCR of naso/oro pharyngeal samples could not reliably distinguish between culture confirmed cases vs. controls [48]. •Almost 90% cases and 80% controls had at least one of the 17 viruses tested for by multiplex PCR in nasopharyngeal/oropharyngeal samples; the respective proportions for 2 viruses were 53% and 40%; and for >3 viruses were 18% and 12% [58]. •Quantitative estimation of viral load in nasopharyngeal/oropharyngeal samples showed considerable overlap between radiographically confirmed cases and controls. Children with very severe pneumonia and those who died did not have higher viral loads. These findings suggest that quantitative PCR for viruses may not be discriminatory [58]. •The yield of bacteria and viruses by PCR of induced sputum samples was comparable to that obtained by PCR of naso/oropharyngeal specimens. Quantitative analysis did not provide additional information [57]. •Bordetella pertussis was detected in 53/ 4200 (1.3%) cases and 11/ 5196 (0.2%) controls in naso/oro pharyngeal aspirates, suggesting a possible role in pneumonia. There was disproportionately high mortality among cases [59]. •Nineteen hundred thirty five of 3587 interpretable chest radiographs (54%) showed abnormality; although consolidation was seen in far fewer children, and there was significant variation across sites. Classic clinical signs of severe pneumonia (hypoxemia, fever, tachypnea, etc) were observed more frequently in those with radiographic abnormalities [60]. •CRP ≥40 mg/L was observed in 77% of 119 HIV-negative cases with bacterial pneumonia (defined by positive blood culture or positive lung aspirate or pleural fluid culture or PCR) compared with 17% of 556 RSV pneumonia cases (defined as nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia), suggesting utility for distinguishing bacterial vs. RSV-associated pneumonia, although not other viruses. However, 30% of 286 children with both bacteria and RSV also had CRP ≥40 mg/L [61].
ia cases (defined as nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia), suggesting utility for distinguishing bacterial vs. RSV-associated pneumonia, although not other viruses. However, 30% of 286 children with both bacteria and RSV also had CRP ≥40 mg/L [61]. •There were wide variations in the results obtained from the 9 sites with significant differences between sites in Asia compared to Africa [45, 47, 48, 55, 57, 60, 61]. •PERCH has developed a bio-repository of specimens for later testing [62].
ia cases (defined as nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia), suggesting utility for distinguishing bacterial vs. RSV-associated pneumonia, although not other viruses. However, 30% of 286 children with both bacteria and RSV also had CRP ≥40 mg/L [61]. •There were wide variations in the results obtained from the 9 sites with significant differences between sites in Asia compared to Africa [45, 47, 48, 55, 57, 60, 61]. •PERCH has developed a bio-repository of specimens for later testing [62]. Community Acquired Pneumonia Etiology Study (CAPES) None of the PERCH sites was located in India. However, India reportedly contributes the largest number of childhood pneumonia cases; and greatest mortality with over 400,000 childhood deaths in the under-five age group [63–67]. Further, India has been under tremendous global pressure to initiate the administration of Pneumococcal Conjugate Vaccine (PCV) in the routine immunization programme, although the scientific rationale and evidence base are controversial [68–71]. Despite this, none of the numerous Indian studies on childhood pneumonia etiology have been designed to address the challenges presented in Table 2. Therefore, the Community Acquired Pneumonia Etiology Study (CAPES) was initiated at PGIMER Chandigarh in 2010, in collaboration with Karolinska Institute, Stockholm [72]. The study enrolled children (1 mo to 12 y) with pneumonia (WHO IMNCI criteria) identified through active surveillance in the community and passive surveillance in the hospital (out-patient department as well as Emergency); over a period from April 2011 through December 2014. Overall, approximately 46,000 children were screened and over 4000 enrolled, making it one of the world’s largest single-centre studies on pneumonia etiology. Children who had received antibiotics for more than 24 h at presentation were excluded. The laboratory tests included blood and nasopharyngeal aspirate (NPA) bacterial cultures, and serology in duplicate for Mycoplasma pneumoniae and Chlamydophila pneumoniae. Multiplex PCR for 25 bacterial/viral species was undertaken in a subgroup selected to represent the entire cohort. In addition, children who required endotracheal intubation had bronchoalveolar lavage (BAL) specimens taken for culture and multiplex PCR. Thus this was a comprehensive study designed to determine microbial etiology. The salient results, conclusions, strengths and limitations (available from data published so far) are briefly presented in Table 4.Table 4 Salient findings, conclusions, strengths and limitations of the Community Acquired Pneumonia Etiology Study (CAPES)
a comprehensive study designed to determine microbial etiology. The salient results, conclusions, strengths and limitations (available from data published so far) are briefly presented in Table 4.Table 4 Salient findings, conclusions, strengths and limitations of the Community Acquired Pneumonia Etiology Study (CAPES) Salient findings
a comprehensive study designed to determine microbial etiology. The salient results, conclusions, strengths and limitations (available from data published so far) are briefly presented in Table 4.Table 4 Salient findings, conclusions, strengths and limitations of the Community Acquired Pneumonia Etiology Study (CAPES) Salient findings •Blood culture yielded organisms in approximately 2% children The most common organism isolated in blood was Staphyococcus aureus, not Streptococcus pneumoniae. •Gram negative bacilli (Klebsiella pneumoniae, Acinetobacter species, Salmonella typhi) together outnumbered Pneumococcal isolates. •Broncho-alveolar lavage culture done in a limited number of cases (but not at presentation) identified organisms in only 10%. •Corresponding PCR of BAL yielded organisms in 93% samples; however a single organism (bacteria or virus) was found in only 33%. The rest had multiple organisms in different combinations. •Nasopharyngeal aspirate culture was positive in only about 15% cases with S. pneumoniae predominating, followed by H. influenzae and S. aureus. •Multiplex PCR of nasopharyngeal aspirate samples yielded multiple bacteria and viruses. Only 1.4% children did not show any of the 25 species looked for. The majority (59%) had multiple organisms, making it impossible to attribute causality. •A single bacterial species was observed in only 9.8% cases; and a single virus identified in only 6.5% cases. •Surprisingly, cytomegalovirus (CMV) was the dominant isolate among viruses, followed by RSV, followed by Rhinovirus, Coronavirus, Parainfluenza virus, Influenza virus, etc. •The yield of bacteria on PCR of nasopharyngeal aspirates was several fold higher than culture (76% vs. 11% for S. pneumoniae; 31% vs. 1.3% for H. influenzae and 20% vs. 0.9% for S. aureus). •The patterns of distribution of organism classes was similar in children with non-severe, severe and very severe pneumonia. •The distribution of organisms in children who died was not significantly different from survivors. •Serology tests (done in duplicate) for M. pneumoniae and C. pneumoniae were positive in 4.3% and 1.1% respectively. •Even among cases with a single bacterial or viral isolate, analysis of various factors showed that it is impossible to predict bacterial vs. viral etiology at presentation.
tly different from survivors. •Serology tests (done in duplicate) for M. pneumoniae and C. pneumoniae were positive in 4.3% and 1.1% respectively. •Even among cases with a single bacterial or viral isolate, analysis of various factors showed that it is impossible to predict bacterial vs. viral etiology at presentation. Salient conclusions •Nasopharyngeal samples are inappropriate specimens to determine pneumonia etiology. •The presence of multiple organisms in the majority of broncho-alveolar lavage specimens (albeit taken during the course of illness, rather than presentation) precludes attribution of etiology in most cases. •It is difficult to determine whether detection of multiple potential pathogens, represents true mixed infection, or whether infection by one organism encourages a harmless colonizer to become pathogenic. •Blood culture has poor sensitivity for pneumonia etiology, but Staphylococcus aureus and Gram negative rods (neither targeted by current vaccines) are important pathogens. Salient strengths •Largest single-centre study of childhood pneumonia etiology •Recruitment of community and hospital cases. •Standard case definitions of pneumonia and pneumonia severity. •Standard reporting protocol for chest radiography. •Sample processing and testing were done in accredited laboratories in India. Salient limitations
Salient strengths •Largest single-centre study of childhood pneumonia etiology •Recruitment of community and hospital cases. •Standard case definitions of pneumonia and pneumonia severity. •Standard reporting protocol for chest radiography. •Sample processing and testing were done in accredited laboratories in India. Salient limitations •No tests were done to confirm antibiotic activity in serum; hence results could not be separately analyzed in children with and without prior antibiotic therapy. •Multiplex PCR could be undertaken in only a subgroup of children representing the whole cohort (on account of financial constraints). •Serotyping of bacteria (especially S. pneumoniae) could not be undertaken due to financial constraints. •Broncho-alveolar lavage was not performed at presentation (in accordance with the institutional protocol); further doing it in intubated children creates the risk of detecting hospital acquired colonization/infection. •Lung aspirates were not performed. •PCR testing was qualitative, and not quantitative (although the limits of detection for each organism were pre-specified). •Analysis of results, by chest radiograph findings is pending.
it in intubated children creates the risk of detecting hospital acquired colonization/infection. •Lung aspirates were not performed. •PCR testing was qualitative, and not quantitative (although the limits of detection for each organism were pre-specified). •Analysis of results, by chest radiograph findings is pending. The challenge of distinguishing nasopharyngeal colonizing organisms from pneumonia causing pathogens has plagued pneumonia etiology researchers worldwide. In order to better understand the timing and patterns of nasopharyngeal colonization in Indian infants, a longitudinal study was initiated at PGIMER Chandigarh. A cohort of 100 infants was enrolled at birth and nasopharyngeal aspirate samples obtained. The infants were serially followed till 2 y of age (6 visits coinciding with vaccination). At each visit, history of respiratory tract infection (personal and family members) in the preceding two weeks was obtained. Those who were free of symptoms and signs for the preceding 14 d underwent nasopharyngeal aspirate analysis by bacterial culture and viral multiplex PCR. The data are being analysed, but preliminary results suggest early colonization (in some cases at birth) with a wide array of bacteria and viruses; dynamic pattern of organisms, and no relationship to recent (i.e., >14 d) upper respiratory tract infection in the infants or family members. This suggests a dynamic microbiome that could impact on the microbial etiology in the event of lower respiratory tract infections.
rth) with a wide array of bacteria and viruses; dynamic pattern of organisms, and no relationship to recent (i.e., >14 d) upper respiratory tract infection in the infants or family members. This suggests a dynamic microbiome that could impact on the microbial etiology in the event of lower respiratory tract infections. In order to further address some of the limitations of CAPES, a smaller prospective study (CAPES 2) was undertaken at PGIMER Chandigarh (during 2015–16) wherein only children with severe pneumonia who had received no prior antibiotics were enrolled. In addition to blood and nasopharyngeal aspirate samples, sputum, induced sputum, and where applicable, pleural fluid samples were obtained. In children with non-resolution of symptoms within 72 h, broncho-alveolar lavage, and lung aspirate specimens were obtained. Postmortem lung aspirates were also drawn. The samples were processed for bacterial culture and viral analysis by multiplex PCR (21 organisms), in addition to selected serological tests for atypical organisms. Preliminary analysis provides a rich pool of data. Blood and nasopharyngeal aspirate culture were positive in 4% and 39% cases respectively (compared to 2% and 11% in CAPES), confirming the adverse impact of even <24 h antibiotic intake prior to presentation. BAL culture was positive in about one third of specimens, but Acinetobacter dominated, raising the dilemma whether this was acquired before or after hospitalization. Lung aspirates obtained in non-responsive children gave a poor yield of bacteria on culture, but several viruses could be identified by PCR. As expected, a plethora of viruses was identified by PCR of nasopharyngeal aspirates, but the same problems in attributing etiology were encountered. Additional analysis of the data from this cohort are underway.
sponsive children gave a poor yield of bacteria on culture, but several viruses could be identified by PCR. As expected, a plethora of viruses was identified by PCR of nasopharyngeal aspirates, but the same problems in attributing etiology were encountered. Additional analysis of the data from this cohort are underway. In 2012–13, the Indian Council of Medical Research (ICMR) took cognizance of the importance of pneumonia etiology in India, and the ongoing CAPES project; and decided to initiate a multi-centric study across India for confirmation of microbial etiology. Five institutions were selected (CMC Vellore, PGIMER Chandigarh, KGMU Lucknow, KEM Pune and NICED Kolkata) to contribute cases (community and hospital based) and controls. A detailed project protocol has been prepared with emphasis on case definitions, clinical protocol, sampling scheme (in cases and controls), laboratory testing (including culture, PCR and advanced molecular techniques). Funding was recently secured and the study is expected to be in initiated in late 2017.
nd controls. A detailed project protocol has been prepared with emphasis on case definitions, clinical protocol, sampling scheme (in cases and controls), laboratory testing (including culture, PCR and advanced molecular techniques). Funding was recently secured and the study is expected to be in initiated in late 2017. The findings from CAPES and other studies clearly suggest that there are wide variations in the clinical presentation, course and outcome of children with pneumonia even when the same limited set of organisms are identified from diverse specimens and using various processing methods. This raises the question whether microbes alone (singly or in combination) can be held responsible for pneumonia. It is of course well known that environmental factors such as nutritional status, living conditions, gestational age, breastfeeding patterns etc., influence the occurrence, course and outcome of pneumonia in individual cases and the community. However, it is also possible that host responses to colonization, and/or infection could account for individual variations in the course and outcome. In a representative subgroup of the CAPES cohort, we were able to evaluate a panel of 21 cytokines/ chemokines with the aim of identifying signatures that could serve as potential biomarkers of pneumonia severity [73]. This is probably the largest panel of potential biomarkers studied in a single cohort. There were significant differences in the levels of 5 of the 21 chemokines between children with severe vs. non-severe pneumonia, at the time of presentation. Likewise, children who died showed significant differences from survivors in the levels of four chemokines. However, none of these could act as a reliable biomarker to predict either severity or outcome. We are planning additional studies when funding is available.
vs. non-severe pneumonia, at the time of presentation. Likewise, children who died showed significant differences from survivors in the levels of four chemokines. However, none of these could act as a reliable biomarker to predict either severity or outcome. We are planning additional studies when funding is available. Pneumonia Etiology Research: What is the Way Forward? Over the past few decades, pneumonia etiology research has witnessed a shift from studies that focused on specificity, in terms of definition of pneumonia (usually radiological evidence), specimen collection (generally lung aspiration in antibiotic naïve children), and processing (culture for bacteria and viruses); to the current focus on sensitivity (evidenced by a liberal clinical definition of pneumonia, surrogate specimens in the presence of prior antibiotic use, and molecular methods) thereby compromising specificity. This has thrown up a lot of data but the key issue of pin-pointing the etiology in individual cases is still elusive. Paradoxically a statement made 40 y ago, that “a wide variety of viruses and bacteria… are associated with respiratory tract infections, and no specific etiologic agent has been found in a significant proportion of patients” [74], appears true even today, but for entirely different reasons.
dual cases is still elusive. Paradoxically a statement made 40 y ago, that “a wide variety of viruses and bacteria… are associated with respiratory tract infections, and no specific etiologic agent has been found in a significant proportion of patients” [74], appears true even today, but for entirely different reasons. Considering this,what kind of pneumonia etiology studies should be undertaken? Data available so far suggest that any new pneumonia etiology study, should attempt to rectify (rather than replicate) the limitations described. Experts such as Shann insist that etiology in childhood pneumonia can be confirmed only through lung aspirate analysis in children who are antibiotic naïve [75]. However, personal experience confirms that it is not easy to convince research colleagues, ethics boards, and funding agencies (and not just children/families) for lung aspiration, given the small but definite risk of events such as pneumothorax, necessitating enhanced monitoring [17, 24]. In such a situation, bronchoscopic broncho-alveolar lavage specimens obtained at presentation in hospitalized children could be the ideal material. Bronchoscopy has the advantage of targeting the specific area(s) in the lung(s) that can be identified through digital radiography. In the hands of experienced clinicians, it is a safe procedure and can yield a wealth of data, not only for pathogen identification, but also host responses (through analysis of BAL cytology, cytokines, and chemokine fractions). Laboratory processing should continue to use traditional methods (especially bacterial culture) in addition to modern techniques. Naturally, a reasonably large sample size of cases would be required, making such a research study time-consuming and expensive.
nalysis of BAL cytology, cytokines, and chemokine fractions). Laboratory processing should continue to use traditional methods (especially bacterial culture) in addition to modern techniques. Naturally, a reasonably large sample size of cases would be required, making such a research study time-consuming and expensive. Etiology of Childhood Pneumonia: What Do We Need to Know? On the other hand, it can be argued that the wealth of data available from excellent studies across the globe, makes it clear that determination of microbial etiology in individual cases of pneumonia is a complex (perhaps impossible) task. Even the resource-intensive PERCH study has not so far been able to address the issue, despite complex statistical wizardry. It appears that we can at best identify patterns of organism distributions in communities that are epidemiologically heterogeneous in many respects. Therefore, it is doubtful if a whole country, or even a region within the country, will behave as a single epidemiologic unit. More likely, there will be wide variations even within defined geographic/ political boundaries. Against this backdrop, it is pertinent to wonder whether we really need to invest more (time, money, manpower and resources) to know the precise microbial etiology in individual pneumonia cases on a routine basis. Would it be enough if we could predict reasonably well the likelihood of bacterial (vs. viral or atypical infection) infection without actually identifying the organism in each case (exception being tuberculosis); and identify factors that predict adverse outcome (complications, non-response to therapy and mortality)? At a deeper level, why do micro-organism(s) with pathogenic potential create disease (with varying severities) in some children and leave others unaffected? In other words, should the emphasis of pneumonia etiology research shift from efforts to merely identify pathogens, to a more holistic approach that embraces the epidemiological triad comprising agent factors (i.e., what causes an organism to become pathogenic in individual children), host factors (both at the macro level such as putative risk factors as well as micro level such as individual immune/inflammatory responses) and environmental factors (again at the macro and micro levels); and the complex interplay among these?
i.e., what causes an organism to become pathogenic in individual children), host factors (both at the macro level such as putative risk factors as well as micro level such as individual immune/inflammatory responses) and environmental factors (again at the macro and micro levels); and the complex interplay among these? Compliance with Ethical Standards Conflict of Interest None. Source of Funding None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 6262231 BF02831327 10.1007/BF02831327 Symposium on Diarrheal Disorders Non bacterial gastroenteritis Steinhoff M. C. M.D., F.A.A.P. John T. Jacob F.R.C.P., Ph.D. grid.11586.3b0000000417678969Department of Child Health and Virology, Christian Medical College and Hospital, 632004 Vellore, 1980 47 4 317 320 Dr. K C Chaudhuri Foundation 1980This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Keywords GastroenteritisAcute GastroenteritisAcute DiarrheaRotaviral GastroenteritisNorwalk Virusissue-copyright-statement Dr. K C Chaudhuri Foundation 1980
Introduction Acute bronchiolitis is the most common lower respiratory tract infection in infants and young children, and one of the most common causes of hospital admission during infancy. The majority of children hospitalized for bronchiolitis are under the age of 6 mo [1]. It is known that acute bronchiolitis is predominantly a viral disease [2]. Almost 90% of cases are related to viruses such as respiratory syncytial virus (RSV), adenovirus, coronavirus, parainfluenza, influenza and rhinovirus. In recent years new human respiratory viruses like human metapneumovirus, bocavirus and new human corona viruses have been reported, as possible pathogens causing acute bronchiolitis [3]. Bordetella pertussis has also been identified in infants hospitalized with acute bronchiolitis, as a single or mainly co-pathogen with respiratory viruses [4–10].
iratory viruses like human metapneumovirus, bocavirus and new human corona viruses have been reported, as possible pathogens causing acute bronchiolitis [3]. Bordetella pertussis has also been identified in infants hospitalized with acute bronchiolitis, as a single or mainly co-pathogen with respiratory viruses [4–10]. In recent years, several studies have been published to assess Bordetella pertussis infection in infants hospitalized for various lower respiratory tract infections including acute bronchiolitis [4, 5, 8, 10]. In these studies, some impacts on the disease manifestation were observed in these infants admitted to pediatric wards or the pediatric intensive care unit. However, the clinical significance of Bordetella pertussis infection in infants with acute bronchiolitis has not been clearly defined. Therefore, the present study was planned to assess the frequency of Bordetella pertussis infection among infants aged <6 mo hospitalized for acute bronchiolitis and to determine whether Bordetella pertussis infection affects the clinical course of acute bronchiolitis.
h acute bronchiolitis has not been clearly defined. Therefore, the present study was planned to assess the frequency of Bordetella pertussis infection among infants aged <6 mo hospitalized for acute bronchiolitis and to determine whether Bordetella pertussis infection affects the clinical course of acute bronchiolitis. Material and Methods This prospective study was conducted in the Department of Pediatrics, Ege University Hospital (Turkey) between October 2013 and April 2016. Infants younger than 6 mo of age, who were hospitalized for acute bronchiolitis in the General Pediatrics ward of the hospital, were enrolled in the study. The Ethics Committee of the Ege University Hospital approved the study. A written informed consent was obtained from parents before enrolling infants. Acute bronchiolitis was defined as acute lower respiratory illness characterized by rhinorrhea, cough, and diffuse wheezes or crackles [11]. Previously healthy infants <6 mo of age, who presented with ≤4 d duration of acute bronchiolitis were included in the study. Infants who were hospitalized within 2 wk before the current admission, those who developed nosocomial acute bronchiolitis, or those who had a known history of bronchopulmonary dysplasia or chronic lung disease or congenital heart disease or any immunodeficiency were excluded.
bronchiolitis were included in the study. Infants who were hospitalized within 2 wk before the current admission, those who developed nosocomial acute bronchiolitis, or those who had a known history of bronchopulmonary dysplasia or chronic lung disease or congenital heart disease or any immunodeficiency were excluded. Detailed demographic, epidemiological and clinical data were recorded on admission and clinical and laboratory data were recorded from each child during the hospitalization. Epidemiological data included age, gender, number of siblings and smoke exposure. Pertussis vaccination status was obtained from the vaccination cards. Presence of characteristic clinical findings of pertussis (paroxysmal cough, whooping, post-tussive vomiting, apne) were recorded on a standard case report form for all patients. On admission, Wang clinical score (composite clinical score with respiratory rate, retraction, wheezing and general condition) was used for the assessment of the severity of acute bronchiolitis [12]. Each clinical sign was scored from zero to 3 except for the general condition, which was scored zero for normal and 3 for irritability or lethargy. The possible total score ranged from 0 to 12.
ory rate, retraction, wheezing and general condition) was used for the assessment of the severity of acute bronchiolitis [12]. Each clinical sign was scored from zero to 3 except for the general condition, which was scored zero for normal and 3 for irritability or lethargy. The possible total score ranged from 0 to 12. An overall disease severity score was also ascertained based on the following parameters: duration of hospital stay, duration of supplemental oxygen therapy, duration of intensive care unit and clinical severity score on admission as previously described by Bamberger et al. [13]. A nasopharyngeal aspirate was obtained from each infant within 24 h of admission and tested for the presence of respiratory syncytial virus (RSV), influenza virus type A and B, adenovirus, parainfluenza viruses (types 1–4), human rhinoviruses, human coronaviruses, human metapneumovirus and human bocavirus with real-time multiplex polymerase chain reaction (PCR) methods (RealAccurate®, Respiratory RT PCR, PathoFinder, Netherlands and Seeplex® RV15 ACEDetection, Seegene, South Korea).
A and B, adenovirus, parainfluenza viruses (types 1–4), human rhinoviruses, human coronaviruses, human metapneumovirus and human bocavirus with real-time multiplex polymerase chain reaction (PCR) methods (RealAccurate®, Respiratory RT PCR, PathoFinder, Netherlands and Seeplex® RV15 ACEDetection, Seegene, South Korea). A second nasopharyngeal sampling was taken easily from each patient by entering through nostrils and rotating the swabs that have flexible, twisted wire shafts with Dacron bud (Transwab, England). The samples were stored at −80 °C and were later analyzed at the bacteriology laboratory in the Department of Clinical Microbiology. Pertussis was diagnosed with quantitative multiplex real-time PCR technique which was used on nasopharyngeal samples to amplify targets IS481. Commercial kit (LightMix kits, TIB Molbiol, GmbH, Germany) was used and all the analyses were done by LightCycler 1.5 (Roche Diagnostics, USA). Statistical analysis was performed using SPSS version 21.0 for personal computers (Chicago, IL, USA). The infants were divided into two groups according to Bordetella pertussis (B. Pertussis) positive or B. pertussis-negative. The two groups were compared in terms of demographic, clinical and laboratory characteristics. Group differences in categorical data were analyzed using the Chi-square test. In cases of non-normally distributed data, the Mann-Whitney U test was used to determine whether the difference between the two groups was statistically significant. A value of p < 0.05 was considered as statistically significant.
teristics. Group differences in categorical data were analyzed using the Chi-square test. In cases of non-normally distributed data, the Mann-Whitney U test was used to determine whether the difference between the two groups was statistically significant. A value of p < 0.05 was considered as statistically significant. Results A total of 172 previously healthy infants <6 mo of age, who were hospitalized for acute bronchiolitis, were enrolled in the study. The mean age of the infants was 11.9 ± 6.5 wk (range 0–25 wk), and 103 (59.9%) were male. Fifty-two (30.2%) infants had received one dose of acellular pertussis vaccine, and 46 (26.7%) had received two doses. Seventy-four (43.1%) infants aged <2 mo were non-vaccinated. Bordetella pertussis was identified in 44 (25.6%) of the 172 infants hospitalized for acute bronchiolitis (Table 1). Of the 44 pertussis-positive infants, 27 (61.4%) co-infected with viral respiratory agents, 17 (38.6%) had only B. pertussis, as a sole pathogen. The most prevalent viral agent was RSV, detected in 88 (51.1%) infants with acute bronchiolitis. Among all RSV positive infants, 18.2% (16/88) had co-infection with pertussis. Demographic characteristics of infants with the positive pertussis-PCR and negative pertussis-PCR are shown in Table 2. Pertussis-positive infants were significantly younger than pertussis-negative infants (10 ± 5.5 wk vs. 12.5 ± 6.6 wk; p = 0.025). Pertussis-positive infants were not likely to have older siblings than pertussis-negative infants. Of the 44 pertussis-positive infants, 23 (52.3%) were non-vaccinated, 15 (34.1%) had received one dose of acellular pertussis vaccine, and 6 (13.6%) had received two doses of the vaccine. None of pertussis-positive infants had completed the primary pertussis vaccination series. Pertussis-PCR positivity was higher in infants who had received only one dose vaccine or who had been unvaccinated than those who had received two doses of the vaccine: 23 (31.1%) of the 74 unvaccinated infants and 15 (28.8%) of the 52 infants who had received one dose of acelluler pertussis vaccine were PCR-positive; while only 6 (13%) of the 46 infants who received two doses were pertussis positive (p = 0.029).Table 1 Respiratory pathogens identified in infants hospitalized with acute bronchiolitis (n = 172)
cinated infants and 15 (28.8%) of the 52 infants who had received one dose of acelluler pertussis vaccine were PCR-positive; while only 6 (13%) of the 46 infants who received two doses were pertussis positive (p = 0.029).Table 1 Respiratory pathogens identified in infants hospitalized with acute bronchiolitis (n = 172) n (%) Co-infection with B. pertussis, n (%) Respiratory syncytial virus 88 (51.1) 16 (18.2) Rhinovirus 55 (31.9) 11 (20.0) Bordetella pertussis 44 (25.6) – Parainfluenza virus 15 (8.7) 1 (6.6) Influenza virus 9 (5.2) 2 (22.2) Adenovirus 8 (4.6) 4 (50.0) Human metapnomovirus 7 (4.0) 2 (28.5) Human bocavirus 7 (4.0) 3 (42.8) Human coronovirus 5 (3.5) – B. Pertussis Bordetella pertussis Table 2 Comparison of demographic characteristics and vaccination status of infants hospitalized with acute bronchiolitis: Pertussis-positive vs. pertussis-negative infants B. pertussis-positive (n = 44) B. pertussis-negative (n = 128) p Age, weeks (mean ± SD) 10 ± 5.5 12.5 ± 6.7 0.025 Gender, n (%) Male 22 (50) 81 (63.2) 0.12 Female 22 (50) 47 (36.8) Number of siblings, n (mean ± SD) 2.07 ± 0.9 2.05 ± 0.9 0.93 Number of people in the house, n (mean ± SD) 4.25 ± 1.8 4.54 ± 1.5 0.34 Vaccination status, n (%) 0 dose 23 (31.1) 51 (68.9) 0.029 1 dose 15 (28.8) 37 (71.2) 2 doses 6 (13) 40 (87) B. pertussis Bordetella pertussis
Age, weeks (mean ± SD) 10 ± 5.5 12.5 ± 6.7 0.025 Gender, n (%) Male 22 (50) 81 (63.2) 0.12 Female 22 (50) 47 (36.8) Number of siblings, n (mean ± SD) 2.07 ± 0.9 2.05 ± 0.9 0.93 Number of people in the house, n (mean ± SD) 4.25 ± 1.8 4.54 ± 1.5 0.34 Vaccination status, n (%) 0 dose 23 (31.1) 51 (68.9) 0.029 1 dose 15 (28.8) 37 (71.2) 2 doses 6 (13) 40 (87) B. pertussis Bordetella pertussis There were no differences between pertussis-positive and pertussis-negative infants in terms of clinical and laboratory findings (Table 3). Paroxysmal coughing spells were present in 38.6% of pertussis-positive infants compared with 34.4% of pertussis-negative infants (p = 0.61). Of the pertussis-positive infants, 9.1% suffered from prolonged cough vs. 8.6% of the pertussis-negative infants (p = 0.92). Frequency of whooping cough, post-tussive vomiting and apnea episodes were also not significantly different between the two groups. Pertussis was clinically suspected in only 7 (15.9%) of the 44 infants who were found positive for pertussis by PCR. There was no statistically significant difference between pertussis-positive and pertussis negative infants according to the Wang clinical score at admission (4.9 ± 1.5 vs. 5.2 ± 2.5, p = 0.689). Wheezing was present in 47.7% (21/44) of pertussis-positive infants compared with 48.4% (62/128) of pertussis-negative infants (p = 0.935). Oxygen saturation was also similar in the two groups (95.6 ± 3.8 vs. 94.0 ± 4.8, p = 0.066).Table 3 Comparison of clinical and laboratory findings in pertussis-positive vs. pertussis-negative infants
t in 47.7% (21/44) of pertussis-positive infants compared with 48.4% (62/128) of pertussis-negative infants (p = 0.935). Oxygen saturation was also similar in the two groups (95.6 ± 3.8 vs. 94.0 ± 4.8, p = 0.066).Table 3 Comparison of clinical and laboratory findings in pertussis-positive vs. pertussis-negative infants B. pertussis-positive (n = 44) B. pertussis-negative (n = 128) p value Clinical characteristics Paroxysmal cough, n (%) 17 (38.6) 44 (34.4) 0.610 Whooping, n (%) 13 (29.5) 35 (27.3) 0.779 Post tussive vomiting, n (%) 15 (34.1) 31 (24.2) 0.202 Apnea, n (%) 7 (15.9) 17 (13.3) 0.403 Prolonged cough (>14 d), n (%) 4 (9.1) 11 (8.6) 0.92 Wheezing, n (%) 21 (47.7) 62 (48.4) 0.935 Oxygen saturation %, mean ± SD 95.6 ± 3.8 94.0 ± 4.8 0.066† Fever >38 °C, n (%) 6 (13.6) 21 (16.4) 0.663 Wang clinical score at admission, mean ± SD 4.9 ± 1.5 5.2 ± 2.5 0.689† Duration of hospitalizition, mean ± SD 5.0 ± 1.9 5.8 ± 2.5 0.095† Supplemental oxygen therapy, n (%) 12 (27.3) 33 (25.8) 0.846 Duration of oxygen therapy, days, mean ± SD 0.6 ± 1.0 1.1 ± 1.8 0.202† Number of infants who required intensive care unit, n (%) – 1 (0.78) Overall disease severity score, mean ± SD 6.5 ± 1.4 6.9 ± 1.6 0.095† Laboratory findings White blood cell/mm3, mean ± SD 10,430 ± 2700 10,360 ± 4200 0.370† Lymphocytes/mm3, mean ± SD 7180 ± 1650 5420 ± 1650 0.137† C-reactive protein, mg/dl, mean ± SD 0.6 ± 0.8 0.8 ± 1.4 0.306† † Mann-Whitney U test, B. pertussis Bordetella pertussis
e severity score, mean ± SD 6.5 ± 1.4 6.9 ± 1.6 0.095† Laboratory findings White blood cell/mm3, mean ± SD 10,430 ± 2700 10,360 ± 4200 0.370† Lymphocytes/mm3, mean ± SD 7180 ± 1650 5420 ± 1650 0.137† C-reactive protein, mg/dl, mean ± SD 0.6 ± 0.8 0.8 ± 1.4 0.306† † Mann-Whitney U test, B. pertussis Bordetella pertussis The overall disease severity score was also similar between the two groups (6.5 ± 1.4 vs. 6.9 ± 1.6; p = 0.095) (Table 3). The duration of hospital stay, the need or duration of supplemental oxygen and the need of intensive care treatment for the infants with pertussis were not significantly different to those with viral bronchiolitis. Only one pertussis-negative infant required transfer to the intensive care unit.
6; p = 0.095) (Table 3). The duration of hospital stay, the need or duration of supplemental oxygen and the need of intensive care treatment for the infants with pertussis were not significantly different to those with viral bronchiolitis. Only one pertussis-negative infant required transfer to the intensive care unit. Discussion Several studies have reported that pertussis was diagnosed by PCR in 7–23% of infants admitted to hospital with various respiratory tract infections including acute bronchiolitis and 36–67% of the pertussis cases were mixed infections with RSV or other respiratory viruses [4, 5, 7–10, 14]. On the other hand, a study found only 1 of 166 children admitted to the hospital during RSV season was B. pertussis positive by PCR [6]. Another study found no B. pertussis positive cases by PCR in 204 infants aged <18 mo with bronchiolitis [15]. In the index study, however, 25.5% of young infants aged <6 mo hospitalized with acute bronchiolitis had a positive pertussis PCR and nearly two-thirds of the pertussis-positive infants were co-infected with respiratory viruses such as RSV. These findings indicate that pertussis respiratory virus co-infection is common in young infants hospitalized for acute bronchiolitis, which is in agreement with several studies [4, 5, 7–9].
tive pertussis PCR and nearly two-thirds of the pertussis-positive infants were co-infected with respiratory viruses such as RSV. These findings indicate that pertussis respiratory virus co-infection is common in young infants hospitalized for acute bronchiolitis, which is in agreement with several studies [4, 5, 7–9]. Pertussis is a vaccine-preventable disease. However, even if the first dose of the pertussis vaccine provides partial protection, full infant protection may not be achieved until after the completion of primary vaccination at 6 mo [16]. Acceptable immunity against pertussis is accomplished one month after the third dose of the vaccine [17]. Thus, unvaccinated or incompletely vaccinated young infants are highly susceptible to pertussis. In the index study, the majority of the pertussis-positive infants were unvaccinated or had received only one dose of acellular pertussis vaccine. None of the infants had completed the primary pertussis vaccination series. This may explain the high prevalence of B. pertussis in the present study group. Moreover, the prevalence of pertussis was higher in infants who had been unvaccinated (31.1%) or who had received only one dose vaccine (28.8%) than those who had received two doses of the vaccine (13%).
imary pertussis vaccination series. This may explain the high prevalence of B. pertussis in the present study group. Moreover, the prevalence of pertussis was higher in infants who had been unvaccinated (31.1%) or who had received only one dose vaccine (28.8%) than those who had received two doses of the vaccine (13%). Pertussis is underdiagnosed, especially in young infants hospitalized with lower respiratory tract infection [5, 7, 9]. In fact, in the present study, pertussis was clinically suspected in only 16% of the infants with acute bronchiolitis, who proved to be B. pertussis positive by PCR. The present study also shows that the viral bronchiolitis and pertussis cases could not be separated by clinical or non-specific laboratory findings. Some studies reported that infants who were pertussis-positive had paroxysmal cough and whooping cough episodes more often than infants who were pertussis-negative, which concluded that paroxysmal cough and whooping are important clinical signs for the diagnosis of pertussis [5, 10]. In the index study, however, most pertussis-positive infants presented no paroxysmal cough or whooping episodes. These findings suggest that the lack of paroxysmal cough or whooping cough is not sufficient enough to exclude the diagnosis of pertussis in young infants hospitalized with acute bronchiolitis, in agreement with several studies [7–9, 14]. Also, the typical features of viral bronchiolitis, or even the detection of respiratory viruses such as RSV, do not rule out pertussis [5, 9, 10]. For example, wheezing did not distinguish viral bronchiolitis and pertussis [7]. In the present study, wheezing was presented in only half of infants in whom RSV and/or other respiratory viral agents were detected, whereas similarly nearly half of the pertussis-positive infants wheezed.
t rule out pertussis [5, 9, 10]. For example, wheezing did not distinguish viral bronchiolitis and pertussis [7]. In the present study, wheezing was presented in only half of infants in whom RSV and/or other respiratory viral agents were detected, whereas similarly nearly half of the pertussis-positive infants wheezed. The clinical significance of B. pertussis infection in infants with acute bronchiolitis has not been clearly defined. Co-infection of B. pertussis with RSV was described to cause severe infections in 2 studies from the United States and Japan [18, 19]. However, newer studies by Greenberg et al. [5] and Crowcroft et al. [10] revealed that co-infection of pertussis and RSV did not adversely affect the outcome in patients admitted to the pediatric intensive care unit with various lower respiratory tract infections including acute bronchiolitis. Nuolivirta et al. [8] also suggests that there were no significant differences between B. pertussis positive and negative cases in the severity of the disease. A recent retrospective study from Israel by Abu Raya et al. [4] reported that young infants hospitalized with acute bronchiolitis in whom B. pertussis was detected had a milder disease severity at admission and during hospitalization than those in whom B. pertussis was not detected [4]. However, in the present prospective study which utilized the same disease severity scores with Abu Raya study, authors found that there were no significant differences in the severity scores at admission and during hospitalization for those with only viral infection compared with B. pertussis co-infection, and it is concluded that co-infection with pertussis did not affect the clinical outcome in infants hospitalized with acute bronchiolitis, which is in agreement with several other studies [5, 8, 10]. Nevertheless, early diagnosis and antibiotic treatment of pertussis is important because it is effective in eradicating B. pertussis from the nasopharynx, thus reducing the risk of transmission [20]. Otherwise, a missed diagnosis in pediatric wards or the pediatric intensive care units may lead to pertussis outbreaks among vulnerable young infants.
and antibiotic treatment of pertussis is important because it is effective in eradicating B. pertussis from the nasopharynx, thus reducing the risk of transmission [20]. Otherwise, a missed diagnosis in pediatric wards or the pediatric intensive care units may lead to pertussis outbreaks among vulnerable young infants. Conclusions Pertussis-respiratory virus co-infection is common in young infants hospitalized for acute bronchiolitis. There are no consistent clinical criteria to distinguish pertussis concomitant with a viral bronchiolitis. The lack of paroxysmal cough or whooping does not rule out the diagnosis of pertussis. The detection of respiratory viruses, such as RSV, also does not rule out pertussis. To avoid underdiagnosis and to prevent possible pertussis outbreaks among vulnerable infants, pediatricians should be aware of these facts and should proceed with their diagnostic effort in order to detect pertussis in young infants hospitalized with acute bronchiolitis. The authors would like to thank the study staff at the Microbiology Laboratory for conducting the study, and the infants and their families for participating in the study. Contributions All the authors were involved in screening and management of cases. SG analyzed and drafted the manuscript. ZK and SSA critically reviewed and finalized the manuscript. ZK will act as guarantor for this paper.
The authors would like to thank the study staff at the Microbiology Laboratory for conducting the study, and the infants and their families for participating in the study. Contributions All the authors were involved in screening and management of cases. SG analyzed and drafted the manuscript. ZK and SSA critically reviewed and finalized the manuscript. ZK will act as guarantor for this paper. Compliance with Ethical Standards Ethical Approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or National Research Committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. The local ethics committee approved this study (reference number B.30.2.EGE.0.20.05.00/OY/1153/457). Conflict of Interest None. Source of Funding None.
Sir, I read the recent publication on pandemic H1N1 2009 in neonates with a great interest. Hon et al. concluded that “Emergency room and frontline staff must be vigilant of the non-specific clinical features of infections with respiratory viruses in the neonates so that prompt triage and isolation can be implemented to avoid outbreaks in the neonatal service [1].” Of the studied cases, there was no pandemic H1N1 2009 in this series [1]. I agree that the pandemic H1N1 2009 can be a serious infection among neonate but the null prevalence in this report might imply some clinical importance. It is still a myth whether neonate has some specific mechanism that brings resistance to infection. In the series of infection in pregnant subjects, the transmission to the child is very low [2]. Indeed, the first case report of neonatal pneumonia has just been published in July 2010 [3]. References 1. Hon KL, Cheung KL, Wong W, Ng PC. Neonates Investigated for Influenza-Like Illness During the Outbreak of Pandemic H1N1 2009: Trivial Infections But Major Triage Implications. Indian J Pediatr. 2010 Sep 3. [Epub ahead of print] 2. Jamieson DJ, Honein MA, Rasmussen SA, et al. Novel Influenza A (H1N1) Pregnancy Working Group. H1N1 2009 influenza virus infection during pregnancy in the USA. Lancet. 2009;374:451–8. 3. Sert A, Yazar A, Odabas D, Bilgin H. An unusual cause of fever in a neonate: influenza A (H1N1) virus pneumonia. Pediatr Pulmonol. 2010;45:734–6. Author’s reply Sir,
2. Jamieson DJ, Honein MA, Rasmussen SA, et al. Novel Influenza A (H1N1) Pregnancy Working Group. H1N1 2009 influenza virus infection during pregnancy in the USA. Lancet. 2009;374:451–8. 3. Sert A, Yazar A, Odabas D, Bilgin H. An unusual cause of fever in a neonate: influenza A (H1N1) virus pneumonia. Pediatr Pulmonol. 2010;45:734–6. Author’s reply Sir, Professor Wiwanitkit’s comment that it is still a myth whether neonate has some specific mechanism that brings resistance to infection is interesting. In the cited series of infection in pregnant subjects, the 5 neonates, born between 27 and 36 wks gestation, were not infected by the H1N1 [1]. In a previous series of SARS-CoV (Severe Acute Respiratory Syndrome - Coronavirus) infection in pregnant women, infants born to mothers with the respiratory viral infection did not acquire the infection through vertical transmission [2]. The first case report of H1N1 neonatal pneumonia has been published [3]. I wonder if there are any more cases of neonatal H1N1 elsewhere in the world. We have since managed a dozen of neonates with RSV infections in the early months of 2010 but no H1N1 to date. These neonates did not require ICU support and were only managed symptomatically. 1. Shek CC, Ng PC, Fung GPG et al. Infants born to mothers with severe acute respiratory syndrome. Pediatrics 2003;112:e254–e256. 2. Jamieson DJ, Honein MA, Rasmussen SA et al. Novel Influenza A (H1N1) Pregnancy Working Group. H1N1 2009 influenza virus infection during pregnancy in the USA. Lancet 2009;374:451–8.
The first case report of H1N1 neonatal pneumonia has been published [3]. I wonder if there are any more cases of neonatal H1N1 elsewhere in the world. We have since managed a dozen of neonates with RSV infections in the early months of 2010 but no H1N1 to date. These neonates did not require ICU support and were only managed symptomatically. 1. Shek CC, Ng PC, Fung GPG et al. Infants born to mothers with severe acute respiratory syndrome. Pediatrics 2003;112:e254–e256. 2. Jamieson DJ, Honein MA, Rasmussen SA et al. Novel Influenza A (H1N1) Pregnancy Working Group. H1N1 2009 influenza virus infection during pregnancy in the USA. Lancet 2009;374:451–8. 3. Sert A, Yazar A, Odabas D, Bilgin H. An unusual cause of fever in a neonate: influenza A (H1N1) virus pneumonia. Pediatr Pulmonol 2010;45:734–6. Dr.Kam-Lun Ellis Hon Department of Pediatrics, The Chinese University of Hong Kong, 6/F, Clinical Sciences Building, Prince of Wales Hospital, Shatin, Hong Kong SAR, China. E-mail: ehon@hotmail.com
Introduction Infectious diseases are common in childhood. Acute respiratory tract infections are the most common cause with high mortality and complication rates. The most common agents for acute respiratory tract infection are viruses [1] and include respiratory syncytial virus (RSV), parainfluenza viruses (PIVs), influenza viruses (IFVs), enteroviruses (EVs), adenoviruses (ADVs), human rhinoviruses (HRVs), human metapneumovirus (hMPV) and human coronaviruses (HCoVs) 229E, OC43, NL63, and HKU1. Coronaviruses NL63, HKU1 and human bocavirus, WU and KI polyomaviruses are the other viruses that cause serious respiratory tract infections [2]. Although viruses are the most common causes of acute respiratory tract infections, main etiological diagnosis is often missed and unnecessary or inappropriate antibiotic use is seen in more than 50 % of acute respiratory tract infections worldwide [3]. This leads to development of serious outcomes such as high resistance rates or multidrug resistance along with drug side effects in the children infected with virus [3, 4]. There are many pathogens causing similar clinical manifestations suggestive of acute respiratory tract infection [3]. Group A beta hemolytic streptococcus (GAS) is the most frequent bacterial agent in the etiology of acute respiratory tract, accounting for 15–30 % of acute pharyngitis cases especially in the children [5]. Clinical manifestations of GAS respiratory tract infection are mostly presence of sore throat and fever and absence of cough [5]. Clinical manifestations like cough, nasal discharge, and diarrhea are more suggestive of viral causes [5]. Clinical differentiation between viral and bacterial etiology is important for performing appropriate laboratory test, treatment and follow-up. In the index study, the authors investigated clinical manifestations and laboratory tests of these two most common etiological causes seen in the children.
of viral causes [5]. Clinical differentiation between viral and bacterial etiology is important for performing appropriate laboratory test, treatment and follow-up. In the index study, the authors investigated clinical manifestations and laboratory tests of these two most common etiological causes seen in the children. The authors investigated the results of respiratory viral panel test (RVPT) (Mutiplex PCR panel) for the diagnosis of frequently isolated viral etiologic groups: RSV, PIVs, IFVs, ADVs, HRVs, hMPV and HCoVs with the results of rapid strep A (RSA) antigen detection test and throat culture test for the diagnosis of GAS. Material and Methods The authors retrospectively evaluated 1654 patients aged 0–16 y with clinical presentation of acute respiratory system infection such as: fever [>38 °C (tympanic)], nasal discharge, cough, rash, sore throat, hoarseness, hyperemia of oropharyngeal region, hyperemic and hypertrophic tonsils, retropharyngeal secretions who presented at Acibadem Maslak Hospital from February 2012 through January 2013. With these clinical findings RVPT, RSA and throat culture tests were performed. Admission date, date of birth, gender, complaints and season of infection were recorded. Tests and results were performed in SPSS database. In this study, NCSS (Number Cruncher Statistical System) 2007 Statistical Software (Utah, USA) package program was used for the statistical analysis.
Material and Methods The authors retrospectively evaluated 1654 patients aged 0–16 y with clinical presentation of acute respiratory system infection such as: fever [>38 °C (tympanic)], nasal discharge, cough, rash, sore throat, hoarseness, hyperemia of oropharyngeal region, hyperemic and hypertrophic tonsils, retropharyngeal secretions who presented at Acibadem Maslak Hospital from February 2012 through January 2013. With these clinical findings RVPT, RSA and throat culture tests were performed. Admission date, date of birth, gender, complaints and season of infection were recorded. Tests and results were performed in SPSS database. In this study, NCSS (Number Cruncher Statistical System) 2007 Statistical Software (Utah, USA) package program was used for the statistical analysis. During the evaluation of the study data, regarding the comparisons of descriptive statistical methods (frequency and percentage distribution) as well as qualitative data, Chi-square test and Fisher’s exact tests were used. Sensitivity, specificity, positive predictive value, negative predictive value and LR + (Likelihood Ratio) values were calculated for the reliability of diagnostic methods. The results obtained from the study were evaluated at a significance level of p < 0.05 and within 95 % confidence interval.
exact tests were used. Sensitivity, specificity, positive predictive value, negative predictive value and LR + (Likelihood Ratio) values were calculated for the reliability of diagnostic methods. The results obtained from the study were evaluated at a significance level of p < 0.05 and within 95 % confidence interval. Results RSA test, throat culture test and RVPT were performed in the patients presenting with symptoms of acute respiratory tract infection. The patients' gender, age, clinical signs (fever, cough, sore throat, headache, rash, nausea, vomiting, hoarseness, ear pain, abdominal pain and foot-knee-leg pain) and season of getting infected are shown in Table 1.Table 1 Distribution of patients according to the age group, gender, season of getting infected and complaints <2 y (N = 127) n(%) 2–6 y (N = 752) n(%) > 6 y (N = 775) n(%) P
Results RSA test, throat culture test and RVPT were performed in the patients presenting with symptoms of acute respiratory tract infection. The patients' gender, age, clinical signs (fever, cough, sore throat, headache, rash, nausea, vomiting, hoarseness, ear pain, abdominal pain and foot-knee-leg pain) and season of getting infected are shown in Table 1.Table 1 Distribution of patients according to the age group, gender, season of getting infected and complaints <2 y (N = 127) n(%) 2–6 y (N = 752) n(%) > 6 y (N = 775) n(%) P Gender Boy 56 (44.09) 343 (45.61) 360 (46.45) 0.886 Girl 71 (55.91) 409 (54.39) 415 (53.55) Season Winter 43 (33.86) 220 (29.26) 216 (27.87) 0.0001 Spring 38 (29.92) 298 (39.63) 381 (49.16) Summer 25 (19.69) 103 (13.70) 70 (9.03) Autumn 21 (16.54) 131 (17.42) 108 (13.94) Fever 82 (64.57) 555 (73.80) 485 (62.58) 0.0001 Cough 47 (37.01) 274 (36.44) 212 (27.35) 0.0001 Sore throat 5 (3.94) 182 (24.20) 342 (44.13) 0.0001 Foot-Knee-Leg pain 0 (0.00) 10 (1.33) 12 (1.55) 0.369 Headache 0 (0.00) 10 (1.33) 29 (3.74) 0.002 Nausea-Vomiting 6 (4.72) 27 (3.59) 42 (5.42) 0.228 Nasal discharge 10 (7.87) 60 (7.98) 53 (6.84) 0.684 Nasal congestion 1 (0.79) 8 (1.06) 9 (1.16) 0.928 Rash 10 (7.87) 31 (4.12) 27 (3.48) 0.069 Fatigue 0 (0.00) 7 (0.93) 16 (2.06) 0.063 Abdominal pain 0 (0.00) 15 (1.99) 21 (2.71) 0.137 Hoarseness 1 (0.79) 3 (0.40) 4 (0.52) 0.830 Ear pain 0 (0.00) 7 (0.93) 7 (0.90) 0.555
Nasal discharge 10 (7.87) 60 (7.98) 53 (6.84) 0.684 Nasal congestion 1 (0.79) 8 (1.06) 9 (1.16) 0.928 Rash 10 (7.87) 31 (4.12) 27 (3.48) 0.069 Fatigue 0 (0.00) 7 (0.93) 16 (2.06) 0.063 Abdominal pain 0 (0.00) 15 (1.99) 21 (2.71) 0.137 Hoarseness 1 (0.79) 3 (0.40) 4 (0.52) 0.830 Ear pain 0 (0.00) 7 (0.93) 7 (0.90) 0.555 Of the total patients, 45.9 % (n = 759) were girls and 54.1 % (n = 895) were boys. Patients were classified according to the age groups: < 2 y, between 2 and 6 y and >6 y. There was no difference between the age groups with respect to gender (p = 0.886) and no difference between the genders with respect to winter, spring, summer and autumn seasons (p = 0.808). RVPT and RSA tests were performed simultaneously in 10.3 % (n = 4) < 2-y-old, 53.8 % (n = 21) 2–6 y old and 35.9 % (n = 14) > 6-y-old. RVPT and throat culture tests were performed simultaneously in 18.6 % (n = 11) < 2-y-old, 52.5 % (n = 31) 2–6 y old and 28.8 % (n = 17) > 6-y-old children. Throat culture test and RSA test were performed simultaneously in 4.6 % (n = 22) < 2-y-old, 45.5 % (n = 218) 2–6 y old and 49.9 % (n = 239) > 6-y-old children. Distribution of the tests according to the age groups is shown in Table 2.Table 2 Distribution of the tests according to the age groups
17) > 6-y-old children. Throat culture test and RSA test were performed simultaneously in 4.6 % (n = 22) < 2-y-old, 45.5 % (n = 218) 2–6 y old and 49.9 % (n = 239) > 6-y-old children. Distribution of the tests according to the age groups is shown in Table 2.Table 2 Distribution of the tests according to the age groups Test <2 y n(%) 2–6 y n(%) >6 y n(%) Total Rapid Strep A Negative 62 (100.00) 456 (89.24) 413 (76.91) 931 (83.87) Positive 0 (0.00) 55 (10.76) 124 (23.09) 179 (16.13) Throat Culture Negative 52 (100.00) 374 (88.42) 330 (72.37) 756 (81.20) Positive 0 (0.00) 49 (11.58) 126 (27.63) 175 (18.80) Respiratory Viral Panel Negative 19 (39.58) 55 (62.50) 40 (72.73) 114 (59.69) Positive 29 (60.42) 33 (37.50) 15 (27.27) 77 (40.31)
931 (83.87) Positive 0 (0.00) 55 (10.76) 124 (23.09) 179 (16.13) Throat Culture Negative 52 (100.00) 374 (88.42) 330 (72.37) 756 (81.20) Positive 0 (0.00) 49 (11.58) 126 (27.63) 175 (18.80) Respiratory Viral Panel Negative 19 (39.58) 55 (62.50) 40 (72.73) 114 (59.69) Positive 29 (60.42) 33 (37.50) 15 (27.27) 77 (40.31) The number of tests performed due to the complaint of fever were higher in 2–6 y age group as compared to the patients in <2 y and >6 y age groups (p 0.0001). The number of tests performed due to the complaint of cough were less in >6 y age group as compared to <2-y-old and 2–6 y age groups (p 0.0001). The tests performed due to the complaint of sore throat were less in <2 y age group as compared to 2–6 y and >6 y age groups (p 0.0001). Also the number of tests performed due to the complaint of headache were higher in >6 y age group as compared to <2 y and 2–6 y age groups (p 0.002). No difference was observed between the number of tests performed in <2 y, 2–6 y and >6 y age groups due to the complaints of foot-knee-leg pain, nausea-vomiting, nasal discharge, nasal congestion, rash, fatigue, abdominal pain, hoarseness and ear pain (p > 0.05). Complaint of fever in the patients in whom the test was performed in the spring and winter months was found to be higher than those in whom the test was done in the summer and autumn months (p 0.005). Absence of cough in the patients in whom the test was performed in the spring and winter months was found to be higher than those in whom the test was performed in the summer and autumn months (p 0.0001). No difference was observed between distribution of presence of sore throat, headache, nasal congestion, rash, hoarseness and ear pain with respect to the winter, spring, summer and autumn seasons (p > 0.05). Presence of fatigue in the patients in whom the test was performed in the winter months was found to be higher than those in whom the test was performed in the summer, spring and autumn months (p 0.012).
congestion, rash, hoarseness and ear pain with respect to the winter, spring, summer and autumn seasons (p > 0.05). Presence of fatigue in the patients in whom the test was performed in the winter months was found to be higher than those in whom the test was performed in the summer, spring and autumn months (p 0.012). Positive RSA test was not observed in <2 y age group and the number of patients with positive RSA test was higher in >6 y age as compared to 2–6 y age group (p 0.0001). Positive throat culture test was not observed in <2 y age group and the number of patients with positive throat culture test were found to be higher in >6 y age group as compared to 2–6 y age group (p 0.0001). Number of patients with positive RVPT were higher in <2 y age group as compared to 2–6 y and >6 y age groups (p 0.002). Positive RSA test and throat culture test in the winter and spring months were higher than in summer and autumn months (p 0.001, p 0.008 respectively). Distributions of tests according to the complaints are shown in Table 3.Table 3 Distribution of tests according to the complaints
Positive RSA test was not observed in <2 y age group and the number of patients with positive RSA test was higher in >6 y age as compared to 2–6 y age group (p 0.0001). Positive throat culture test was not observed in <2 y age group and the number of patients with positive throat culture test were found to be higher in >6 y age group as compared to 2–6 y age group (p 0.0001). Number of patients with positive RVPT were higher in <2 y age group as compared to 2–6 y and >6 y age groups (p 0.002). Positive RSA test and throat culture test in the winter and spring months were higher than in summer and autumn months (p 0.001, p 0.008 respectively). Distributions of tests according to the complaints are shown in Table 3.Table 3 Distribution of tests according to the complaints Complaint Rapid Strep A test Throat Culture test Respiratory Viral Panel test n(%) n(%) n(%) Fever 816(73.5) 602(64.7) 140(73.3) Cough 332(29.9) 321(34.5) 96(50.3) Sore throat 363(32.7) 359(38.6) 21(11.0) Foot-Knee-Leg pain 14(1.3) 12(1.3) 0(0) Headache 29(2.6) 23(2.5) 1(0.5) Nausea-Vomiting 54(4.9) 33(3.5) 10(5.2) Nasal discharge 82(7.4) 82(8.8) 15(7.9) Nasal congestion 12(1.1) 8(0.9) 0(0) Rash 49(4.4) 35(3.8) 5(2.6) Fatigue 17(1.5) 13(1.4) 2(1.0) Abdominal pain 24(2.2) 15(1.6) 0(0) Hoarseness 3(0.3) 7(0.8) 0(0) Ear pain 6(0.5) 8(0.9) 0(0) No difference was observed between distribution of positive RVPT in winter, spring, summer and autumn season groups (p 0.135). The number of patients with RSA test (+) in >6 y age group were higher than those in RSA test (−) group (p 0.0001).
Complaint Rapid Strep A test Throat Culture test Respiratory Viral Panel test n(%) n(%) n(%) Fever 816(73.5) 602(64.7) 140(73.3) Cough 332(29.9) 321(34.5) 96(50.3) Sore throat 363(32.7) 359(38.6) 21(11.0) Foot-Knee-Leg pain 14(1.3) 12(1.3) 0(0) Headache 29(2.6) 23(2.5) 1(0.5) Nausea-Vomiting 54(4.9) 33(3.5) 10(5.2) Nasal discharge 82(7.4) 82(8.8) 15(7.9) Nasal congestion 12(1.1) 8(0.9) 0(0) Rash 49(4.4) 35(3.8) 5(2.6) Fatigue 17(1.5) 13(1.4) 2(1.0) Abdominal pain 24(2.2) 15(1.6) 0(0) Hoarseness 3(0.3) 7(0.8) 0(0) Ear pain 6(0.5) 8(0.9) 0(0) No difference was observed between distribution of positive RVPT in winter, spring, summer and autumn season groups (p 0.135). The number of patients with RSA test (+) in >6 y age group were higher than those in RSA test (−) group (p 0.0001). No difference was observed between distribution of gender of RSA test group (−) and rapid strep A test (+) groups (p 0.770). The number of patients with fever in the RSA test (+) group were higher than those in RSA test (−) group (p 0.022). The number of patients with cough in the RSA test (+) group were less than those in RSA test (−) group (p 0.001). The number of patients with sore throat in the RSA test (+) group were higher than those in RSA (−) group (p 0.0001). No difference was observed between distribution of foot-knee-leg pain, headache, nausea-vomiting, nasal discharge, nasal congestion, rash, fatigue, abdominal pain, hoarseness and ear pain in the RSA test (−) group and the RSA test (+) groups (p > 0.05).
No difference was observed between distribution of gender of RSA test group (−) and rapid strep A test (+) groups (p 0.770). The number of patients with fever in the RSA test (+) group were higher than those in RSA test (−) group (p 0.022). The number of patients with cough in the RSA test (+) group were less than those in RSA test (−) group (p 0.001). The number of patients with sore throat in the RSA test (+) group were higher than those in RSA (−) group (p 0.0001). No difference was observed between distribution of foot-knee-leg pain, headache, nausea-vomiting, nasal discharge, nasal congestion, rash, fatigue, abdominal pain, hoarseness and ear pain in the RSA test (−) group and the RSA test (+) groups (p > 0.05). In the >6 y age group number of patients with throat culture (+) were higher than those in throat culture (−) (p 0.0001). No difference was observed between distribution of gender in the throat culture (−) and the throat culture (+) groups (p 0.423). The number of patients with detection of infection in winter and spring months in the throat culture (+) group were higher than those in the throat culture (−) group (p 0.008). Presence of cough in the throat culture (+) group was less than the throat culture (−) group (p 0.001). Sore throat in the throat culture (+) group was higher than the throat culture (−) group (p 0.0001).
No difference was observed between distribution of gender in the throat culture (−) and the throat culture (+) groups (p 0.423). The number of patients with detection of infection in winter and spring months in the throat culture (+) group were higher than those in the throat culture (−) group (p 0.008). Presence of cough in the throat culture (+) group was less than the throat culture (−) group (p 0.001). Sore throat in the throat culture (+) group was higher than the throat culture (−) group (p 0.0001). No difference was observed between distribution of fever, foot-knee-leg pain, headache, nausea-vomiting, nasal discharge, nasal congestion, rash, fatigue, abdominal pain, hoarseness and ear pain in the throat culture (+) group and throat culture (−) groups (p > 0.05). Positive RSA test in the throat culture (+) group was higher than the throat culture (−) group (p 0.0001). In <2 y age group, number of patients with RVPT (+) were higher than those with RVPT (−) (p 0.002). No difference was observed between the distribution of gender in RVPT (−) and RVPT (+) groups (p 0.994). No difference was observed between distribution of season, fever, cough, sore throat, headache, nausea-vomiting, nasal discharge, rash and fatigue in RVPT (−) and RVPT (+) groups (p > 0.05).
In <2 y age group, number of patients with RVPT (+) were higher than those with RVPT (−) (p 0.002). No difference was observed between the distribution of gender in RVPT (−) and RVPT (+) groups (p 0.994). No difference was observed between distribution of season, fever, cough, sore throat, headache, nausea-vomiting, nasal discharge, rash and fatigue in RVPT (−) and RVPT (+) groups (p > 0.05). According to throat culture, specificity, sensitivity, positive predictive value, negative predictive value and LR(+) values of the results of RSA test were found to be 0.50, 0.98, 0.85, 0.88 and 20.83, respectively. In a patient positive with RSA test, the likelihood of positivity of throat culture is 20.83-fold higher than in a patient with negative RSA test. According to throat culture, specificity, sensitivity, positive predictive value, negative predictive value and LR(+) values of the results of RVPT were found to be 0.17, 0.64, 0.14, 0.87 and 0.46, respectively. In a patient positive with RVPT, the likelihood of positivity of throat culture is 0.46-fold higher than in a patient with negative RVPT (it is not successful since it is not more than 2).
, negative predictive value and LR(+) values of the results of RVPT were found to be 0.17, 0.64, 0.14, 0.87 and 0.46, respectively. In a patient positive with RVPT, the likelihood of positivity of throat culture is 0.46-fold higher than in a patient with negative RVPT (it is not successful since it is not more than 2). Discussion RVPT and RSA tests were performed simultaneously in 10.3 % (n = 4) < 2-y-old, 53.8 % (n = 21) 2–6 y old and 35.9 % (n = 14) > 6-y-old patients; RVPT and throat culture tests were performed simultaneously in 18.6 % (n = 11) < 2-y-old, 52.5 % (n = 31) 2–6 y old and 28.8 % (n = 17) > 6-y-old patients; throat culture test and RSA tests were performed simultaneously in 4.6 % (n = 22) < 2-y-old, 45.5 % (n = 218) 2–6 y old and 49.9 % (n = 239) > 6-y-old. It shows that according to the patient’s complaints, clinician could choose one or two tests for diagnosis. Viruses cause most common acute respiratory system infections but GAS causes 37 % of all cases of acute respiratory system infections in children older than 5 y. Streptococcal acute respiratory system infections have a peak incidence in the early school years and are uncommon before 3 y of age [6].
Discussion RVPT and RSA tests were performed simultaneously in 10.3 % (n = 4) < 2-y-old, 53.8 % (n = 21) 2–6 y old and 35.9 % (n = 14) > 6-y-old patients; RVPT and throat culture tests were performed simultaneously in 18.6 % (n = 11) < 2-y-old, 52.5 % (n = 31) 2–6 y old and 28.8 % (n = 17) > 6-y-old patients; throat culture test and RSA tests were performed simultaneously in 4.6 % (n = 22) < 2-y-old, 45.5 % (n = 218) 2–6 y old and 49.9 % (n = 239) > 6-y-old. It shows that according to the patient’s complaints, clinician could choose one or two tests for diagnosis. Viruses cause most common acute respiratory system infections but GAS causes 37 % of all cases of acute respiratory system infections in children older than 5 y. Streptococcal acute respiratory system infections have a peak incidence in the early school years and are uncommon before 3 y of age [6]. It was found that the ratio of the patients in whom the test was performed due to the complaint of fever was higher in 2–6 y age than the patients in <2 y and >6 y age groups. While the ratio of the patients in whom the test was performed due to the complaint of cough was significantly less in >6 y age group; the ratio of the patients in whom the test was performed due to the complaint of headache was higher in >6 y age group. The authors found that the number of patients in whom the test was performed due to the complaint of sore throat were less in <2 y age group as compared to those in >6 y age group. The ratio of patients with positive RSA test and positive throat culture test was higher in >6 y age group. Also the ratio of patients with complaint of cough and sore throat were low and high respectively in the patients with positive RSA and positive throat culture test. GAS is seen frequently during the winter and spring months especially in 5–15 y age groups [8]. The number of patients with positive GAS tests were higher in the winter and spring months. While viruses are responsible for 95 % cases of sore throat in <5 y age children, they are responsible for 70 % cases of sore throat in 5–15 y age group. The most common bacterial cause of sore throat is GAS. One-third cause of sore throat in children 5–15 y of age is GAS [9]. Absence of cough, headache, myalgia, fever >38 °C has sensitivity of 51–79 %, 48 %, 49 % and 22–58 % respectively for GAS respiratory system infections [6]. The clinical presentations of GAS and viral acute respiratory system infections show considerable overlap and no single element of the patient’s history or physical examination reliably confirms or excludes GAS acute respiratory system infection [6]. Most of the American authors suggest the necessity of microbiological confirmation for the diagnosis of GAS; clinical criteria can help a clinician to select patients who need to be tested [7].
ent of the patient’s history or physical examination reliably confirms or excludes GAS acute respiratory system infection [6]. Most of the American authors suggest the necessity of microbiological confirmation for the diagnosis of GAS; clinical criteria can help a clinician to select patients who need to be tested [7]. Also in the index study, the authors found the ratio of positive RSA test and throat culture test in the winter and spring months to be higher in >6 y age group. They found the ratio of positive RSA test and positive throat culture test in the summer, autumn months to be lower in >6 age group. While complaints of fever and sore throat are more suggestive of GAS infection, symptoms like cough, nasal discharge, diarrhea and conjunctivitis are suggestive of viral causes [5, 8, 9]. Complaints like headache, nausea, vomiting and abdominal pain may accompany GAS infection especially in the children [8]. In the index study, the authors found no difference between the distribution of nausea, vomiting, nasal discharge, nasal congestion, hoarseness, headache, foot-knee-leg pain, rash, fatigue, abdominal pain and ear pain in the groups with positive RSA test and positive throat culture test.
especially in the children [8]. In the index study, the authors found no difference between the distribution of nausea, vomiting, nasal discharge, nasal congestion, hoarseness, headache, foot-knee-leg pain, rash, fatigue, abdominal pain and ear pain in the groups with positive RSA test and positive throat culture test. It was observed that GAS infection is higher in >6 y age group and again in this age group complaints of fever and sore throat are at the forefront and complaint of cough is lower. The authors found the presence of positive RSA test in the group with positive throat culture to be higher than the group with negative throat culture test. They found no positive RSA test or throat culture test in children <2 y age group. GAS infection is not seen frequently in <3 y age group. However, the authors found positive RVPT to be higher in <2 y age group than in 2–6 y and >6 y age groups. No statistically significant difference was found between distribution of positive RVPT in the winter, spring, summer and autumn seasons. Viral infections may show seasonal variance and peaks. However, there is no certain information regarding seasonal distribution of viral infection; viral infections vary according to the seasons, trophic-nontrophic regions and geographic locations [10].
of positive RVPT in the winter, spring, summer and autumn seasons. Viral infections may show seasonal variance and peaks. However, there is no certain information regarding seasonal distribution of viral infection; viral infections vary according to the seasons, trophic-nontrophic regions and geographic locations [10]. No difference was found between the distribution of genders in the RVPT negative and RVPT positive groups. There was no difference between distribution of fever, cough, sore throat, headache, nausea-vomiting, nasal discharge, nasal congestion, rash and fatigue in the RVPT negative and RVPT positive groups. Although the complaints like fever, cough, nasal discharge and nasal congestion are suggestive of a viral etiology but they are not specific. Some clinical symptoms are non-specific and variable in viral infections [11]. Rapid and precise determination of viral etiology in a laboratory test is necessary to initiate appropriate antiviral therapy, reduce the requirement of additional diagnostic studies and to limit unnecessary use of antibiotics in clinical therapy and also helps in epidemiological evaluation [12]. Considering and verifying the viral etiology is important for the treatment and prevention or epidemiological tracking of the disease.
viral therapy, reduce the requirement of additional diagnostic studies and to limit unnecessary use of antibiotics in clinical therapy and also helps in epidemiological evaluation [12]. Considering and verifying the viral etiology is important for the treatment and prevention or epidemiological tracking of the disease. Currently, population of viral infection is changing and new viral agents causing serious infections are seen. According to the etiology, it is necessary to administer the required therapy to prevent the spread of the disease and to protect the patient. Also if the pathogen is viral, unnecessary antibiotherapy would be prevented. Conclusions In patients of <2 y age group with acute respiratory tract infection symptoms and presenting with any complaint, primarily a viral etiology should be considered and should not be hurried for antibiotherapy. Viral etiology should be investigated and if it is necessary, antiviral therapy should be administered and the necessary precautions should be taken according to the viral etiology to prevent the contamination. In the patients of >6 y age group presenting with complaints of presence of fever, sore throat and absence of cough, primarily GAS infection should be considered and it should be confirmed with rapid strep A test and/or throat culture test and antibiotherapy should not be delayed. Abbreviations GASGroup A beta hemolytic streptococcus RSVRespiratory syncytial virus vPIVsParainfluenza viruses IFVsInfluenza viruses EVsEnteroviruses ADVsAdenoviruses HRVsHuman rhinoviruses hMPVHuman metapneumovirus HCoVsHuman coronaviruses
Conclusions In patients of <2 y age group with acute respiratory tract infection symptoms and presenting with any complaint, primarily a viral etiology should be considered and should not be hurried for antibiotherapy. Viral etiology should be investigated and if it is necessary, antiviral therapy should be administered and the necessary precautions should be taken according to the viral etiology to prevent the contamination. In the patients of >6 y age group presenting with complaints of presence of fever, sore throat and absence of cough, primarily GAS infection should be considered and it should be confirmed with rapid strep A test and/or throat culture test and antibiotherapy should not be delayed. Abbreviations GASGroup A beta hemolytic streptococcus RSVRespiratory syncytial virus vPIVsParainfluenza viruses IFVsInfluenza viruses EVsEnteroviruses ADVsAdenoviruses HRVsHuman rhinoviruses hMPVHuman metapneumovirus HCoVsHuman coronaviruses Compliance with Ethical Standards Contributions RD: Conceptualized and designed the study, designed the data collection instruments and coordinated and supervised data collection and drafted the manuscript and approved the final manuscript. SK: Designed the study, coordinated and reviewed and revised the manuscript. RD will act as guarantor for this paper. Conflict of Interest None. Source of Funding None.
Introduction The 2019 novel coronavirus (2019-nCoV) or the severe acute respiratory syndrome corona virus 2 (SARS-CoV-2) as it is now called, is rapidly spreading from its origin in Wuhan City of Hubei Province of China to the rest of the world [1]. Till 05/03/2020 around 96,000 cases of coronavirus disease 2019 (COVID-19) and 3300 deaths have been reported [2]. India has reported 29 cases till date. Fortunately so far, children have been infrequently affected with no deaths. But the future course of this virus is unknown. This article gives a bird’s eye view about this new virus. Since knowledge about this virus is rapidly evolving, readers are urged to update themselves regularly. History Coronaviruses are enveloped positive sense RNA viruses ranging from 60 nm to 140 nm in diameter with spike like projections on its surface giving it a crown like appearance under the electron microscope; hence the name coronavirus [3]. Four corona viruses namely HKU1, NL63, 229E and OC43 have been in circulation in humans, and generally cause mild respiratory disease.
uses ranging from 60 nm to 140 nm in diameter with spike like projections on its surface giving it a crown like appearance under the electron microscope; hence the name coronavirus [3]. Four corona viruses namely HKU1, NL63, 229E and OC43 have been in circulation in humans, and generally cause mild respiratory disease. There have been two events in the past two decades wherein crossover of animal betacorona viruses to humans has resulted in severe disease. The first such instance was in 2002–2003 when a new coronavirus of the β genera and with origin in bats crossed over to humans via the intermediary host of palm civet cats in the Guangdong province of China. This virus, designated as severe acute respiratory syndrome coronavirus affected 8422 people mostly in China and Hong Kong and caused 916 deaths (mortality rate 11%) before being contained [4]. Almost a decade later in 2012, the Middle East respiratory syndrome coronavirus (MERS-CoV), also of bat origin, emerged in Saudi Arabia with dromedary camels as the intermediate host and affected 2494 people and caused 858 deaths (fatality rate 34%) [5].
aused 916 deaths (mortality rate 11%) before being contained [4]. Almost a decade later in 2012, the Middle East respiratory syndrome coronavirus (MERS-CoV), also of bat origin, emerged in Saudi Arabia with dromedary camels as the intermediate host and affected 2494 people and caused 858 deaths (fatality rate 34%) [5]. Origin and Spread of COVID-19 [1, 2, 6] In December 2019, adults in Wuhan, capital city of Hubei province and a major transportation hub of China started presenting to local hospitals with severe pneumonia of unknown cause. Many of the initial cases had a common exposure to the Huanan wholesale seafood market that also traded live animals. The surveillance system (put into place after the SARS outbreak) was activated and respiratory samples of patients were sent to reference labs for etiologic investigations. On December 31st 2019, China notified the outbreak to the World Health Organization and on 1st January the Huanan sea food market was closed. On 7th January the virus was identified as a coronavirus that had >95% homology with the bat coronavirus and > 70% similarity with the SARS- CoV. Environmental samples from the Huanan sea food market also tested positive, signifying that the virus originated from there [7]. The number of cases started increasing exponentially, some of which did not have exposure to the live animal market, suggestive of the fact that human-to-human transmission was occurring [8]. The first fatal case was reported on 11th Jan 2020. The massive migration of Chinese during the Chinese New Year fuelled the epidemic. Cases in other provinces of China, other countries (Thailand, Japan and South Korea in quick succession) were reported in people who were returning from Wuhan. Transmission to healthcare workers caring for patients was described on 20th Jan, 2020. By 23rd January, the 11 million population of Wuhan was placed under lock down with restrictions of entry and exit from the region. Soon this lock down was extended to other cities of Hubei province. Cases of COVID-19 in countries outside China were reported in those with no history of travel to China suggesting that local human-to-human transmission was occurring in these countries [9]. Airports in different countries including India put in screening mechanisms to detect symptomatic people returning from China and placed them in isolation and testing them for COVID-19.
ed in those with no history of travel to China suggesting that local human-to-human transmission was occurring in these countries [9]. Airports in different countries including India put in screening mechanisms to detect symptomatic people returning from China and placed them in isolation and testing them for COVID-19. Soon it was apparent that the infection could be transmitted from asymptomatic people and also before onset of symptoms. Therefore, countries including India who evacuated their citizens from Wuhan through special flights or had travellers returning from China, placed all people symptomatic or otherwise in isolation for 14 d and tested them for the virus.
on could be transmitted from asymptomatic people and also before onset of symptoms. Therefore, countries including India who evacuated their citizens from Wuhan through special flights or had travellers returning from China, placed all people symptomatic or otherwise in isolation for 14 d and tested them for the virus. Cases continued to increase exponentially and modelling studies reported an epidemic doubling time of 1.8 d [10]. In fact on the 12th of February, China changed its definition of confirmed cases to include patients with negative/ pending molecular tests but with clinical, radiologic and epidemiologic features of COVID-19 leading to an increase in cases by 15,000 in a single day [6]. As of 05/03/2020 96,000 cases worldwide (80,000 in China) and 87 other countries and 1 international conveyance (696, in the cruise ship Diamond Princess parked off the coast of Japan) have been reported [2]. It is important to note that while the number of new cases has reduced in China lately, they have increased exponentially in other countries including South Korea, Italy and Iran. Of those infected, 20% are in critical condition, 25% have recovered, and 3310 (3013 in China and 297 in other countries) have died [2]. India, which had reported only 3 cases till 2/3/2020, has also seen a sudden spurt in cases. By 5/3/2020, 29 cases had been reported; mostly in Delhi, Jaipur and Agra in Italian tourists and their contacts. One case was reported in an Indian who traveled back from Vienna and exposed a large number of school children in a birthday party at a city hotel. Many of the contacts of these cases have been quarantined.
By 5/3/2020, 29 cases had been reported; mostly in Delhi, Jaipur and Agra in Italian tourists and their contacts. One case was reported in an Indian who traveled back from Vienna and exposed a large number of school children in a birthday party at a city hotel. Many of the contacts of these cases have been quarantined. These numbers are possibly an underestimate of the infected and dead due to limitations of surveillance and testing. Though the SARS-CoV-2 originated from bats, the intermediary animal through which it crossed over to humans is uncertain. Pangolins and snakes are the current suspects.
By 5/3/2020, 29 cases had been reported; mostly in Delhi, Jaipur and Agra in Italian tourists and their contacts. One case was reported in an Indian who traveled back from Vienna and exposed a large number of school children in a birthday party at a city hotel. Many of the contacts of these cases have been quarantined. These numbers are possibly an underestimate of the infected and dead due to limitations of surveillance and testing. Though the SARS-CoV-2 originated from bats, the intermediary animal through which it crossed over to humans is uncertain. Pangolins and snakes are the current suspects. Epidemiology and Pathogenesis [10, 11] All ages are susceptible. Infection is transmitted through large droplets generated during coughing and sneezing by symptomatic patients but can also occur from asymptomatic people and before onset of symptoms [9]. Studies have shown higher viral loads in the nasal cavity as compared to the throat with no difference in viral burden between symptomatic and asymptomatic people [12]. Patients can be infectious for as long as the symptoms last and even on clinical recovery. Some people may act as super spreaders; a UK citizen who attended a conference in Singapore infected 11 other people while staying in a resort in the French Alps and upon return to the UK [6]. These infected droplets can spread 1–2 m and deposit on surfaces. The virus can remain viable on surfaces for days in favourable atmospheric conditions but are destroyed in less than a minute by common disinfectants like sodium hypochlorite, hydrogen peroxide etc. [13]. Infection is acquired either by inhalation of these droplets or touching surfaces contaminated by them and then touching the nose, mouth and eyes. The virus is also present in the stool and contamination of the water supply and subsequent transmission via aerosolization/feco oral route is also hypothesized [6]. As per current information, transplacental transmission from pregnant women to their fetus has not been described [14]. However, neonatal disease due to post natal transmission is described [14]. The incubation period varies from 2 to 14 d [median 5 d]. Studies have identified angiotensin receptor 2 (ACE2) as the receptor through which the virus enters the respiratory mucosa [11].
egnant women to their fetus has not been described [14]. However, neonatal disease due to post natal transmission is described [14]. The incubation period varies from 2 to 14 d [median 5 d]. Studies have identified angiotensin receptor 2 (ACE2) as the receptor through which the virus enters the respiratory mucosa [11]. The basic case reproduction rate (BCR) is estimated to range from 2 to 6.47 in various modelling studies [11]. In comparison, the BCR of SARS was 2 and 1.3 for pandemic flu H1N1 2009 [2].
egnant women to their fetus has not been described [14]. However, neonatal disease due to post natal transmission is described [14]. The incubation period varies from 2 to 14 d [median 5 d]. Studies have identified angiotensin receptor 2 (ACE2) as the receptor through which the virus enters the respiratory mucosa [11]. The basic case reproduction rate (BCR) is estimated to range from 2 to 6.47 in various modelling studies [11]. In comparison, the BCR of SARS was 2 and 1.3 for pandemic flu H1N1 2009 [2]. Clinical Features [8, 15–18] The clinical features of COVID-19 are varied, ranging from asymptomatic state to acute respiratory distress syndrome and multi organ dysfunction. The common clinical features include fever (not in all), cough, sore throat, headache, fatigue, headache, myalgia and breathlessness. Conjunctivitis has also been described. Thus, they are indistinguishable from other respiratory infections. In a subset of patients, by the end of the first week the disease can progress to pneumonia, respiratory failure and death. This progression is associated with extreme rise in inflammatory cytokines including IL2, IL7, IL10, GCSF, IP10, MCP1, MIP1A, and TNFα [15]. The median time from onset of symptoms to dyspnea was 5 d, hospitalization 7 d and acute respiratory distress syndrome (ARDS) 8 d. The need for intensive care admission was in 25–30% of affected patients in published series. Complications witnessed included acute lung injury, ARDS, shock and acute kidney injury. Recovery started in the 2nd or 3rd wk. The median duration of hospital stay in those who recovered was 10 d. Adverse outcomes and death are more common in the elderly and those with underlying co-morbidities (50–75% of fatal cases). Fatality rate in hospitalized adult patients ranged from 4 to 11%. The overall case fatality rate is estimated to range between 2 and 3% [2].
tion of hospital stay in those who recovered was 10 d. Adverse outcomes and death are more common in the elderly and those with underlying co-morbidities (50–75% of fatal cases). Fatality rate in hospitalized adult patients ranged from 4 to 11%. The overall case fatality rate is estimated to range between 2 and 3% [2]. Interestingly, disease in patients outside Hubei province has been reported to be milder than those from Wuhan [17]. Similarly, the severity and case fatality rate in patients outside China has been reported to be milder [6]. This may either be due to selection bias wherein the cases reporting from Wuhan included only the severe cases or due to predisposition of the Asian population to the virus due to higher expression of ACE2 receptors on the respiratory mucosa [11].
ality rate in patients outside China has been reported to be milder [6]. This may either be due to selection bias wherein the cases reporting from Wuhan included only the severe cases or due to predisposition of the Asian population to the virus due to higher expression of ACE2 receptors on the respiratory mucosa [11]. Disease in neonates, infants and children has been also reported to be significantly milder than their adult counterparts. In a series of 34 children admitted to a hospital in Shenzhen, China between January 19th and February 7th, there were 14 males and 20 females. The median age was 8 y 11 mo and in 28 children the infection was linked to a family member and 26 children had history of travel/residence to Hubei province in China. All the patients were either asymptomatic (9%) or had mild disease. No severe or critical cases were seen. The most common symptoms were fever (50%) and cough (38%). All patients recovered with symptomatic therapy and there were no deaths. One case of severe pneumonia and multiorgan dysfunction in a child has also been reported [19]. Similarly the neonatal cases that have been reported have been mild [20]. Diagnosis [21] A suspect case is defined as one with fever, sore throat and cough who has history of travel to China or other areas of persistent local transmission or contact with patients with similar travel history or those with confirmed COVID-19 infection. However cases may be asymptomatic or even without fever. A confirmed case is a suspect case with a positive molecular test.
throat and cough who has history of travel to China or other areas of persistent local transmission or contact with patients with similar travel history or those with confirmed COVID-19 infection. However cases may be asymptomatic or even without fever. A confirmed case is a suspect case with a positive molecular test. Specific diagnosis is by specific molecular tests on respiratory samples (throat swab/ nasopharyngeal swab/ sputum/ endotracheal aspirates and bronchoalveolar lavage). Virus may also be detected in the stool and in severe cases, the blood. It must be remembered that the multiplex PCR panels currently available do not include the COVID-19. Commercial tests are also not available at present. In a suspect case in India, the appropriate sample has to be sent to designated reference labs in India or the National Institute of Virology in Pune. As the epidemic progresses, commercial tests will become available. Other laboratory investigations are usually non specific. The white cell count is usually normal or low. There may be lymphopenia; a lymphocyte count <1000 has been associated with severe disease. The platelet count is usually normal or mildly low. The CRP and ESR are generally elevated but procalcitonin levels are usually normal. A high procalcitonin level may indicate a bacterial co-infection. The ALT/AST, prothrombin time, creatinine, D-dimer, CPK and LDH may be elevated and high levels are associated with severe disease.
count is usually normal or mildly low. The CRP and ESR are generally elevated but procalcitonin levels are usually normal. A high procalcitonin level may indicate a bacterial co-infection. The ALT/AST, prothrombin time, creatinine, D-dimer, CPK and LDH may be elevated and high levels are associated with severe disease. The chest X-ray (CXR) usually shows bilateral infiltrates but may be normal in early disease. The CT is more sensitive and specific. CT imaging generally shows infiltrates, ground glass opacities and sub segmental consolidation. It is also abnormal in asymptomatic patients/ patients with no clinical evidence of lower respiratory tract involvement. In fact, abnormal CT scans have been used to diagnose COVID-19 in suspect cases with negative molecular diagnosis; many of these patients had positive molecular tests on repeat testing [22]. Differential Diagnosis [21] The differential diagnosis includes all types of respiratory viral infections [influenza, parainfluenza, respiratory syncytial virus (RSV), adenovirus, human metapneumovirus, non COVID-19 coronavirus], atypical organisms (mycoplasma, chlamydia) and bacterial infections. It is not possible to differentiate COVID-19 from these infections clinically or through routine lab tests. Therefore travel history becomes important. However, as the epidemic spreads, the travel history will become irrelevant. Treatment [21, 23] Treatment is essentially supportive and symptomatic.
Differential Diagnosis [21] The differential diagnosis includes all types of respiratory viral infections [influenza, parainfluenza, respiratory syncytial virus (RSV), adenovirus, human metapneumovirus, non COVID-19 coronavirus], atypical organisms (mycoplasma, chlamydia) and bacterial infections. It is not possible to differentiate COVID-19 from these infections clinically or through routine lab tests. Therefore travel history becomes important. However, as the epidemic spreads, the travel history will become irrelevant. Treatment [21, 23] Treatment is essentially supportive and symptomatic. The first step is to ensure adequate isolation (discussed later) to prevent transmission to other contacts, patients and healthcare workers. Mild illness should be managed at home with counseling about danger signs. The usual principles are maintaining hydration and nutrition and controlling fever and cough. Routine use of antibiotics and antivirals such as oseltamivir should be avoided in confirmed cases. In hypoxic patients, provision of oxygen through nasal prongs, face mask, high flow nasal cannula (HFNC) or non-invasive ventilation is indicated. Mechanical ventilation and even extra corporeal membrane oxygen support may be needed. Renal replacement therapy may be needed in some. Antibiotics and antifungals are required if co-infections are suspected or proven. The role of corticosteroids is unproven; while current international consensus and WHO advocate against their use, Chinese guidelines do recommend short term therapy with low-to-moderate dose corticosteroids in COVID-19 ARDS [24, 25]. Detailed guidelines for critical care management for COVID-19 have been published by the WHO [26]. There is, as of now, no approved treatment for COVID-19. Antiviral drugs such as ribavirin, lopinavir-ritonavir have been used based on the experience with SARS and MERS. In a historical control study in patients with SARS, patients treated with lopinavir-ritonavir with ribavirin had better outcomes as compared to those given ribavirin alone [15].
ved treatment for COVID-19. Antiviral drugs such as ribavirin, lopinavir-ritonavir have been used based on the experience with SARS and MERS. In a historical control study in patients with SARS, patients treated with lopinavir-ritonavir with ribavirin had better outcomes as compared to those given ribavirin alone [15]. In the case series of 99 hospitalized patients with COVID-19 infection from Wuhan, oxygen was given to 76%, non-invasive ventilation in 13%, mechanical ventilation in 4%, extracorporeal membrane oxygenation (ECMO) in 3%, continuous renal replacement therapy (CRRT) in 9%, antibiotics in 71%, antifungals in 15%, glucocorticoids in 19% and intravenous immunoglobulin therapy in 27% [15]. Antiviral therapy consisting of oseltamivir, ganciclovir and lopinavir-ritonavir was given to 75% of the patients. The duration of non-invasive ventilation was 4–22 d [median 9 d] and mechanical ventilation for 3–20 d [median 17 d]. In the case series of children discussed earlier, all children recovered with basic treatment and did not need intensive care [17]. There is anecdotal experience with use of remdeswir, a broad spectrum anti RNA drug developed for Ebola in management of COVID-19 [27]. More evidence is needed before these drugs are recommended. Other drugs proposed for therapy are arbidol (an antiviral drug available in Russia and China), intravenous immunoglobulin, interferons, chloroquine and plasma of patients recovered from COVID-19 [21, 28, 29]. Additionally, recommendations about using traditional Chinese herbs find place in the Chinese guidelines [21].
Other drugs proposed for therapy are arbidol (an antiviral drug available in Russia and China), intravenous immunoglobulin, interferons, chloroquine and plasma of patients recovered from COVID-19 [21, 28, 29]. Additionally, recommendations about using traditional Chinese herbs find place in the Chinese guidelines [21]. Prevention [21, 30] Since at this time there are no approved treatments for this infection, prevention is crucial. Several properties of this virus make prevention difficult namely, non-specific features of the disease, the infectivity even before onset of symptoms in the incubation period, transmission from asymptomatic people, long incubation period, tropism for mucosal surfaces such as the conjunctiva, prolonged duration of the illness and transmission even after clinical recovery. Isolation of confirmed or suspected cases with mild illness at home is recommended. The ventilation at home should be good with sunlight to allow for destruction of virus. Patients should be asked to wear a simple surgical mask and practice cough hygiene. Caregivers should be asked to wear a surgical mask when in the same room as patient and use hand hygiene every 15–20 min.
ss at home is recommended. The ventilation at home should be good with sunlight to allow for destruction of virus. Patients should be asked to wear a simple surgical mask and practice cough hygiene. Caregivers should be asked to wear a surgical mask when in the same room as patient and use hand hygiene every 15–20 min. The greatest risk in COVID-19 is transmission to healthcare workers. In the SARS outbreak of 2002, 21% of those affected were healthcare workers [31]. Till date, almost 1500 healthcare workers in China have been infected with 6 deaths. The doctor who first warned about the virus has died too. It is important to protect healthcare workers to ensure continuity of care and to prevent transmission of infection to other patients. While COVID-19 transmits as a droplet pathogen and is placed in Category B of infectious agents (highly pathogenic H5N1 and SARS), by the China National Health Commission, infection control measures recommended are those for category A agents (cholera, plague). Patients should be placed in separate rooms or cohorted together. Negative pressure rooms are not generally needed. The rooms and surfaces and equipment should undergo regular decontamination preferably with sodium hypochlorite. Healthcare workers should be provided with fit tested N95 respirators and protective suits and goggles. Airborne transmission precautions should be taken during aerosol generating procedures such as intubation, suction and tracheostomies. All contacts including healthcare workers should be monitored for development of symptoms of COVID-19. Patients can be discharged from isolation once they are afebrile for atleast 3 d and have two consecutive negative molecular tests at 1 d sampling interval. This recommendation is different from pandemic flu where patients were asked to resume work/school once afebrile for 24 h or by day 7 of illness. Negative molecular tests were not a prerequisite for discharge.
they are afebrile for atleast 3 d and have two consecutive negative molecular tests at 1 d sampling interval. This recommendation is different from pandemic flu where patients were asked to resume work/school once afebrile for 24 h or by day 7 of illness. Negative molecular tests were not a prerequisite for discharge. At the community level, people should be asked to avoid crowded areas and postpone non-essential travel to places with ongoing transmission. They should be asked to practice cough hygiene by coughing in sleeve/ tissue rather than hands and practice hand hygiene frequently every 15–20 min. Patients with respiratory symptoms should be asked to use surgical masks. The use of mask by healthy people in public places has not shown to protect against respiratory viral infections and is currently not recommended by WHO. However, in China, the public has been asked to wear masks in public and especially in crowded places and large scale gatherings are prohibited (entertainment parks etc). China is also considering introducing legislation to prohibit selling and trading of wild animals [32]. The international response has been dramatic. Initially, there were massive travel restrictions to China and people returning from China/ evacuated from China are being evaluated for clinical symptoms, isolated and tested for COVID-19 for 2 wks even if asymptomatic. However, now with rapid world wide spread of the virus these travel restrictions have extended to other countries. Whether these efforts will lead to slowing of viral spread is not known.
na/ evacuated from China are being evaluated for clinical symptoms, isolated and tested for COVID-19 for 2 wks even if asymptomatic. However, now with rapid world wide spread of the virus these travel restrictions have extended to other countries. Whether these efforts will lead to slowing of viral spread is not known. A candidate vaccine is under development. Practice Points from an Indian Perspective At the time of writing this article, the risk of coronavirus in India is extremely low. But that may change in the next few weeks. Hence the following is recommended:Healthcare providers should take travel history of all patients with respiratory symptoms, and any international travel in the past 2 wks as well as contact with sick people who have travelled internationally. They should set up a system of triage of patients with respiratory illness in the outpatient department and give them a simple surgical mask to wear. They should use surgical masks themselves while examining such patients and practice hand hygiene frequently. Suspected cases should be referred to government designated centres for isolation and testing (in Mumbai, at this time, it is Kasturba hospital). Commercial kits for testing are not yet available in India.
They should set up a system of triage of patients with respiratory illness in the outpatient department and give them a simple surgical mask to wear. They should use surgical masks themselves while examining such patients and practice hand hygiene frequently. Suspected cases should be referred to government designated centres for isolation and testing (in Mumbai, at this time, it is Kasturba hospital). Commercial kits for testing are not yet available in India. Patients admitted with severe pneumonia and acute respiratory distress syndrome should be evaluated for travel history and placed under contact and droplet isolation. Regular decontamination of surfaces should be done. They should be tested for etiology using multiplex PCR panels if logistics permit and if no pathogen is identified, refer the samples for testing for SARS-CoV-2. All clinicians should keep themselves updated about recent developments including global spread of the disease. Non-essential international travel should be avoided at this time. People should stop spreading myths and false information about the disease and try to allay panic and anxiety of the public.
Patients admitted with severe pneumonia and acute respiratory distress syndrome should be evaluated for travel history and placed under contact and droplet isolation. Regular decontamination of surfaces should be done. They should be tested for etiology using multiplex PCR panels if logistics permit and if no pathogen is identified, refer the samples for testing for SARS-CoV-2. All clinicians should keep themselves updated about recent developments including global spread of the disease. Non-essential international travel should be avoided at this time. People should stop spreading myths and false information about the disease and try to allay panic and anxiety of the public. Conclusions This new virus outbreak has challenged the economic, medical and public health infrastructure of China and to some extent, of other countries especially, its neighbours. Time alone will tell how the virus will impact our lives here in India. More so, future outbreaks of viruses and pathogens of zoonotic origin are likely to continue. Therefore, apart from curbing this outbreak, efforts should be made to devise comprehensive measures to prevent future outbreaks of zoonotic origin. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of Interest None.
Introduction Upper Respiratory tract infections are seen with great frequency in both children and adults and have remarkable economic impact, related to the frequent prescription by physicians of antibiotics, even when the causative agents of infection are not bacteria. About one-fourth of children with sore throat have bacterial pharyngitis and about half of the families with index case have a secondary case [1]. Identification and adequate antibiotic treatment of group A streptococcal sore throat is important for primary prevention of acute rheumatic fever, as it carries approximately 3% risk of development of acute rheumatic fever. Definition Soreness is generally described by the patient as pain in the throat without the effort of swallowing and also a painful swallow [2]. Sore throat is primary symptom of pharyngitis. The terms “sore throat” and “pharyngitis or pharyngotonsillitis” are often used interchangeably. Pharyngitis refers to objective evidence of inflammation of the pharynx, such as exudates, ulceration, or definite erythema. Redness of the throat may occur as part of the general redness of all mucous membranes in a patient with fever. A diagnosis of pharyngitis is justified only when the pharynx is redder than the rest of the oral mucosa. Etiology Most sore throats are caused by viruses. Less often, sore throats are due to bacterial infections. Viral Infections Corona virus, rhinovirus, adeno virus, influenza and parainfluenza are the commonest etiological agents and usually presents as common cold.
Definition Soreness is generally described by the patient as pain in the throat without the effort of swallowing and also a painful swallow [2]. Sore throat is primary symptom of pharyngitis. The terms “sore throat” and “pharyngitis or pharyngotonsillitis” are often used interchangeably. Pharyngitis refers to objective evidence of inflammation of the pharynx, such as exudates, ulceration, or definite erythema. Redness of the throat may occur as part of the general redness of all mucous membranes in a patient with fever. A diagnosis of pharyngitis is justified only when the pharynx is redder than the rest of the oral mucosa. Etiology Most sore throats are caused by viruses. Less often, sore throats are due to bacterial infections. Viral Infections Corona virus, rhinovirus, adeno virus, influenza and parainfluenza are the commonest etiological agents and usually presents as common cold. Other viral infections that can present with sore throat are Ebstein Barr (EB) virus and HIV which can present as a sore throat in initial course of illness. Recurrent sore throat can occur due to cytomegalovirus or fungal infections in immunosuppresed patients. Bacterial Infections Group A beta-hemolytic streptococcus (GABHS) is the most common cause of bacterial sore throat. It accounts for 15–36% of cases of acute pharyngitis in children in west [1], and 13.4% of cases in India, according to one study done at PGIMER [3]. Streptococcus type C and G Diphtheria—is an important cause in India and many developing countries.
Group A beta-hemolytic streptococcus (GABHS) is the most common cause of bacterial sore throat. It accounts for 15–36% of cases of acute pharyngitis in children in west [1], and 13.4% of cases in India, according to one study done at PGIMER [3]. Streptococcus type C and G Diphtheria—is an important cause in India and many developing countries. H influenza, Staphylococcus aureus, Mycoplasma, Chlamydia pneumoniae, Moraxella catarrhalis and Yersinia are some uncommon bacterial causes. Fusobacterium necrophorum infection. This uncommon infection which starts as fever and sore throat, can complicate into Lemierre’s syndrome. (Positive blood culture, clinical or radiographic evidence of internal jugular vein thrombosis, and at least one metastatic focus.) Other Causes Peritonsillar, Retropharyngeal and Lateral Pharyngeal abscesses—usually due to spread of infection from local site like bacterial tonsillitis. Along with fever and sore throat, other features like painful swallowing, drooling, trismus, visible swelling below mandible and deviation of uvula to opposite side may be present. Allergies—especially when complicated by postnasal drip. Irritants—Dust, tobacco smoke (in teenagers) or chemicals (occupational hazard for children/adolescents working in factories). Sore throat in such patients is usually chronic. Muscle strain—talking in loud noise without rest for long period. GastroEsophageal Reflux Disease (GERD) Psychogenic
Allergies—especially when complicated by postnasal drip. Irritants—Dust, tobacco smoke (in teenagers) or chemicals (occupational hazard for children/adolescents working in factories). Sore throat in such patients is usually chronic. Muscle strain—talking in loud noise without rest for long period. GastroEsophageal Reflux Disease (GERD) Psychogenic Approach to the Patient Majority of the times, history and clinical examination gives clue to etiology (Table 1). The major challenge is to diagnose GABHS infection, because the signs and symptoms of GABHS pharyngitis overlap with other infections and untreated GABHS can cause serious complications. No single element of the history or physical examination reliably confirms or excludes GABHS pharyngitis. Table 1 Clues towards etiological diagnosis of sore throat Enterovirus Summer, pharyngeal vesicle/ulcer, rash, diarrhea EBV(infectious mononucleosis) Teenagers, tender posterior cervical lymphadenopathy, tender hepatomegaly, splenomegaly, petechial rash, edema of eyelids, supported by thrombocytopenia, >10% atypical lymphocytes on peripheral smear and positive monospot test or IgM antibody against Viral Capsular Antigen (VCA). Adenovirus Preschoolers, conjunctivitis, follicular hyperplasia of tonsils Diphtheria Unvaccinated child, shallow ulceration of upper lips and external nares, neck swelling, characteristic pseudomembrane GastroEsophageal Reflux Disease Retrosternal burning/epigastric pain, lump in throat, no fever Fungal Oral thrush, common in neonates and infants <9 months. Immunocomromised/HIV
ia of tonsils Diphtheria Unvaccinated child, shallow ulceration of upper lips and external nares, neck swelling, characteristic pseudomembrane GastroEsophageal Reflux Disease Retrosternal burning/epigastric pain, lump in throat, no fever Fungal Oral thrush, common in neonates and infants <9 months. Immunocomromised/HIV Several scoring systems have been developed to predict which patients will have GABHS. Use of these does improve quality of care but none of these systems, however, is totally reliable in identifying children who need treatment [4]. A clinical scoring system has been designed in India but it has to be validated for local use. This scoring system uses variables such as age, season, fever, erythema of pharynx, size of tonsil, pharyngeal exudates; lymphadenopathy and pain in throat, and scores are assigned according to throat culture positivity in association with the same. Cut off value of 15 predicts GAS infection with 91% sensitivity and 98% specificity [3]. The evaluation of patient should include the following: History Onset and duration Fever—degree (doesn’t help much to differentiate) Associated cough, coryza, conjunctivitis (more with viral); headache, myalgia (more with GABHS) Any breathing difficulty especially new onset snoring at night or stridor (a likely sign of developing abscess) History of rash, diarrhea, allergy History of regurgitation, epigastric or retrosternal pain usually indicates GERD History of sore throat in family in past 2 wks. Similar complaints in past, with vaccination history Examination
Any breathing difficulty especially new onset snoring at night or stridor (a likely sign of developing abscess) History of rash, diarrhea, allergy History of regurgitation, epigastric or retrosternal pain usually indicates GERD History of sore throat in family in past 2 wks. Similar complaints in past, with vaccination history Examination Look oral cavity with a good light for- Exudates: White/gray scum on the surface of the tonsils or pharynx, readily wiped off without producing bleeding is more likely with bacterial pharyngitis. Ulcer Membrane: Exudates of bacterial pharyngitis may organize as gray-white layer of materials that can be peeled from the pharynx. ○ A membrane is seen with infectious mononucleosis, diphtheria and sometimes streptococcal infection. Arcanobacterium hemolyticum and tularemia are rare causes of membranous pharyngitis. ○ Gray to black adherent membrane, with extension beyond the faucial area (esp. soft palate and uvula), dysphagia, and relative lack of fever suggest a diagnosis of diphtheria. ○ Oral thrush seen in neonates and infants which can have pseudomembrane (curd like plaques), removal of which may cause mild punctuate bleeding. Bulging of oropharynx or uvula displacement are suggestive of parapharyngeal or peritonsillar abscess. Painful vesicular lesions on pharynx and tonsils are characteristic of herpangina. Herpes simplex produces painful vesicles confined to anterior mouth which may sometimes extend to anterior tonsillar pillars.
○ Oral thrush seen in neonates and infants which can have pseudomembrane (curd like plaques), removal of which may cause mild punctuate bleeding. Bulging of oropharynx or uvula displacement are suggestive of parapharyngeal or peritonsillar abscess. Painful vesicular lesions on pharynx and tonsils are characteristic of herpangina. Herpes simplex produces painful vesicles confined to anterior mouth which may sometimes extend to anterior tonsillar pillars. Lymphadenopathy: Look for anterior (tonsillar) and posterior cervical lymph nodes. Tender anterior lymphadenopathy favors bacterial sore throat. Tender posterior cervical and/or generalized lymphadenopathy favours Ebstein Barr (EB) virus infection. Examine for neck swelling, conjunctivitis, auscultatory abnormalities and hepatosplenomegaly. Vital signs, including blood pressure, should be recorded. Poor quality of the heart sounds raises the possibility of diphtheritic myocarditis. Absence of a heart murmur or dependent edema should be noted for their relevance to rheumatic fever and glomerulonephritis. Common signs and symptoms of streptococcal pharyngitis include sore throat, temperature ≥38.3°C, tonsillar or pharyngeal exudates and cervical lymphadenopathy. Cough, coryza and diarrhea are more common with viral pharyngitis. Differentiating features between streptococcal pharyngitis and viral pharyngitis are given in Table 2. Table 2 Clinical clues to differentiate viral infection from those of Group A beta-hemolytic streptococcus (GABHS)
dates and cervical lymphadenopathy. Cough, coryza and diarrhea are more common with viral pharyngitis. Differentiating features between streptococcal pharyngitis and viral pharyngitis are given in Table 2. Table 2 Clinical clues to differentiate viral infection from those of Group A beta-hemolytic streptococcus (GABHS) GABHS Viruses Age 5–11 years All ages Season Late winter/early spring All Symptoms Sudden onset Onset varies Severe sore throat Mild sore throat Absent cougha Present Fever ≥ 38.3°Ca/b Varies Absent coryza Present Headache, myalgia +/− Throat pain – Signs Severe pharyngeal erythema Mild Pharyngeal exudatesb No exudate Palatal petechieb Enanthem Anterior cervical nodesa, tender Varies Tonsillar exudate Absent Tonsil enlargement large/moderate Normal Scarlentiform rashb Exanthem H/o streptococcus exposure in past 2 wks Presentb Absent aHigh sensitivity for GABHS [1] bHigh specificity for GABHS [1] Investigations A major concern in emergency room for a child with sore throat is not to miss diagnosis of diphtheria and GABHS pharyngitis. Obtain throat swab for bacterial smear and culture including Albert stains for diphtheria. A provisional diagnosis of diphtheria is suggested if typical drum stick organisms are seen in the smear. However, a definitive diagnosis requires growth of C. diphtherium in culture as diphtheroids are commensals in throat.
tis. Obtain throat swab for bacterial smear and culture including Albert stains for diphtheria. A provisional diagnosis of diphtheria is suggested if typical drum stick organisms are seen in the smear. However, a definitive diagnosis requires growth of C. diphtherium in culture as diphtheroids are commensals in throat. Rapid Antigen Diagnostic Tests (RADTs) for GABHS [5, 6]: It is based on nitrous acid extraction of group A carbohydrate antigen from organisms obtained by throat swab. It is highly specific (>95%), and provides immediate results, but has variable sensitivity. Throat culture confirmation of a negative RADT is recommended to increase sensitivity. Confirmation of positive test is not recommended because of very high specificity. Other investigations to be done according to clinical possibility. ○ Complete blood count ○ Peripheral blood smears-for atypical lymphocytes. ○ EB virus serology (IgM antibody against VCA(viral capsular antigen)) ○ Streptococcal antibody titre is not useful for diagnosis of streptococcal pharyngitis and is not routinely recommended. ○ X ray soft tissue neck (lateral view) for retropharyngeal abscess. ○ CT scan of neck including base of skull for abscess. Throat Swab Sampling Technique Samples should be obtained by vigorous swabbing of both tonsillar surfaces or fossae and the posterior pharynx [6, 7]. Correctly sampled and plated, throat swab culture has 90–95% sensitivity. Swabbing the soft palate and uvula should be avoided, because it dilutes the inoculums.
○ CT scan of neck including base of skull for abscess. Throat Swab Sampling Technique Samples should be obtained by vigorous swabbing of both tonsillar surfaces or fossae and the posterior pharynx [6, 7]. Correctly sampled and plated, throat swab culture has 90–95% sensitivity. Swabbing the soft palate and uvula should be avoided, because it dilutes the inoculums. Management GABHS pharyngitis is self-limiting illness. Antibiotic treatment provides acute symptom relief, prevent suppurative (otitis media, sinusitis, quinsy) and non suppurative complications, and reduce communicability. Antibiotics reduce incidence of rheumatic fever by more than two third [8]. Clinical decision guideline for sore throat is given in Fig. 1. Fig. 1 Clinical decision guideline for suspected streptococcal pharyngitis
purative (otitis media, sinusitis, quinsy) and non suppurative complications, and reduce communicability. Antibiotics reduce incidence of rheumatic fever by more than two third [8]. Clinical decision guideline for sore throat is given in Fig. 1. Fig. 1 Clinical decision guideline for suspected streptococcal pharyngitis Clinical features, epidemiological criteria and expert clinician judgment with or without supportive investigation usually indicate need for antibiotics. Currently used score for decision making in pharyngitis has been adapted by adding age to four components of original Centor score (absence of cough, swollen and tender anterior cervical nodes, temperature >38°C and tonsillar exudates or swelling) [9]. Each component is given 1 point; age of 3–14 years carries 1 point while that of 14–44 years, zero. Patients with a score of zero or 1 do not require testing or antibiotic therapy. Patients with score of 2 or 3 should be tested and prescribed antibiotics if found positive while patients with score of 4 or higher, are at high risk of streptococcal pharyngitis and should be given empiric treatment [10].
44 years, zero. Patients with a score of zero or 1 do not require testing or antibiotic therapy. Patients with score of 2 or 3 should be tested and prescribed antibiotics if found positive while patients with score of 4 or higher, are at high risk of streptococcal pharyngitis and should be given empiric treatment [10]. Antibiotics Based on cost, narrow spectrum of activity, safety, and effectiveness, penicillin is the drug of choice [10, 11]. Shorter duration of treatment increases risk of bacteriological recurrence [12] Inappropriate use of macrolides for treatment of GABHS pharyngitis has been the main cause of resistant strains in western countries [13]. The various alternatives to penicillin and the dosage of antibiotics are given in Table 3. Table 3 Antibiotic choice for streptococcal pharyngitis Drug Route Dosage Duration Penicillin V Oral <27 kg–250 mg 2–3/day 10 days ≥27 kg–250 mg 3–4/day or 500 mg 2/day Amoxicillina Oral 40 mg/kg/day in 3 divided doses 10 days Penicillin G benzathine IM <27 kg–6 lac unit Single dose ≥27 kg–12 lac unit Options for patients allergic to penicillin Erythromycin ethylsuccinate Oral 30–50 mg/kg/day in 2–4 divided doses 10 days Erythromycin estolate oral 20–40 mg/kg/day in 2–4 divided doses 10 days Cefadroxil Oral 30 mg/kg/day in 2 divided doses 10 days Cephalexin Oral 25–50 mg/kg/day in 2 divided doses 10 days aAmoxicillin is equally effective as penicillin V and is more palatable
ylsuccinate Oral 30–50 mg/kg/day in 2–4 divided doses 10 days Erythromycin estolate oral 20–40 mg/kg/day in 2–4 divided doses 10 days Cefadroxil Oral 30 mg/kg/day in 2 divided doses 10 days Cephalexin Oral 25–50 mg/kg/day in 2 divided doses 10 days aAmoxicillin is equally effective as penicillin V and is more palatable The following medications are FDA (U.S. Food and Drug Administration) approved, but are not recommended by guidelines for primary GABHS therapy: azithromycin, clarithromycin, cefpodoxime, ceftibuten, and cefdinir Diphtheria Management Stabilize child (ABC…) (For details refer to section on upper airway obstruction). Diphtheria antitoxin: 50,000–120,000 U IV depending on extent of involvement. Antibiotics: Aqueous crystalline penicillin G 40,000 U/kg/dose 6 hourly IV or erythromycin 15 mg/kg 8 hourly (not to exceed 2 g/day) oral/IV for 14 days. For prophylaxis to contacts same dose of erythromycin for 7 days or a single injection of benzathine penicillin G (600,000 U IM for <30 kg, 1,200,000 U IM for ≥30 kg.) is recommended. Indication for Hospitalization Toxic looking child Not accepting orally well Suspected to having associated complications or diphtheria. Conflict of Interest None. Role of Funding Source None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 11669033 BF02762112 10.1007/BF02762112 Review Article Necrotizing enterocolitis Kulkarni Anjali 011-6328725akulkarni58@rediffmail.com 1 Vigneswaran R. 2 1 grid.414612.4000000041804700XIndraprastha Apollo Hospital, 6 Ishwar Nagar Mathura Road, 110065 New Delhi, 2 grid.1694.aWomen’s and Children’s Hospital, Adelaide, Australia 2001 68 9 847 853 © Dr. K C Chaudhuri Foundation 2001This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Improvement in survival rates of low birth-weight infants particularly in the neonatal intensive care units of India appears to be accompanied by frequent recognition of Necrotizing enterocolitis (NEC) among early survivors. As the philosophy and practice of advanced care for tiny infants becomes more acceptable and affordable in the country, a steady increase in survival of such infants is predictable. However there is growing concern in India that NEC could become a significant contributor to morbidity and mortality in the future. NEC is currently regarded as the most common acquired gastrointestinal emergency in the newborn period, and the outcome of this disease is universally poor. Improved understanding of the pathophysiology and pathogenesis of this condition is required for formulating optimal principles of prevention and management.
ture. NEC is currently regarded as the most common acquired gastrointestinal emergency in the newborn period, and the outcome of this disease is universally poor. Improved understanding of the pathophysiology and pathogenesis of this condition is required for formulating optimal principles of prevention and management. Key words Necrotizing EnterocolitisLBW infantsAetiologyissue-copyright-statement© Dr. K C Chaudhuri Foundation 2001
Introduction Vaccines are a cost effective way of decreasing mortality and morbidity due to various childhood infectious diseases. The Expanded Programme on Immunization (EPI) was adopted by WHO in 1977 against diphtheria, polio, tuberculosis, pertussis, measles, and tetanus with prime aim of immunization to all children [1]. It was started in India in 1978 with BCG, DPT (3 doses) and typhoid vaccine. In 1979, OPV and in 1985, measles vaccine was added to the list subsequent to omission of typhoid vaccine [2]. Later Hepatitis B and Haemophilus influenzae type b (Hib) were included in the same. So far, vaccination has successfully eradicated small pox, polio and maternal and neonatal tetanus along with decreasing the burden of many other diseases. Majority of the vaccines available are injectable preparations. A child receives as many as 18–24 shots of vaccination till he/she reaches the age of two according to CDC vaccine schedule [3]. Besides the prototype oral Sabin polio vaccine, rotavirus vaccine, cholera vaccine, typhoid vaccine and Shigella flexneri 2a vaccine are available for oral administration. Nasal spray for influenza vaccine is also available but CDC advisory committee abandoned its use during 2016–2017 flu season [4].
cine schedule [3]. Besides the prototype oral Sabin polio vaccine, rotavirus vaccine, cholera vaccine, typhoid vaccine and Shigella flexneri 2a vaccine are available for oral administration. Nasal spray for influenza vaccine is also available but CDC advisory committee abandoned its use during 2016–2017 flu season [4]. Life saving benefits aside, the very thought of vaccination comes with pain and anxiety associated with that needle prick. It is difficult for the parents to handover their child to the nurse knowing that the child does not understand why he is being hurt. It is a helpless feeling as the parents know that the discomfort and the side-effects far outweigh the morbidity and mortality due to the disease. The most common vaccine-related concern the parents have is that injection will be painful to the child. Study by Kennedy et al. demonstrated that 44.2% of parents are concerned about pain to the child [5]. Studies suggest nearly 24% of parents and 63% of children have needle fear and it is the primary reason for immunization non-compliance amongst 7% of parents and 8% children [6]. So being a pediatrician we must ensure vaccine delivery in a painless manner.
eller’s vaccine. While two doses of the currently available OCVs are recommended by manufacturers, a single dose would be easier to implement. Qadri et al. proved a single-dose of the current killed oral cholera vaccines, that have been prequalified by the World Health Organization, to be efficacious in epidemics [15]. Rotavirus is responsible for fever, nausea, vomiting and watery diarrhea in young infants. Oral vaccines for rotavirus are in use since 2006 and are effective. Both the brands of available vaccines, are administered orally and are only different in the number of doses. With five valent vaccine, three doses are required (2 mo, 4 mo, and 6 mo) and monovalent human strain vaccine requires two doses (2 mo and 4 mo).
hat 44.2% of parents are concerned about pain to the child [5]. Studies suggest nearly 24% of parents and 63% of children have needle fear and it is the primary reason for immunization non-compliance amongst 7% of parents and 8% children [6]. So being a pediatrician we must ensure vaccine delivery in a painless manner. There are guidelines to assist clinicians in managing vaccination-related fear, pain and anxiety among children. To reduce pain at the time of injection, breastfeeding, administration of a sweet-tasting solution (sucrose), offering to rub or stroke the skin near the injection site with moderate intensity before and during vaccination, parent and clinician-led distraction, and use of topical anesthetics (lidocaine–prilocaine 5% cream or patch, amethocaine 4% gel and liposomal lidocaine 4% cream) all have been tried [7]. Topical application of lidocaine-prilocaine cream is proven to be effective and does not interfere with immunogenicity of the vaccine. Parents have shown good acceptance towards it even though it is expensive and take 60 min to work [8, 9]. Distraction is defined as the use of strategies to take an individual’s attention away from the procedure [7]. Its efficacy is variable. Music seems to reduce distress and pain during vaccinations in adolescents but not in younger children [9]. However, video distraction relieves anxiety before and after vaccinations but not the pain. Distraction by blowing a party blower and toys reduces vaccination pain in children. Party blower also aids in breathing techniques which also decreases the pain. Breastfeeding relieves the pain by sweet taste, distraction, suckling, and physical contact and the 24% oral sucrose solution too decreases the pain by releasing endogenous opioids and distraction [8]. Tactile stimulation in the form of pressure at the site reduces the pain or not, is controversial [7, 9, 10].
he pain. Breastfeeding relieves the pain by sweet taste, distraction, suckling, and physical contact and the 24% oral sucrose solution too decreases the pain by releasing endogenous opioids and distraction [8]. Tactile stimulation in the form of pressure at the site reduces the pain or not, is controversial [7, 9, 10]. Immunization procedure matters a lot. Parents are advised to hold the infant comfortably and not to place them supine. Injecting the vaccine without aspiration and giving the most painful vaccine (MMR-II and Prevnar) last when administering multiple vaccines at the same visit reduces the pain [7, 8]. Finally, in the era of multiple injections, parents want that multiple injections be given simultaneously, rather than sequentially [10]. This has insufficient level of evidence in reducing the pain. The said interventions may though decrease the pain but the fear of needles and anxiety associated with procedure of vaccination needs new ways of delivering the vaccines. The need of the hour is to find out ways of vaccine delivery which do not cause any pain at all. Various vaccine delivery methods already exist that are painless vis a vis oral and nasal vaccination. The newer non-invasive routes of administering vaccines are the followingOral Nasal (aerosols and dry powder inhalations) Transdermal (microneedles and nanopatch) Table 1 enlists various non-injectable vaccines available for use and trial.
The said interventions may though decrease the pain but the fear of needles and anxiety associated with procedure of vaccination needs new ways of delivering the vaccines. The need of the hour is to find out ways of vaccine delivery which do not cause any pain at all. Various vaccine delivery methods already exist that are painless vis a vis oral and nasal vaccination. The newer non-invasive routes of administering vaccines are the followingOral Nasal (aerosols and dry powder inhalations) Transdermal (microneedles and nanopatch) Table 1 enlists various non-injectable vaccines available for use and trial. Oral Vaccines There is a considerable amount of exposure of infectious agents from our gut mucosa. Needle vaccination may not be just sufficient to provide protection from the gut infection routes. Initially the oral vaccines were shunned, considering their digestion into small fragments by the gastric enzymes rendering them ineffective. However, now oral vaccines are being made using lipids and fats which are not broken down in the stomach and traverse till the intestine where they are absorbed.
nfection routes. Initially the oral vaccines were shunned, considering their digestion into small fragments by the gastric enzymes rendering them ineffective. However, now oral vaccines are being made using lipids and fats which are not broken down in the stomach and traverse till the intestine where they are absorbed. The well-known oral polio vaccine (OPV) has been used for mass vaccination campaigns due to its ease of administration. Trivalent OPV consists of a mixture of live attenuated poliovirus strains of each of the three serotypes. OPV produces both, local and humoral immune response. Antibodies in the blood protect the individual against polio paralysis by preventing the spread of poliovirus to the nervous system. The local immune response in the lining (‘mucous membrane’) of the intestine inhibits the multiplication of subsequent infections of ‘wild’ (naturally occurring) virus and also stop person-to-person transmission of wild poliovirus [11]. As it has been nearly 5 y that India is free of polio, now bivalent OPV is used. Similar oral vaccine is available for typhoid with 50% to 80% efficacy and it confers protection for at least 5 to 7 y in 62% to 78% of recipients [12]. The oral live-attenuated vaccine (manufactured from the Ty21a strain of Salmonella serotype typhi) is known for primary vaccination. It consists of an enteric-coated capsule taken on alternate days (day 0, 2, 4, and 6), for a total of four capsules [13]. Presently this vaccine is not available for use in India.
s [12]. The oral live-attenuated vaccine (manufactured from the Ty21a strain of Salmonella serotype typhi) is known for primary vaccination. It consists of an enteric-coated capsule taken on alternate days (day 0, 2, 4, and 6), for a total of four capsules [13]. Presently this vaccine is not available for use in India. Oral cholera vaccines (OCVs): single-dose live oral cholera vaccine and two other oral inactivated, or non-live cholera vaccines have proven to be effective in epidemics and outbreaks [14]. Live oral cholera vaccine strain CVD 103-HgR, which is an attenuated, live vaccine, administered as a single dose has an efficacy of 62% to 100% [12]. The establishment of the global OCV stockpile in 2013 has been a major advance in cholera preparedness. New killed and live-attenuated vaccines are being actively explored as candidate vaccines for endemic settings and/or as a traveller’s vaccine. While two doses of the currently available OCVs are recommended by manufacturers, a single dose would be easier to implement. Qadri et al. proved a single-dose of the current killed oral cholera vaccines, that have been prequalified by the World Health Organization, to be efficacious in epidemics [15].
vaccines for rotavirus are in use since 2006 and are effective. Both the brands of available vaccines, are administered orally and are only different in the number of doses. With five valent vaccine, three doses are required (2 mo, 4 mo, and 6 mo) and monovalent human strain vaccine requires two doses (2 mo and 4 mo). Edible vaccine is an unusual and new concept. Scientists suggest that plants and plant viruses can be genetically engineered to produce vaccines against diseases. These are produced by introducing selected genes encoding bacterial and viral antigens in plants which are used to form immunogenic proteins [16]. Edible plant vaccines are like conventional subunit vaccines i.e., immunogenic preparations containing antigenic proteins rather than pathogens [17]. This process is known as “transformation” and the altered plants are called “transgenic plants”. Thus, they are highly safe and cannot cause disease. It will be easy to administer them and they will have a low production cost. It eliminates need of fermentation and purification systems, sterile delivery and being heat stable does not require cold chain maintenance. It confers both mucosal (IgA) and systemic (IgG) immunity. Over past 5 y significant progress has been made in expressing vaccine antigens in edible leaves (especially lettuce) and processing them to achieve antigen stability and efficacy after prolonged storage at ambient temperatures [18]. They can be grown using local production facilities and are thus, cutting expensive manufacturing cost. And as there is no need of needles, it prevents infection.
ens in edible leaves (especially lettuce) and processing them to achieve antigen stability and efficacy after prolonged storage at ambient temperatures [18]. They can be grown using local production facilities and are thus, cutting expensive manufacturing cost. And as there is no need of needles, it prevents infection. Bioencapsulation of antigens in plant cells protects them from the digestive system; the fusion of antigens to transmucosal carriers enhances efficiency of their delivery to the immune system and facilitates successful development of plant vaccines as oral boosters [18]. Antigen expression in plants has been successfully shown for LT-B (ETEC) in tobacco and potato; rabies virus-G protein in tomato; HBsAg in tobacco and potato; Norwalk virus in tobacco and potato; CT-B (Vibrio cholerae) in potato [19]. Clinical trials are undergoing for malaria, measles, human papilloma virus (HPV-11), Human Immunodeficiency Virus, Respiratory Synctial Virus and Mycobacterium tuberculosis [19]. Human clinical trials using transgenic potatoes having cholera toxin have shown successful seroconversion in volunteers.
rae) in potato [19]. Clinical trials are undergoing for malaria, measles, human papilloma virus (HPV-11), Human Immunodeficiency Virus, Respiratory Synctial Virus and Mycobacterium tuberculosis [19]. Human clinical trials using transgenic potatoes having cholera toxin have shown successful seroconversion in volunteers. The sublingual route i.e., via the mucosal surfaces under the tongue and the buccal route have been used for many years to deliver drugs (cardiovascular drugs, steroids, barbiturates, benzodiazepines, opioid analgesics) and small molecules to the bloodstream. The potential of sublingual and buccal vaccine delivery is largely unexplored. They are superior to oral vaccination method where there is a risk of degradation by gastric enzymes. Similarly in skin vaccination method, impermeable thick keratinized stratum corneum acts as a physiological barrier and chemical disruption and/or microneedle penetration is required which is not so in sublingual and buccal vaccine delivery. Intranasal immunization also induces mucosal immunity but retrograde transport of antigen and/or adjuvant from vaccine formulations to the brain and other neural tissues, causes serious side-effects. This is in contrast to the sublingual route of delivery wherein no antigenic migration to the central nervous system occurs. Many laboratories have documented the efficacy of sublingual immunization in inducing adequate immune response in experimental animal systems using a variety of antigens, including soluble proteins, inert particulate antigens (killed viruses, virus-like particles, bacterial extracts) as well as live-attenuated viruses [20]. Researchers have successfully demonstrated protection against H. pylori [21], HPV16, HPV18, and HPV58 pseudoviruses [22] by sublingual vaccination in animals. The sublingual mucosa is a promising vaccine delivery route for other respiratory pathogens including influenza virus, Respiratory Syncytial virus (RSV) and Severe Acute Respiratory Syndrome (SARS) virus [23]. However in a clinical trial, where HPV vaccine was applied sublingually to humans, antibody titre were 1000-fold lower than in the intramuscular group. So researchers concluded that alternative delivery systems and adjuvants would be required to enhance and evaluate immune responses following sublingual immunization in humans [23]. It is an attractive option for vaccine delivery because it is efficient, accessible, and relatively clean.
han in the intramuscular group. So researchers concluded that alternative delivery systems and adjuvants would be required to enhance and evaluate immune responses following sublingual immunization in humans [23]. It is an attractive option for vaccine delivery because it is efficient, accessible, and relatively clean. “ Melt in mouth strips ” is an another innovation in vaccine delivery. Researchers at McMaster University are inspired from the chemistry of a consumer product: breath-freshening strips that melt on tongue [24]. Pullulan, a polysaccharide derived from a common fungus is the key ingredient of these strips. It normally rests in a solid state but dissolves easily in water. By casting enzymes and other substrates within this material; they can be preserved in a form that will remain inert until it interacts with water. Undergraduate biomedical engineering students at John Hopkins University have developed such strips laced with vaccine against rotavirus [25].Table 1 List of non-injectable vaccines available for use or under trial Route Available Under trial Oral Polio vaccine Rotavirus vaccine Typhoid vaccine Cholera vaccine Edible vaccines Cholera, Norwalk virus, Hepatitis B, Malaria, Measles, Human Papilloma Virus (HPV-11), Human Immunodeficiency Virus (HIV), Respiratory Synctial virus and Mycobacterium tuberculosis Sublingual vaccines Helicobacter pylori, HPV16, HPV18, and HPV58 pseudoviruses, Influenza Virus, Respiratory Syncytial virus (RSV) and Severe Acute Respiratory Syndrome (SARS) virus Melt in mouth strips Rotavirus Nasal vaccines Influenza spray Ebola vaccine spray
Edible vaccines Cholera, Norwalk virus, Hepatitis B, Malaria, Measles, Human Papilloma Virus (HPV-11), Human Immunodeficiency Virus (HIV), Respiratory Synctial virus and Mycobacterium tuberculosis Sublingual vaccines Helicobacter pylori, HPV16, HPV18, and HPV58 pseudoviruses, Influenza Virus, Respiratory Syncytial virus (RSV) and Severe Acute Respiratory Syndrome (SARS) virus Melt in mouth strips Rotavirus Nasal vaccines Influenza spray Ebola vaccine spray Pneumococcal infection, Dengue, Hepatitis B, Whole Influenza virus, Vaccinia viruses, Anthrax and HIV Pulmonary vaccines Hepatitis B virus, Measles, Tuberculosis, Yersinia pestis, Measles, MMR (Measles, Mumps, Rubella) vaccine, Bacillus Calmette-Guérin (BCG) vaccine, Influenza, Streptococcus pneumoniae, HPV and Mycoplasma hyopneumoniae Microneedles Diphtheria, Hepatitis B, recombinant anthrax vaccine, Live-attenuated Japanese encephalitis vaccine, Rabies vaccine, Influenza vaccine, BCG vaccine, Measles, Rotavirus vaccine, Vaccine for travellers’ diarrhea Nanopatch West Nile virus, Chikungunya, Influenza
Pneumococcal infection, Dengue, Hepatitis B, Whole Influenza virus, Vaccinia viruses, Anthrax and HIV Pulmonary vaccines Hepatitis B virus, Measles, Tuberculosis, Yersinia pestis, Measles, MMR (Measles, Mumps, Rubella) vaccine, Bacillus Calmette-Guérin (BCG) vaccine, Influenza, Streptococcus pneumoniae, HPV and Mycoplasma hyopneumoniae Microneedles Diphtheria, Hepatitis B, recombinant anthrax vaccine, Live-attenuated Japanese encephalitis vaccine, Rabies vaccine, Influenza vaccine, BCG vaccine, Measles, Rotavirus vaccine, Vaccine for travellers’ diarrhea Nanopatch West Nile virus, Chikungunya, Influenza Nasal and Aerosol Vaccines We respire every moment and with every breath we are exposed to several viral and bacterial pathogens that transmit through air-borne particles. The large surface area of respiratory system can provide adequate interaction between the immune system and the antigen. The nasal mucosa and lungs can be considered as an important route for vaccination. In addition, the extensive vascularization and thin epithelium in the alveolar lung tissue [26] facilitates efficient systemic delivery of antigens, thereby ensuring both local and systemic antibodies. The delivery of vaccines via these routes is recently emerging as an attractive alternative to injection. It is more potent and a practical way of inducing effective immunity against infectious diseases. It elicits rapid immune response, both locally and systemically. It is gaining advances in the future for being a self-administrative and non-invasive technique, thus causing little discomfort to the patients. Another advantage is that both liquid and dry powder formulations can be given, thus saving the cost spend in transportation via cold chain.
se, both locally and systemically. It is gaining advances in the future for being a self-administrative and non-invasive technique, thus causing little discomfort to the patients. Another advantage is that both liquid and dry powder formulations can be given, thus saving the cost spend in transportation via cold chain. The various devices available for nasal route of vaccination are single dose nasal spray, bi-dose nasal spray, multi-dose pump with tip-seal technology (prevents contamination of bottle content), unit-dose nasal powder delivery system, bi-dose nasal powder delivery system [27] and jet nebulizers. The live, attenuated influenza vaccine (called LAIV) may be given to healthy, non-pregnant people (2 to 49 y of age) as a nasal spray. It is made from attenuated flu virus so it does not cause flu [28]. There are many flu viruses, and they keep on changing every year. Initially it was believed to provide some protection even when the vaccine does not match the current season virus. However, recently, CDC’s Advisory Committee on Immunization Practices (ACIP) declared that it should not be used during the 2016–2017 flu season as studies conducted showed just 3% protective benefit [4].
Initially it was believed to provide some protection even when the vaccine does not match the current season virus. However, recently, CDC’s Advisory Committee on Immunization Practices (ACIP) declared that it should not be used during the 2016–2017 flu season as studies conducted showed just 3% protective benefit [4]. Needle-free nasal immunization with recombinant HBsAg using nanoemulsions (NEs) has also proved to be a safe and effective hepatitis B vaccine, and has provided an alternative booster administration for the parenteral hepatitis B vaccines [29]. NEs (< 400 nm) are emulsions formulated with surfactants, distilled water, refined soybean oil and ethanol as a solvent. Initially they were used as broad-spectrum antimicrobial agents. NEs proved effective as mucosal adjuvants for whole influenza virus, vaccinia viruses, recombinant anthrax protective antigen and HIV gp120 [29]. Suzuki et al. have developed an efficient nasal vaccine delivery system against pneumococcal infection. They fused C-terminal fragment of Clostridium perfringens enterotoxin (C-CPE) with pneumococcal surface protein A (PspA). Nasal immunization with PspA-C-CPE induces PspA-specific IgG in the serum and bronchoalveolar lavage fluid (BALF) as well as IgA in the nasal wash and BALF, which proved sufficient to protect against pneumococcal infection [30].
of Clostridium perfringens enterotoxin (C-CPE) with pneumococcal surface protein A (PspA). Nasal immunization with PspA-C-CPE induces PspA-specific IgG in the serum and bronchoalveolar lavage fluid (BALF) as well as IgA in the nasal wash and BALF, which proved sufficient to protect against pneumococcal infection [30]. Nantachit et al., delivered dengue immunogen (domain III of dengue serotype-3 E protein -EDIII-D3) loaded into trimethyl chitosan nanoparticles (EDIII-D3 TMC NPs) intranasally. This stimulated a strong local innate antiviral response which helped in systemic adaptive immunity [31]. Studies have also been conducted for Ebola virus, which was recently a dreadful outbreak in western Africa. Researchers at The University of Texas at Austin have developed nasal vaccine which provided long-term protection for non-human primates against the deadly Ebola virus. Results from a small pre-clinical study represent the only proof to date that a single dose of a non-injectable vaccine platform for Ebola is long-lasting [32].
rs at The University of Texas at Austin have developed nasal vaccine which provided long-term protection for non-human primates against the deadly Ebola virus. Results from a small pre-clinical study represent the only proof to date that a single dose of a non-injectable vaccine platform for Ebola is long-lasting [32]. Aerosol vaccine delivery involves creating small particles, usually generated by a nebulizer, that reach the lungs [12]. Two types of pulmonary delivery devices are available and useful for vaccination: Dry Powder Inhalers (DPI) and jet nebulizers. Pulmonary vaccine formulations for Hepatitis B virus [33], Measles [34], Tuberculosis [35] and Yersinia pestis are in preclinical research phase. Measles vaccine, MMR (Measles, Mumps, Rubella) vaccine, BCG vaccine, Influenza, Streptococcus pneumoniae and Human Papilloma virus [36] are in clinical research phase. Clinical trials in Mexico and South Africa have demonstrated significantly higher rate of measles seroconversion following measles vaccination and combined rubella and measles vaccination in children after aerosol delivery than after subcutaneous delivery [37, 38]. Animal experiments have also demonstrated efficacy of Mycoplasma hyopneumoniae aerosol vaccine [39]. Most of the successful clinical trials have been done using jet nebulizers but the need for a pressurized (clean) air system and stability concerns of aqueous vaccine formulations limits their applicability in mass vaccination programs. As production of powder formulations for pulmonary administration is a one-step process, it reduces the risks of contaminations and batch-to-batch differences, as well as production costs. Thus, a simple, cheap, compact, disposable, and effective DPI is the most optimal device for pulmonary vaccination for target population.
duction of powder formulations for pulmonary administration is a one-step process, it reduces the risks of contaminations and batch-to-batch differences, as well as production costs. Thus, a simple, cheap, compact, disposable, and effective DPI is the most optimal device for pulmonary vaccination for target population. Transdermal Route Skin has an outermost layer called the stratum corneum, below which lies the viable epidermis that comprises 2% of Langerhans cells. These are extremely effective antigen-presenting cells, and generate an immune response. Vaccination in this cutaneous environment rich in specialized antigen-presenting cells using microneedles and nanopatches has practical and immunological advantages over conventional needle delivery. Microneedles are micro structured projections which range from solid to hollow. There are (i) solid microneedles for skin pretreatment to increase skin permeability, (ii) microneedles coated with drug that dissolves off in the skin, (iii) polymer microneedles that encapsulate drug and fully dissolve in the skin and (iv) hollow microneedles for drug infusion into the skin [40]. Volunteers of clinical studies reported no pain and minimal sensation of these microneedle arrays, likely due to not enough length of these microneedles to stimulate nerves present in the deeper tissues [41].
apsulate drug and fully dissolve in the skin and (iv) hollow microneedles for drug infusion into the skin [40]. Volunteers of clinical studies reported no pain and minimal sensation of these microneedle arrays, likely due to not enough length of these microneedles to stimulate nerves present in the deeper tissues [41]. Microneedles have been employed successfully to vaccinate with diphtheria toxoid adjuvanted with cholera toxin and to increase delivery of a DNA vaccine against hepatitis B, recombinant anthrax vaccine, and live-attenuated Japanese encephalitis vaccine in animal models as well as rabies vaccine in human subjects [40]. Influenza vaccination with coated microneedles has shown complete protection against lethal viral infection after vaccination using H1N1 and H3N2 seasonal strains in mice [40]. Substantially improved immunity resulted following administration of Bacillus Calmette-Guérin (BCG) vaccine in guinea pigs using similar coated-microneedle devices [40]. The World Health officials are aiming to eliminate measles and such a microneedle patch can be the game changer [12]. Study by Levin et al. and Behrens et al. confirmed the immunogenicity and safety of intradermal delivery of virosomal influenza vaccine and vaccine containing heat-labile toxin from Escherichia coli against travellers’ diarrhea respectively in humans [42, 43].
and such a microneedle patch can be the game changer [12]. Study by Levin et al. and Behrens et al. confirmed the immunogenicity and safety of intradermal delivery of virosomal influenza vaccine and vaccine containing heat-labile toxin from Escherichia coli against travellers’ diarrhea respectively in humans [42, 43]. The ‘Nanopatch’ (NP) comprises arrays of densely packed projections with a defined geometry and distribution designed to physically target vaccines directly to thousands of epidermal and dermal antigen presenting cells [44]. These miniaturized arrays are smaller than standard needles used for vaccination and are also much smaller than current microneedle arrays. The NP immunization has been seen to be efficient using commercial available influenza vaccine antigen [45], inactivated whole chikungunya virus vaccine and DNA-delivered attenuated West Nile virus vaccine [44].
maller than standard needles used for vaccination and are also much smaller than current microneedle arrays. The NP immunization has been seen to be efficient using commercial available influenza vaccine antigen [45], inactivated whole chikungunya virus vaccine and DNA-delivered attenuated West Nile virus vaccine [44]. Others Another mode of vaccine delivery known for more than 50 y is via jet injectors. Jet injectors are needle-free devices that deliver a prescribed drug, vaccine, or compound intradermally, subcutaneously, or intramuscularly via high pressure produced by either a carbon-dioxide-filled or nitrogen-filled cartridge or a spring [12]. Antigens delivered by jet injectors are dispersed more widely in the tissue because of high pressure of the fluid stream allowing for a larger contact volume between the vaccine antigen and immune cells. Several studies have shown that it elicits higher antibody titers and seroconversion rates than traditional needle and syringe [12]. Earlier, multiuse-nozzle jet injectors were used that delivered vaccine through the same fluid stream and nozzle to multiple patients. It was commonly used for vaccinating military personnel, and for other mass immunization campaigns. However, when the year 1985 witnessed an outbreak of hepatitis B infection due to contamination of the jet injector by body fluids, health authorities, including the Department of Defense and the World Health Organization, discontinued the use of multiuse-nozzle jet injectors.
and for other mass immunization campaigns. However, when the year 1985 witnessed an outbreak of hepatitis B infection due to contamination of the jet injector by body fluids, health authorities, including the Department of Defense and the World Health Organization, discontinued the use of multiuse-nozzle jet injectors. Now-a-days disposable-cartridge jet injectors, where fluid stream is delivered within a disposable vaccine cartridge and nozzle, with a new cartridge and nozzle for each patient and no splash back of blood are under development. Biovalve’s Mini-Ject, Bioject and Powderject are few developing technologies for vaccination. Trials are underway to deliver Inactivated polio vaccine, Measles-Mumps-Rubella vaccine, Yellow fever vaccine, DTP-Hib-hep B vaccine, BCG vaccine and rabies vaccine by jet injection technology [12]. On August 15, 2014, the U.S. Food and Drug Administration (FDA) approved use of one jet injector device (the PharmaJetStratis) for delivery of one particular flu vaccine in individuals 18 through 64 y of age [46]. However post-vaccination, patients have reported tenderness, swelling, pain, redness, itching and bruising at the site of vaccination.
Food and Drug Administration (FDA) approved use of one jet injector device (the PharmaJetStratis) for delivery of one particular flu vaccine in individuals 18 through 64 y of age [46]. However post-vaccination, patients have reported tenderness, swelling, pain, redness, itching and bruising at the site of vaccination. Epidermal powder immunization (EPI) is similar to liquid jet injection, but here dried-powder particles of vaccine, rather than liquid, are injected into the skin at supersonic speed. Another similar concept is particle-mediated epidermal delivery (PMED) in which DNA vaccine coated on gold microparticles are shot into the skin. Clinical studies of PMED immunization are promising but immunogenic responses were low compared to conventional vaccination methods [47]. As a whole, jet injection offers multiple benefits. They are less painful, thus improve compliance, reduce risks of needle-stick injuries and cross-contamination, eliminate the need for “sharps” disposal, and ensure reliable, reproducible, and accurate delivery of medication with minimal training.
Epidermal powder immunization (EPI) is similar to liquid jet injection, but here dried-powder particles of vaccine, rather than liquid, are injected into the skin at supersonic speed. Another similar concept is particle-mediated epidermal delivery (PMED) in which DNA vaccine coated on gold microparticles are shot into the skin. Clinical studies of PMED immunization are promising but immunogenic responses were low compared to conventional vaccination methods [47]. As a whole, jet injection offers multiple benefits. They are less painful, thus improve compliance, reduce risks of needle-stick injuries and cross-contamination, eliminate the need for “sharps” disposal, and ensure reliable, reproducible, and accurate delivery of medication with minimal training. Conclusions The future of immunization depends on the how successfully we are able develop methods for vaccination that are simpler to administer, do not need cold chain for their maintenance, provide long-lasting immune response with minimal side-effects and, most importantly in a child-friendly way. Needle-free and painless vaccination will ensure improved safety for the vaccinator, vaccinee, and community; improved compliance with immunization schedules; reduced anxiety and pain related to injection; easier and speedier vaccine delivery with reduced cost of production, storage and transportation. This will mean less healthcare training needed to give vaccines, especially in mass vaccinations on national or sub-national immunization days (campaigns), natural pandemics, and bioterrorism emergencies.
ted to injection; easier and speedier vaccine delivery with reduced cost of production, storage and transportation. This will mean less healthcare training needed to give vaccines, especially in mass vaccinations on national or sub-national immunization days (campaigns), natural pandemics, and bioterrorism emergencies. Contributions The main manuscript was prepared by NG and it was revised by critical outputs from AA. AA will act as guarantor for the paper. Compliance with Ethical Standards Conflict of Interest None. Source of Funding None.
Introduction A century has elapsed since the most fatal epidemic known in mankind which killed over 50 million people – the Spanish influenza pandemic of 1918. India was the focal point of this pandemic in terms of mortality with deaths between 10 and 20 million (about 8% of the population at that time). The epidemic in India originated in Bombay in September 1918 where the troops infected with influenza returned from the First World War [1]. Several pandemics have followed with lower mortality and morbidity in the years 1957 (Asian flu), 1968 (Hongkong flu) and 2009 (Swine flu) [2]. Despite the advances in diagnostics, antiviral drugs and vaccines the threat of a severe pandemic like 1918 looms large as the novel Influenza A viruses of avian or swine origin continue to infect the humans. Sporadic cases of Influenza occur throughout the year. Transmission of the virus depends on two important environmental factors – temperature and humidity. Epidemics in temperate zones generally occur in dry and cold winters as the influenza virus is known to be more stable in cold with greatest transmission at 5 °C and least above 30 °C [3]. However these transmission dynamics cannot be applied to tropical countries where the average humidity and temperatures are higher and epidemics are observed during the monsoons. Diurnal variations in humidity and temperature and household exposures have been postulated as possible mechanisms in these regions though the exact reasons for monsoon peaks in tropics remain elusive [4].
l countries where the average humidity and temperatures are higher and epidemics are observed during the monsoons. Diurnal variations in humidity and temperature and household exposures have been postulated as possible mechanisms in these regions though the exact reasons for monsoon peaks in tropics remain elusive [4]. As of 14th July 2019, the data from National Centre of Disease Control reported over 26,000 cases and 1000 deaths due to influenza since the beginning of this year even when the peak season had just begun [5]. Influenza surveillance studies from India have identified three major patterns of influenza circulation: Srinagar situated in north most part (latitude of 34° N) has its peak circulation like temperate regions during the winter (January–April) probably due to the climatic similarity. Late monsoon peaks have been observed at the opposite end in Chennai and Vellore situated in the South west. Whereas rest of India has peak activity coinciding with the rains (June–October) with minor peaks during winter [6]. This has a significant relevance for vaccination strategy for India. The incubation period is about 1–2 d with a range of 1–4 d [7]. The viral shedding occurs from the day prior to symptoms and lasts for about 3–5 d in adults and for several weeks in young children and immunocompromised. The primary mode of transmission of the virus is by large size droplets. Particles <10 μm in diameter are more likely to cause infection in the lower respiratory tract.
viral shedding occurs from the day prior to symptoms and lasts for about 3–5 d in adults and for several weeks in young children and immunocompromised. The primary mode of transmission of the virus is by large size droplets. Particles <10 μm in diameter are more likely to cause infection in the lower respiratory tract. Influenza Virus Influenza viruses A, B and C belong to Orthomyxoviridae family and are enveloped negative strand RNA viruses. Negative means they have opposite polarity of the RNA that forms template for protein synthesis required for their viral replication. Though the three viruses have a common genetic ancestry, genetic reassortment is limited to within each specific virus genus and not across the types. The surface glycoproteins present on the envelope of the virus – hemagglutinin (HA), and neuraminidase (NA) play a critical role in their pathogenesis as well as form the main targets for neutralizing antibodies against the virus. In 1980, WHO established a standard nomenclature for identifying the influenza viruses. It consists of the antigenic type (A, B or C); host of origin (in case the virus has not been isolated from humans); geographical region of origin; number of lineage; year of isolation and, for Influenza A viruses only, HA and NA subtype, described by letter and number, H1 to H16 known to date, and N1 to N9 [8]. For example, the pandemic Influenza A of 2009 is denoted as A/California/04/2009(H1N1) for Influenza type A, isolated first in California, lineage number 04, year of 2009 and type H1N1.
ation and, for Influenza A viruses only, HA and NA subtype, described by letter and number, H1 to H16 known to date, and N1 to N9 [8]. For example, the pandemic Influenza A of 2009 is denoted as A/California/04/2009(H1N1) for Influenza type A, isolated first in California, lineage number 04, year of 2009 and type H1N1. Pathogenesis HA binds to the sialic acid residues expressed on the columnar epithelial cells of the respiratory tract and the alveolar type II cells. It is important to note that Avian influenza viruses preferentially bind to sialic acids via alpha 2,3 linkages present on alveolar type II cells and ocular epithelium [9] while human influenza viruses bind to 2,6 linked sialic acids present in the upper respiratory tract epithelium. Due to localisation of the human influenza virus mainly to the upper respiratory tract, there is greater risk of transmission of human influenza viruses than Avian flu [10]. However strains that are able to infect the lower respiratory tract cause more inflammation and severe complications. For example, H1N1 pandemic flu of 1918 was both highly transmissible as well as virulent, while the 2009 H1N1 was highly transmissible but had moderate virulence. As opposed, H5N1 and H7N9 have low transmissibility but high virulence [11].
ct the lower respiratory tract cause more inflammation and severe complications. For example, H1N1 pandemic flu of 1918 was both highly transmissible as well as virulent, while the 2009 H1N1 was highly transmissible but had moderate virulence. As opposed, H5N1 and H7N9 have low transmissibility but high virulence [11]. The HA attachment results in endocytosis of the virion and fusion with the endoplasmic membrane which in turn activates the matrix protein 2 (M2) ion channel. M2 facilitates the virion entry into the host nucleus for replication. The Influenza A viruses carry 8 negative sense RNA segments. These negative sense RNAs therefore require RNA polymerase carried with the virus into the cell to be copied onto the template. Viral replication includes the stages of assembly, budding and scission. NA helps to release these newly formed virions which are either expelled through the tract by droplet secretions or infect other cells. In this manner the virus spreads from cell to cell. The immune response of the host’s body to clear the virus can result in cell apoptosis. In severe cases necrosis of the alveolar epithelium can occur which clinically leads to acute respiratory distress. Either or both the impaired viral clearance and exaggerated host immune response can account for the severity of the illness [12].
ol group (333.2 ± 79.7 vs. 199.9 ± 26.7 pg/ml; P = 0.115). Compared with serum angiopoietin-2 levels in the control and non-pulmonary edema groups, angiopoietin-2 in the pulmonary edema group was higher (both, P < 0.001). # P < 0.01 compared with the control group. ▼ P < 0.01 compared with the non-pulmonary edema group After reaching confluence, the HPMEC monolayers were incubated for 24 h with low levels of serum Ang-2 (121.6 pg/ml) from healthy infants, and the links between the HPMECs were observed to be intact (Fig. 2a–c). When the HPMEC monolayers were incubated with recombinant human Ang-2 (final concentration, 4414.4 pg/ml) from PE infants, actin stress fibers were stained, whereas VE-cadherin staining was attenuated, and endothelial gaps were noted (Fig. 2d–f). The same effects were observed when recombinant Ang-2 was substituted with serum from PE infants for incubation with the HPMEC monolayers (Ang-2 concentration adjusted to 4414.4 pg/ml; Fig. 2g–i). When the HPMEC monolayers were simultaneously incubated with recombinant human Ang-1 (10 ng/ml) and serum from PE infants (Ang-2, 4414.4 pg/ml), a significant attenuation in stress fiber formation and maintenance of VE-cadherin cell junctions were noted (Fig. 2j–l). The links between the endothelial cells were relatively intact without gaps.Fig. 2 Serum from infants with pulmonary edema had disrupted endothelial architecture that was reversed by recombinant human angiopoietin (Ang)-1. Ang-2 (121.6 pg/ml) from the serum of healthy infants was incubated with human pulmonary microvascular endothelial cell monolayers to examine the effects on the endothelial architecture (a–c). Recombinant human Ang-2 (4414.4 pg/ml) induced thick actin stress fibers and intercellular gap formation (d–f). The same effect was observed when HPMEC monolayers were incubated with high concentrations of Ang-2 serum (4414.4 pg/ml) from infants with PE (g–i). The gap effect was reversed by the addition of 10 ng/ml recombinant human Ang-1 (j–l). Arrows indicate intercellular gaps
ponse of the host’s body to clear the virus can result in cell apoptosis. In severe cases necrosis of the alveolar epithelium can occur which clinically leads to acute respiratory distress. Either or both the impaired viral clearance and exaggerated host immune response can account for the severity of the illness [12]. Antigenic Shift and Drift The HA glycoprotein is constantly evolving and the minor antigenic changes occur through accumulation of spontaneous point mutations to form antigenically distinguishable strains with very limited cross-sectional genetic diversity. This phenomenon is referred to as antigenic drift and occurs in Influenza A, B and C viruses. When a sudden genetic reassortment takes place with a creation and introduction of a novel HA, NA or both segments from a zoonotoic reservoir into the currently circulating human viruses, it is called as an antigenic shift. This phenomenon occurs only in Influenza A. For example antigenic shift took place with swine H1N1 in 1918 then later to H2N2 in 1957 and to H3N2 in 1968 with re-introduction and co-circulation of H1N1 since 1977 [13]. The consequences are dramatic as it affects an immunologicaly naive population and results in an unpredictable pandemic. Clinical Manifestations Over 50% of infections can be asymptomatic. Symptoms include acute onset of high fever, coryza, cough, headache, prostration, malaise which persist for 7 to 10 d. Fatigue associated with this illness take weeks to resolve.
Antigenic Shift and Drift The HA glycoprotein is constantly evolving and the minor antigenic changes occur through accumulation of spontaneous point mutations to form antigenically distinguishable strains with very limited cross-sectional genetic diversity. This phenomenon is referred to as antigenic drift and occurs in Influenza A, B and C viruses. When a sudden genetic reassortment takes place with a creation and introduction of a novel HA, NA or both segments from a zoonotoic reservoir into the currently circulating human viruses, it is called as an antigenic shift. This phenomenon occurs only in Influenza A. For example antigenic shift took place with swine H1N1 in 1918 then later to H2N2 in 1957 and to H3N2 in 1968 with re-introduction and co-circulation of H1N1 since 1977 [13]. The consequences are dramatic as it affects an immunologicaly naive population and results in an unpredictable pandemic. Clinical Manifestations Over 50% of infections can be asymptomatic. Symptoms include acute onset of high fever, coryza, cough, headache, prostration, malaise which persist for 7 to 10 d. Fatigue associated with this illness take weeks to resolve. In general, influenza illness is self limiting. High risk factors for developing complications are elderly, children, pregnant women and those with chronic conditions like asthma, hematological disorders, neurological disorders, metabolic disorders, congenital heart disorders and being immunocompromised [14].
Clinical Manifestations Over 50% of infections can be asymptomatic. Symptoms include acute onset of high fever, coryza, cough, headache, prostration, malaise which persist for 7 to 10 d. Fatigue associated with this illness take weeks to resolve. In general, influenza illness is self limiting. High risk factors for developing complications are elderly, children, pregnant women and those with chronic conditions like asthma, hematological disorders, neurological disorders, metabolic disorders, congenital heart disorders and being immunocompromised [14]. Primary viral pneumonia, acute respiratory distress syndrome (ARDS) and pulmonary edema occur due to bronchiolar and alveolar cytopathology and cytokine storm. Secondary bacterial pneumonia post-influenza usually occurs during resolution, however 32% of patients with viral pneumonia can develop a concomitant bacterial pneumonia which is clinically challenging to distinguish [15]. Streptococcus pneumoniae is the commonest causative organism of secondary bacterial pneumonia in children. The viral-bacterial synergism is not clearly understood but the damaged respiratory epithelial lining with facilitation of access to the receptors, viral suppression of the neutrophil functions and even direct interaction between the virus on the surface of gram positive bacteria like Streptococcus pneumoniae and Staphylococcus aureus have been proposed as possible mechanisms [16].
damaged respiratory epithelial lining with facilitation of access to the receptors, viral suppression of the neutrophil functions and even direct interaction between the virus on the surface of gram positive bacteria like Streptococcus pneumoniae and Staphylococcus aureus have been proposed as possible mechanisms [16]. It has been estimated that 3–5% of children suffer from influenza associated acute otitis media annually. Co-infection with bacteria increases the severity of the infection. Influenza associated myositis presents with severe bilateral myaligia in the lower limbs and reluctance to walk for about 2–3 d. The most common muscles affected are the gastrocnemius and soleus. In these children the creatinine phosphokinase can be high, myoglobinuria can also occur. Rarely rhabdomyolysis has been reported [17]. The commonest neurological complication is febrile seizures, reported in about 5% infants and young children. Influenza associated encephalopathy can occur due to direct infection of the central nervous system through viremia and presents as sudden onset of fever with convulsions and rapid progression into coma and can cause severe neurological deficits in survivors. Imaging may reveal bilateral thalamic necrosis and brainstem involvement. Fulminant myocarditis is a rare complication presenting with arrhythmias and cardiogenic shock. Hematological picture can vary from mild to severe leucopenia, thrombocytopenia including a serious complication of hemophagocytic lymphohistocytosis (HLH).
g may reveal bilateral thalamic necrosis and brainstem involvement. Fulminant myocarditis is a rare complication presenting with arrhythmias and cardiogenic shock. Hematological picture can vary from mild to severe leucopenia, thrombocytopenia including a serious complication of hemophagocytic lymphohistocytosis (HLH). Death due to influenza occurs either due to the primary virulent infection or secondary bacterial infection or an increase in physiological load in a person with an underlying chronic condition. Diagnosis The availability of the nucleic acid amplification test (NAAT) test like the Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) has revolutionised the diagnosis of influenza. These are highly sensitive and specific and are regarded as the gold standard assays. Loop-Mediated Isothermal Amplification-Based Assay (LAMP) based approach have also demonstrated a very high sensitivity of 98% and specificity of 100% when compared to RT-PCR assays [18]. The major limitation of the NAAT bases tests is the high cost in resource-limited settings. The cheaper, Rapid Influenza Diagnostic tests (RIDT) using monoclonal antibodies are available for point of care. But the results are dependent on the prevalence of influenza with greater positive predictive value and false positives occurring in peak periods of influenza circulation.
cost in resource-limited settings. The cheaper, Rapid Influenza Diagnostic tests (RIDT) using monoclonal antibodies are available for point of care. But the results are dependent on the prevalence of influenza with greater positive predictive value and false positives occurring in peak periods of influenza circulation. Virus can be traditionally isolated by inoculation of specimen into permissive cell lines or embryonated eggs or it can be isolated with a quicker turn-around time of 1.4 d by propagation of viruses in mammalian cells grown in shell vials (Shell Vial Culture). Direct Fluorescent antibody tests have a reasonable good sensitivity of 60–80% in comparison with viral cultures for seasonal flu, its sensitivity varied between 38 and 93% during the pandemic H1N1 when compared to the PCR results. These can differentiate Influenza A and B viruses but cannot be used for subtyping. Serological tests help to determine presence of influenza specific antibodies following infection and vaccination. Most commonly used are Hemagluttination Inhibition Assay (HIA) and Virus Neutralisation Assay (VN) and Enzyme Immunoassays (EIA), but these tests have lower sensitivities compared to NAAT tests.
Direct Fluorescent antibody tests have a reasonable good sensitivity of 60–80% in comparison with viral cultures for seasonal flu, its sensitivity varied between 38 and 93% during the pandemic H1N1 when compared to the PCR results. These can differentiate Influenza A and B viruses but cannot be used for subtyping. Serological tests help to determine presence of influenza specific antibodies following infection and vaccination. Most commonly used are Hemagluttination Inhibition Assay (HIA) and Virus Neutralisation Assay (VN) and Enzyme Immunoassays (EIA), but these tests have lower sensitivities compared to NAAT tests. Treatment The neuroaminase inhibitors like Oseltamivir and Zanamivir are the mainstay for treatment and help to inhibit the neuraminase which plays a critical role for cleavage of virion from infected cells and its spread to other host cells. Presently Oseltamivir is recommended as the first-line for treatment of influenza in children. It is less efficacious in treatment of Influenza B than A. The indications for initiating treatment are in those children with suspected influenza with high risk of complications or with severe illness requiring hospitalization. The dosage recommended are based on weight: 30 mg twice a day in less than 15 kg, 45 mg twice a day between 15 and 23 kg, 60 mg twice a day between 24 and 40 kg and 75 mg twice a day above 40 kg and in adults. In infants the recommended dose is 3 mg/kg twice a day while once a day dose is recommended in neonates less than 2 wk. The drug is best administered with food to reduce its gastrointestinal side-effects, commonest being vomiting. Dose modification is required in those with renal insufficiency. The treatment duration is five days, but longer duration can be given based on the clinical response. Such patients requiring longer duration of drug should be evaluated for antiviral resistance. Resistance should also be suspected in contacts of patients with Oseltamivir resistance who develop infection.
nsufficiency. The treatment duration is five days, but longer duration can be given based on the clinical response. Such patients requiring longer duration of drug should be evaluated for antiviral resistance. Resistance should also be suspected in contacts of patients with Oseltamivir resistance who develop infection. The alternative antiviral, Zanamivir given by inhalation is approved for age more than 7 y and should not be given in those with underlying airway disease. The older antivirals, Amantidine and Rimatidine are no longer recommended since 2006 due to the increased global resistance causing treatment failures.
nsufficiency. The treatment duration is five days, but longer duration can be given based on the clinical response. Such patients requiring longer duration of drug should be evaluated for antiviral resistance. Resistance should also be suspected in contacts of patients with Oseltamivir resistance who develop infection. The alternative antiviral, Zanamivir given by inhalation is approved for age more than 7 y and should not be given in those with underlying airway disease. The older antivirals, Amantidine and Rimatidine are no longer recommended since 2006 due to the increased global resistance causing treatment failures. There are several challenges in the pharmaceutical treatment of influenza. Varying efficacy of the antiviral drugs, increasing resistance of antivirals available and unavailability of parenteral formulations for use in severe patients are some of these challenges. Influenza A (H1N1) viruses resistant to Oseltamivir have been reported in children with higher frequency than adults due to relatively higher viral load [19]. The Global Influenza Surveillance and Response System (GISRS) tested 27,000 H1N1 viruses from 2009 to 2011 and detected Oseltamivir resistance in 447 viruses [20]. Of these majority were reported from the Western Pacific region of the WHO. Fourteen percent were from patients who had not been exposed to Oseltamivir, indicating either a spontaneous neuraminase His275Tyr mutation or nosocomial acquisition of the resistant strain. Immunocompromised patients, especially those with hematological malignancies or hematopoietic stem cell transplantation (HSCT) were noted to have the highest risk of Oseltamivir resistance because of suboptimal dosing during prophylaxis or disruption in treatment during viral replication [20].
of the resistant strain. Immunocompromised patients, especially those with hematological malignancies or hematopoietic stem cell transplantation (HSCT) were noted to have the highest risk of Oseltamivir resistance because of suboptimal dosing during prophylaxis or disruption in treatment during viral replication [20]. Baloxavir Marboxil was approved by FDA in October 2018 for use in patients with uncomplicated influenza aged above 12 y and weighing above 40 kg, who present within 48 h of onset of illness [21]. This oral antiviral inhibits viral replication by targeting the endonuclease function encoded by the polymerase acidic subunit of the viral polymerase. It has shown broad antiviral activity against all known types of Influenza (A, B, C and D) and the Influenza A viruses of avian and swine origin which have the potential to cause pandemic [22]. Two intravenous NIs, Peramivir and Zanamivir, are currently undergoing clinical trials [19]. Laninamivir Octanoate has been evaluated in randomised control trials and have shown good tolerance and efficacy in children aged 9 y and under with Oseltamivir-resistant influenza A (H1N1) virus infection [23]. Combination therapy is also being evaluated for treatment of severe influenza strains which have likely susceptibility to M2 inhibitors [19].
aluated in randomised control trials and have shown good tolerance and efficacy in children aged 9 y and under with Oseltamivir-resistant influenza A (H1N1) virus infection [23]. Combination therapy is also being evaluated for treatment of severe influenza strains which have likely susceptibility to M2 inhibitors [19]. Prevention and Infection Control Annual vaccination against influenza remains the primary mode of prevention against influenza. The vaccines are effective only if there is antigenic matching of the vaccine strains with the circulating virus strains. After the matching is performed by the GISRS, the majority of commercially available vaccines are manufactured by propagation in embryonated chicken eggs. It takes at least 6–8 mo for production of these vaccines. Moreover, the flu seasons are different in both hemispheres i.e., October–May in the northern hemisphere and May–October in the southern hemisphere. Therefore the matching process is completed twice a year, once each for the two hemispheres. Indian surveillance data suggest that, based on the geographical diversity of transmission dynamics, cities above 30° latitude (Srinagar) and those with late monsoon season (Chennai and Vellore) should have winter vaccination strategies, while rest of the country in May–June [6].
ear, once each for the two hemispheres. Indian surveillance data suggest that, based on the geographical diversity of transmission dynamics, cities above 30° latitude (Srinagar) and those with late monsoon season (Chennai and Vellore) should have winter vaccination strategies, while rest of the country in May–June [6]. At present, trivalent and quadrivalent formulations are available, which include an H1N1 strain, an H3N2 strain and one or two Influenza B strains belonging to evolutionarily diverging lineages – B/Victoria or B/Yamagata. The estimated protection of these vaccines is roughly about 60% in adults and 83% in children [24]. Efforts are underway for production of the “universal” influenza vaccine which are not dependent on this annual labor intensive matching but target certain protein regions common to the seasonal and pre-pandemic strains. The two leading candidates for universal vaccines include the highly conserved stem region of the HA and the M2 protein [25].
roduction of the “universal” influenza vaccine which are not dependent on this annual labor intensive matching but target certain protein regions common to the seasonal and pre-pandemic strains. The two leading candidates for universal vaccines include the highly conserved stem region of the HA and the M2 protein [25]. Routine chemoprophylaxis to contacts should be avoided, except to control an institutional outbreak, because of concerns of sub therapeutic dosing of the antiviral in case the infection is established. Chemoprophylaxis is best offered to children above 3 mo or adults who have high risk of complications from influenza or in those in whom influenza vaccination is either contraindicated, not available or may not be effective. Post-exposure chemoprophylaxis is not recommended after 48 h of first exposure to a person with influenza. Either oral Oseltamivir (for above 3 mo of age) or inhaled Zanamivir (for above 7 y of age) is recommended for chemoprophylaxis when indicated. Early initiation of empiric treatment for contacts on development of fever or respiratory symptoms is an alternative to post-exposure chemoprophylaxis [26].
son with influenza. Either oral Oseltamivir (for above 3 mo of age) or inhaled Zanamivir (for above 7 y of age) is recommended for chemoprophylaxis when indicated. Early initiation of empiric treatment for contacts on development of fever or respiratory symptoms is an alternative to post-exposure chemoprophylaxis [26]. Annual influenza vaccination of health care workers is critical for protection and infection control. Cough and sneezing etiquettes and hand hygiene are important for control of influenza infection both in the community and the health care settings. Health education through local media or posters displayed at health care settings can help as reminders. Since influenza primarily spreads by large particle droplet transmission, about 6 ft space surrounding the patient is considered infectious. All the body fluids of the patient are also considered infectious as indirect transmission through contact can also occur. In health care settings, patients can be cohorted or should stay in individual rooms. Droplet precautions and hand hygiene should be performed by attending health care workers and attendants. Gloves and gowns are required for personal protection if there is potential exposure to infected body fluids. Aerosol producing procedures should be minimized, ideally conducted in negative pressure rooms and protection with N95 mask is needed by the health care personnel conducting such procedures.
ers and attendants. Gloves and gowns are required for personal protection if there is potential exposure to infected body fluids. Aerosol producing procedures should be minimized, ideally conducted in negative pressure rooms and protection with N95 mask is needed by the health care personnel conducting such procedures. Surveillance and Pandemic Preparedness The GISRS of WHO has a robust network of laboratories spread across the globe which is to be notified of any case of human infection due to a new Influenza A virus subtype within 24 h of its detection. These laboratories constantly survey the genetic and antigenic characteristics of circulating influenza viruses. However, there is more work needed to be done for capacity building for diagnostics in the middle- and low-income countries which bear the maximum brunt of the pandemic. Also the production time for vaccine needs to be reduced along with better availability of efficacious and safe antiviral drugs during such a pandemic [2]. In the efforts to address many of these challenges, in 2019, WHO established the Global Influenza Strategy 2019–2030. The four strategic objectives outlined are to promote research, strengthen global surveillance, expand seasonal influenza prevention to protect the vulnerable and strengthen pandemic preparedness [27].
In the efforts to address many of these challenges, in 2019, WHO established the Global Influenza Strategy 2019–2030. The four strategic objectives outlined are to promote research, strengthen global surveillance, expand seasonal influenza prevention to protect the vulnerable and strengthen pandemic preparedness [27]. Summary Influenza, like a chameleon is an ever changing virus and continues to keep humans on their toes. Over the hundred years since the 1918 flu epidemic, there have been considerable advances in the understanding of pathogenesis, diagnostics, antiviral drugs and vaccination strategies. But despite the progress, the global preparedness for the next pandemic remains suboptimal. Not forgetting that the greatest impact of the pandemic was suffered by India, the Indian health authorities need to gear up with greater urgency in capacity building for clinical support and preventive measures. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Compliance with Ethical Standards Conflict of Interest None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 7744460 BF02751724 10.1007/BF02751724 Clinical Briefs Cranial MRI findings in acute disseminated encephalomyelitis Dirik Eray 1 Taskin Figen 1 Kovanlikaya Ilhami 2 1 grid.21200.310000000121839022Department of Pediatric Neurology, Dokuz Eyll University, Faculty of Medicine, Inciralti, Izmir, Trkiye 2 grid.21200.310000000121839022Department of Pediatric Radiology, Dokuz Eyll University, Faculty of Medicine, Inciralti, Izmir, Trkiye 1994 61 5 578 583 Dr. K C Chaudhuri Foundation 1994This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Keywords Optic NeuritisGanglioneuromaAcute Disseminate EncephalomyelitisCorona RadiataPosterior Mediastinal Massissue-copyright-statement Dr. K C Chaudhuri Foundation 1994
ess fibers and intercellular gap formation (d–f). The same effect was observed when HPMEC monolayers were incubated with high concentrations of Ang-2 serum (4414.4 pg/ml) from infants with PE (g–i). The gap effect was reversed by the addition of 10 ng/ml recombinant human Ang-1 (j–l). Arrows indicate intercellular gaps Discussion The pathogenesis of PE can be subcategorized into two mechanisms: elevated pulmonary hydrostatic pressure and increased pulmonary capillary permeability; the treatment for each type differs accordingly. The mechanism of EV71-induced PE remains unclear. One study reported that in PE caused by elevated pulmonary hydrostatic pressure, the P/S ratio of total protein is less than 0.60, whereas the P/S ratio of albumin is less than 0.7 [12]. In the present study, the authors found that the P/S ratio of total protein was 0.9 ± 0.2, and the P/S ratios of albumin were greater than 1.0 ± 0.3, which indicated that EV71-induced PE is associated with increased pulmonary capillary permeability. Wu et al. used pulmonary artery catheterization to monitor pulmonary circulation hemodynamics in 5 infants with EV71-induced PE and found that pulmonary arterial pressure and pulmonary artery wedge pressure were normal or slightly elevated [3], which suggested that PE is not caused by elevated hydrostatic pressure of pulmonary capillaries. The present clinical data showed that infants with PE had noticeable tachycardia, high blood pressure, and other signs of symptomatic nervous system; however, myocardial enzymogram, the images of heart and left ventricle ejection fraction were basically normal. Treatments such as heart strengthening and diuresis had no effect. Therefore, none of these clinical data support the hypothesis that EV71-induced PE is associated with elevated hydrostatic pressure.
system; however, myocardial enzymogram, the images of heart and left ventricle ejection fraction were basically normal. Treatments such as heart strengthening and diuresis had no effect. Therefore, none of these clinical data support the hypothesis that EV71-induced PE is associated with elevated hydrostatic pressure. Other studies have shown that Ang-2 is related to increased vascular permeability [9, 13]. In ARDS, in which vascular leakage is the major pathophysiological basis, Ang-2 is associated with development and prognosis [14, 15]. In the present study, the authors measured the levels of Ang-2 in the serum and PE fluid and found that compared with the Ang-2 serum levels in the non-PE and control groups, that in the PE group was significantly higher, and the Ang-2 level in the PE fluid was similar to or slightly higher than that in the serum, which indicated that Ang-2 may be related to the development of EV71-induced PE.
Introduction Respiratory tract infections are a leading cause of morbidity and mortality worldwide. All classes of microorganisms including viruses, bacteria and protozoa are capable of infecting the respiratory tract [1]. A variety of viruses, including respiratory syncytial virus (RSV), influenza virus, parainfluenza virus, adenovirus, coronavirus and picornavirus, are associated with different respiratory syndromes in all age groups [2]. In half of the upper respiratory tract infections (URTI) in children, an infectious cause cannot be determined [3].Also the etiology of a majority of lower respiratory tract infections (LRTI) is thought to be viral [4], yet in only 40% of cases a viral agent can be identified [5]. These observations suggest that unknown pathogens may be responsible for a substantial proportion of respiratory tract diseases [5]. Recently, an increasing number of studies demonstrated that the human metapneumovirus (hMPV) causes mild to severe respiratory infections in both sexes of all ages in different countries of the world and may be a frequent but somewhat undervalued pathogen [6]. hPMV induces clinical symptoms ranging from upper to lower respiratory illness such as bronchiolitis, bronchitis and pneumonia [7].
tapneumovirus (hMPV) causes mild to severe respiratory infections in both sexes of all ages in different countries of the world and may be a frequent but somewhat undervalued pathogen [6]. hPMV induces clinical symptoms ranging from upper to lower respiratory illness such as bronchiolitis, bronchitis and pneumonia [7]. hMPV grows poorly in cell culture. The replication of hMPV in vitro is restricted to a limited number of cell lines. A more important defect is the long incubation cycle [7]. These properties may explain why the virus was not identified until recently [7]. hMPV-specific antibodies have been developed for immunofluorescence assays, though this method may not be as sensitive as RT-PCR for the detection of hMPV [8]. As infections with hMPV are universal, serologic testing for diagnosis can only help if four fold increases in antibody titers or seroconversion is demonstrated [9]. Currently, RT-PCR is the most common method used to detect hMPV. Several genes of hMPV have been primer targets for genomic amplification. Cote et al. [10], reported that primers that bind regions of the N and L genes are highly sensitive for the detection of hMPV strains of both genotypes.
hMPV grows poorly in cell culture. The replication of hMPV in vitro is restricted to a limited number of cell lines. A more important defect is the long incubation cycle [7]. These properties may explain why the virus was not identified until recently [7]. hMPV-specific antibodies have been developed for immunofluorescence assays, though this method may not be as sensitive as RT-PCR for the detection of hMPV [8]. As infections with hMPV are universal, serologic testing for diagnosis can only help if four fold increases in antibody titers or seroconversion is demonstrated [9]. Currently, RT-PCR is the most common method used to detect hMPV. Several genes of hMPV have been primer targets for genomic amplification. Cote et al. [10], reported that primers that bind regions of the N and L genes are highly sensitive for the detection of hMPV strains of both genotypes. A previous study [11] done in Egypt found a prevalence of 13.6% of human metapneumovirus in adult patients with lower respiratory tract infections. To the best of the authors’ knowledge, hMPV has not been studied previously among children in Egypt. Hence, this study is planned to determine the frequency, epidemiology and clinical characteristics of this virus in children with respiratory tract infection manifestations using a rapid fairly accurate test, RT-PCR.
s. To the best of the authors’ knowledge, hMPV has not been studied previously among children in Egypt. Hence, this study is planned to determine the frequency, epidemiology and clinical characteristics of this virus in children with respiratory tract infection manifestations using a rapid fairly accurate test, RT-PCR. Material and Methods This study was carried out in outpatients’ clinic of Mansoura University Children Hospital (MUCH), Egypt during the calendar year of 2010. Mansoura is the largest city in the northeast of Egypt. Outpatients’ clinic offers daily free services to all sick children. According to the hospital statistics, a total of 35,268 children attended the outpatients’ clinic during the study period. Acute respiratory infection (ARI) accounted for about one-third of diagnoses. Six hundred children were included in the study after the consent of their parents. Depending on the logistics and parents’ agreement, 600 child were included (600/11,756 =5.1% of children with ARIs). Data and specimen (nasopharyngeal aspirate) collection were carried out 3 d per wk. Children with ARIs diagnosed during the day were enlisted and a systematic random sample of them was selected (one case per fixed number of cases) for specimen collection. The number specimens collected varied from 3 to 5 per day according to the number of children with ARIs. The research protocol was approved by the research ethics committee of Faculty of Medicine, Mansoura University and by the Administration of MUCH.
significant proportion of both upper and lower acute respiratory infection in infants and young children [12, 13]. Because of the unavailability of rapid antigenic detection assays in the past and slow growth in tissue culture, molecular methods have become the method of choice for the diagnosis of hMPV infection [10]. In the present study, the incidence of hMPV was 8%. This result is more or less similar to previous studies in other countries with incidence ranging from 5 to 10% in children with ARI cases [14–20]. Higher detection rates were reported from some countries [21, 22] while lower levels observed in some studies [23, 24]. This variation could be attributed to different localities, age group, genetic susceptibility, sampling technique and detection method. Epidemiological findings suggest that hMPV may circulate worldwide and may have a seasonal distribution in winter months for temperate and spring/summer for tropical countries [13, 25]. In this study incidence of hMPV is insignificantly higher during fall and summer seasons, a situation that shows a mix of the temperate and tropical countries. Caracciolo et al. [12], in Italy, observed a high incidence of hMPV infection (25.3%) during winter-spring season. A study in northern Taiwan concluded that hMPV circulates in children during spring and early summer [24]. In Netherlands, hMPV was found primarily in winter months and rarely detected in summer months [15]. In Korea, hMPV infections peak in winter and spring [20].
Material and Methods This study was carried out in outpatients’ clinic of Mansoura University Children Hospital (MUCH), Egypt during the calendar year of 2010. Mansoura is the largest city in the northeast of Egypt. Outpatients’ clinic offers daily free services to all sick children. According to the hospital statistics, a total of 35,268 children attended the outpatients’ clinic during the study period. Acute respiratory infection (ARI) accounted for about one-third of diagnoses. Six hundred children were included in the study after the consent of their parents. Depending on the logistics and parents’ agreement, 600 child were included (600/11,756 =5.1% of children with ARIs). Data and specimen (nasopharyngeal aspirate) collection were carried out 3 d per wk. Children with ARIs diagnosed during the day were enlisted and a systematic random sample of them was selected (one case per fixed number of cases) for specimen collection. The number specimens collected varied from 3 to 5 per day according to the number of children with ARIs. The research protocol was approved by the research ethics committee of Faculty of Medicine, Mansoura University and by the Administration of MUCH. Each child was subjected to history taking, clinical examination, and appropriate laboratory and radiological examination and then nasopharyngeal aspirate was collected. Treatment was offered and final diagnosis was recorded. Nasopharyngeal aspirates were collected by syringe with 3 or 4 ml of buffered saline which was sequestrated into the nose and aspirated again, then immediately installed into viral transport media. The samples were placed immediately in cold packs or refrigerator (ice box with ice), transported immediately to MDICU where they were stored at 2°C–8°C.
ollected by syringe with 3 or 4 ml of buffered saline which was sequestrated into the nose and aspirated again, then immediately installed into viral transport media. The samples were placed immediately in cold packs or refrigerator (ice box with ice), transported immediately to MDICU where they were stored at 2°C–8°C. RNA was extracted using TriFast™ reagent, according to the manufacturer’s instructions. First strand cDNA synthesis from extracted RNA was done using The revertAid™ Minus first strand cDNA synthesis kit (Fermentas), according to the manufacturer’s instructions. Then PCR was performed with primers for amplification of M gene, hMPV- MF1 (AAGTGAATGCATCAGCCCAAG) and hMPV- MR1 (CACAGACTGTGAGTTTGTCAAA), which amplified the region between nucleotides 212 and 331, were used to give an amplicon of 120 bp. Each PCR reaction mixture contained 10 μl of cDNA, 2.5 U Taq DNA polymerase (Fermentas), 2 mmol/ L MgCI 2, 4 μmol each primer, 300 μmol /L each dNTP, 50 mmol /L KCI and 10 mmol /L Tris Cl (pH 8,5) . PCR cycling conditions were 95°C for 10 min followed by 45 cycles of 95°C for 1 min, 58°C for 1 min, 72°C for 1 min and a final extension step for 10 min in a master cycler instrument Perkin Elmer cetus (Norwalk, Conn). Positive samples were confirmed by PCR amplification of a longer product of M gene. The longer M product used primers for hMPV- MR1 and a new primer, hMPV MF2 (ATGGAGTCCTATCTAGTAGTAGAC) which amplified the reigon between nucleotides 1 and 331 of the M gene, yielded an amplicon of 331 bp product. The cycling conditions were same for the first PCR but with annealing temperature of 62°C. Amplicons were analyzed on agarose gels (1%) after ethidium bromide staining. As negative control distilled water was used, positive controls were not available for use.
d 331 of the M gene, yielded an amplicon of 331 bp product. The cycling conditions were same for the first PCR but with annealing temperature of 62°C. Amplicons were analyzed on agarose gels (1%) after ethidium bromide staining. As negative control distilled water was used, positive controls were not available for use. Statistical analysis of the results was performed with SPSS (Statistical Package for Social Sciences) program version 16. Mean, standard deviation, and percentage were used as descriptive statistics. Categorical variables were analyzed by chi- square test. Difference at P value of ≤0.05 was considered significant. Results Table 1 shows that the overall prevalence of hMPV infection among studied patients was 8% (95% = 6.1–10.4). The prevalence rate was significantly higher among children aged 2–24 mo compared to other age groups (11.9% vs. 3.7% and 4.0% for 2–24, 25–60, 61–108 mo respectively). Also it was significantly higher among females than males (12.6% vs. 6.6%). However, the prevalence does not show any variation with diagnosis and season of infection.Table 1 Prevalence of hMPV and its variation according to some factors Total h-MPV Positive N (%) Significance test Overall 600 48(8.0) Age (mo) 2–24 311 37(11.9) χ 2 = 13.3, P = 0.0013 25–60 190 7(3.7) 61–108 99 4(4.0) Sex Male 457 30(6.6) χ 2 = 5.37, P = 0.021 Female 143 18(12.6) Season Winter 364 30(8.2) χ 2 = 1.91, P = 0.59 Spring 176 11(6.3) Summer 19 2(10.5) Fall 41 5(12.2) Diagnosis Pneumonia 378 27(7.1) χ 2 = 1.99, P = 0.57 Bronchial asthma 103 8(0.8) Bronchiolitis 88 9(10.2) Croup 31 4(12.9)
25–60 190 7(3.7) 61–108 99 4(4.0) Sex Male 457 30(6.6) χ 2 = 5.37, P = 0.021 Female 143 18(12.6) Season Winter 364 30(8.2) χ 2 = 1.91, P = 0.59 Spring 176 11(6.3) Summer 19 2(10.5) Fall 41 5(12.2) Diagnosis Pneumonia 378 27(7.1) χ 2 = 1.99, P = 0.57 Bronchial asthma 103 8(0.8) Bronchiolitis 88 9(10.2) Croup 31 4(12.9) Clinical presentations and treatment were enlisted in Table 2. Cough, wheezing, rhinorrhea, fever and chest wall retraction were the most frequent presentations (81.2%, 68.8%, 66.7%, 64.6% and 56.3%; respectively). Antibiotics, bronchodilators and oxygen administration were the most treatments offered (60.4%, 31.2% and 27.1%; respectively).Table 2 Clinical presentation and treatment of cases with hMPV infection N (%) Clinical presentations a : Cough 39(81.2) Wheezing 33(68.8) Rhinorrhea 32(66.7) Fever 31(64.6) Chest wall retraction 27(56.3) Sore throat 20(41.7) Hyperventilation 20(41.7) Hypoxemia 19(39.6) Tachycardia 18(37.5) Feeding difficulties 18(33.3) Treatment a : Antibiotics 29(60.4) Bronchodilators 15(31.2) Oxygen administration 13(27.1) Corticosteroids 8(16.7) Artificial respiration 4(8.3) aCategories are not mutually exclusive Discussion Human metapneumovirus (hMPV) is an emerging virus associated with a significant proportion of both upper and lower acute respiratory infection in infants and young children [12, 13]. Because of the unavailability of rapid antigenic detection assays in the past and slow growth in tissue culture, molecular methods have become the method of choice for the diagnosis of hMPV infection [10].
of hMPV infection (25.3%) during winter-spring season. A study in northern Taiwan concluded that hMPV circulates in children during spring and early summer [24]. In Netherlands, hMPV was found primarily in winter months and rarely detected in summer months [15]. In Korea, hMPV infections peak in winter and spring [20]. In the present study hMPV infection was highest in children less than 2 y. Most hMPV infections occur in children less than 5 y of age, with children <2 y of age being most at risk for serious hMPV infections [8, 13, 15, 26]. In Japan, hMPV was significantly higher among children with ARI aged 3–5 y (20.9%) compared to those aged 1–3 y (16.5%) and 5–10 y(16.0%) [14]. The authors found that the incidence of hMPV is significantly higher among female than male children. However, Ebihara et al. [14] and Hara et al. [19], reported no sex differences in detection of hMPV. The virus causes a variety of clinical symptoms in children that are typical of the paramyxoviruses, including upper and lower respiratory tract illnesses [13]. The virus was significantly more frequent among children diagnosed with croup (12.9%), bronchiolitis (10.2%) and pneumonia (7.1%), compared to 0.8% among asthmatic children. Previous studies concluded that hMPV has likely been a major factor in pneumonia and bronchiolitis [7, 19, 23, 27]. The diagnoses were bronchiolitis, bronchopneumonia, infantile asthma or upper respiratory tract infection in China [28]. In Italy, the diagnoses were bronchiolitis, pneumonia and upper respiratory tract illness [12].
dies concluded that hMPV has likely been a major factor in pneumonia and bronchiolitis [7, 19, 23, 27]. The diagnoses were bronchiolitis, bronchopneumonia, infantile asthma or upper respiratory tract infection in China [28]. In Italy, the diagnoses were bronchiolitis, pneumonia and upper respiratory tract illness [12]. The clinical characteristics of hMPV infections are not distinctive. Thus, differentiating it from other respiratory viruses on clinical grounds is not possible [29]. In the current study 81.2% of hMPV infections were associated with cough, 60.6% were associated with fever, 66.7% with rhinoorrhea and 68.8% with wheezing. The same symptoms were reported with different percentages in different studies from different localities [18, 27, 28, 30]. Antibiotics were by far the most frequently prescribed treatment (about 60%) followed by bronchodilators (31%), oxygen administration (27.1%), corticosteroids (16.7%) and artificial respiration (8.3%). In a Netherlands’ study the most frequent treatments were antibiotics (60%), bronchodilators and oxygen administration (36%, each), corticosteroids (20%) and artificial respiration (12%) [18]. Because at the time of consultation no etiological agent had been identified in children with RTI associated with hMPV infection, physicians continued treatment with antibiotics and corticosteroids, to control potentially unidentified bacterial infections and to control wheeze. This indicates that testing for hMPV in patients with RTI may reduce unnecessary use of antibiotics and corticosteroids.
children with RTI associated with hMPV infection, physicians continued treatment with antibiotics and corticosteroids, to control potentially unidentified bacterial infections and to control wheeze. This indicates that testing for hMPV in patients with RTI may reduce unnecessary use of antibiotics and corticosteroids. A weakness of this study is the fact that only outpatients’ infants and children attending a single hospital with infections severe enough to seek medical advice were included. Therefore, the prevalence of hMPV in these children may underestimate its prevalence in the community. A previous study [11] in Egypt found a prevalence of 13.6% of human metapneumovirus in adult patients with lower respiratory tract infections. The present results cannot be extrapolated to the entire population of Egyptian children. Despite this limitation, this study confirms the etiologic role of hMPV in respiratory infections among children in Egypt. A wide-scale community-based study is recommended for further characterization of the viral genotype, its epidemiology, co-infections and re-infections. Conclusions hMPV infection is frequent in infants and children presented with different clinical manifestations of respiratory tract infections in MUCH and thus must be considered in etiological diagnosis though no treatment is yet known. Conflict of Interest None. Role of Funding Source None.
and PE fluid and found that compared with the Ang-2 serum levels in the non-PE and control groups, that in the PE group was significantly higher, and the Ang-2 level in the PE fluid was similar to or slightly higher than that in the serum, which indicated that Ang-2 may be related to the development of EV71-induced PE. To confirm the association between Ang-2 and EV71-induced PE, the authors cultivated human recombinant Ang-2 with HPMECs and found that Ang-2 increased F-actin staining, whereas VE-cadherin staining was reduced and gaps in the intracellular junctions were noted. The endothelial cells incubated with serum from infants with PE showed the same results; however, these changes were not noted in cells incubated with serum from control group infants. Endothelial cells normally connect with one another through cell adhesion molecules [16], and VE-cadherin is one of the adhesive proteins necessary for maintaining vascular integrity. The VE-cadherin molecule is related to F-actin. When inflammatory mediators stimulate the endothelium, F-actin rearranges and centripetal tension increases. Changes in the F-actin skeleton affect the endothelial connections and lead to the formation of gaps in the endothelium, thereby increasing permeability [17].
Introduction Acute respiratory tract infections (ARTI) occur frequently in the society [1]. Especially children appear to be at risk. Most of the viruses are transmitted through respiratory droplets. While some of them can stay localized in the respiratory tract, some can show systemic dissemination. In two third of the ARTI, influenza virus and respiratory syncytial (RSV) virus, parainfluenzavirus, adenovirus, coronavirus and rhinovirus are responsible. Influenza is a major cause of morbidity and mortality in infants [2]. Parainfluenza viruses (PIV) are mostly seen in the lower respiratory tract infections of the children after RSV infection. Type 3 is common and approximately half of the children are infected in the first year after the birth. Adenovirus infections are endemic and cause infections mostly in the school ages; 50 % of these infections are asymptomatic. Infections with coronavirus is seasonal and is especially seen in the winter months. The infection caused by rhinovirus is seen throughout the year [3]. Metapneumovirus infections, like RSV infections are common in children younger than 2 y [4]. RSV infections are among the most important agents causing acute bronchitis and pneumonia in Turkey as in the world. Almost all of the children younger than 3 y may be infected with RSV [5]. C. pneumoniae, is responsible for 10–20 % of community-acquired atypical pneumonia in the childhood, 10 % of the acute bronchitis and 5–10 % of the pharyngitis cases [6].
nt agents causing acute bronchitis and pneumonia in Turkey as in the world. Almost all of the children younger than 3 y may be infected with RSV [5]. C. pneumoniae, is responsible for 10–20 % of community-acquired atypical pneumonia in the childhood, 10 % of the acute bronchitis and 5–10 % of the pharyngitis cases [6]. The authors aimed to evaluate various agents causing ARTI in children for the first time in Turkey. This will help in making early viral diagnosis and prevention of unnecessary antibiotics usage and also early initiation of antiviral treatment in high risk group patients. Material and Methods A total of 109 children (62 boys and 47 girls) with ARTI findings such as fever, fast breathing, wheeze, cough, nasal draining and nasal congestion between the age group 0–6 y were included in this study which was conducted from January 2006 through June 2007. 46.5 % of the cases were between 6–23 mo, 27.9 % were between 60–72 mo, 18.6 % were between 24–59 mo and 6.9 % were between 0–5 y. Children having any underlying disease were excluded. The complaints and clinical findings of the patients were recorded by a pediatrician designing a questionnaire for the purpose of gathering information. To obtain C. pneumoniae DNA, swab samples were tested by a real time PCR kit (Roboscreen, Germany). ID-Tag™ RVP (Respiratory Viral Panel) kit was used for influenza A (H1,H3,H5), influenza B, RSV (type A, type B), coronavırus (229E, 0C43, SARS, NL63, HKU1), parainfluenza virus, metapneumovirus, rhinovirus and adenovirus [7–9]. This kit was designed as multiplex PCR assay.
by a real time PCR kit (Roboscreen, Germany). ID-Tag™ RVP (Respiratory Viral Panel) kit was used for influenza A (H1,H3,H5), influenza B, RSV (type A, type B), coronavırus (229E, 0C43, SARS, NL63, HKU1), parainfluenza virus, metapneumovirus, rhinovirus and adenovirus [7–9]. This kit was designed as multiplex PCR assay. For influenza virus, cell culture method [Madine Darby Canine Kidney (MDCK) cells in the epiteloid nature] was preferred as the “Gold Standard”. The single-layer MDCK cells were washed with serum free medium and material inoculation was performed. It was incubated for 3 d in 5 % C02 environment. RSV antigen was investigated by direct fluorescent antibody (DFA) test (Monofluo screen, BioRad, France). The upper supernatants of the cultures were tested by immunocapture ELISA in terms of influenza A and B. Results The order of symptoms were as follows; nasal draining (100 %), cough/nasal congestion (90.6 %), fever (86 %), labored breathing (27.9 %) and stomach pain (4.6 %) and anorexia (6.9 %) (Table 1).Table 1 Distribution of the detected viral agents according to the symptoms
RSV antigen was investigated by direct fluorescent antibody (DFA) test (Monofluo screen, BioRad, France). The upper supernatants of the cultures were tested by immunocapture ELISA in terms of influenza A and B. Results The order of symptoms were as follows; nasal draining (100 %), cough/nasal congestion (90.6 %), fever (86 %), labored breathing (27.9 %) and stomach pain (4.6 %) and anorexia (6.9 %) (Table 1).Table 1 Distribution of the detected viral agents according to the symptoms Symptoms Influenza A n (%) Influenza B n (%) ADV n (%) RSV A n (%) RSV B n (%) PIV-3 n (%) PIV-4 n (%) Metapneumovirus n (%) Rhinovirus n (%) Coronavirus n (%) Total n (%) Cough 7 (100) 3 (100) 4 (100) 1 (100) 8 (100) 4 (100) 12 (75) 39 (90.6) Nasal draining 7 (100) 2 (66.6) 4 (100) 1 (100) 8 (100) 1 (100) 1 (100) 4 (100) 14 (87.5) 1 (100) 43 (100) Nasal congestion 7 (100) 3 (100) 3 (100) 1 (100) 8 (100) 1 (100) 1 (100) 4 (100) 10 (62.5) 1 (100) 39 (90.6) Fever 7 (100) 1 (33.3) 4 (100) 1 (100) 7 (87.5) 4 (100) 13 (81.25) 37 (86) Labored breathing 1 (100) 7 (87.5) 2 (50) 2 (12.5) 12 (27.9) Anorexia 1 (12.5) 2 (12.5) 3 (6.9) Phlegmy cough 1 (12.5) 1 (2.3) Stomach pain 1 (100) 1 (12.5) 2 (4.6)
100) 3 (100) 1 (100) 8 (100) 1 (100) 1 (100) 4 (100) 10 (62.5) 1 (100) 39 (90.6) Fever 7 (100) 1 (33.3) 4 (100) 1 (100) 7 (87.5) 4 (100) 13 (81.25) 37 (86) Labored breathing 1 (100) 7 (87.5) 2 (50) 2 (12.5) 12 (27.9) Anorexia 1 (12.5) 2 (12.5) 3 (6.9) Phlegmy cough 1 (12.5) 1 (2.3) Stomach pain 1 (100) 1 (12.5) 2 (4.6) PCR Method The detected virus ratios were 62.7 % and 37.2 % in boys and girls, respectively by PCR multiplex method. According to the study results; C. pneumoniae DNA was found negative in all samples by PCR method. Viruses were detected in 43 (39.4 %), of the 109 children’s swab samples. The virus detection ratios by PCR multiplex method (with DFA only for RSV A and RSV B, cell culture only for influenza A and influenza B) were as follows; rhinoviruses: 16 (14.7 %), RSV:B 11 (10.1 %), influenza A: 8 (7.3 %), metapneumovirus: 4 (3.6 %), adenovirus: 4 (3.6 %), coronavirus: 1 (0.9 %), parainfluenzavirus type 3: 1 (0.9 %), parainfluenzavirus type 4: 1 (0.9 %) and RSV A: 1 (0.9 %) (Table 2).Table 2 Ratios of the viral agents detected in cases according to the DFA(only for RSV A and RSV B), cell culture(only for influenza A and influenza B) and multiplex PCR methods Agents Boys Girls % (n:109) Rhinovirus 10 6 14.7 % RSV Ba 5 3 7.3 % Influenza Ab 5 2 6.4 % Metapneumovirus 2 2 3.6 % Adenovirus 2 2 3.6 % Coronavirus – 1 0.9 % Parainfluenza 3 1 – 0.9 % Parainfluenza 4 1 – 0.9 % RSV A 1 – 0.9 % Influenza Bc – – 0 %
PCR Method The detected virus ratios were 62.7 % and 37.2 % in boys and girls, respectively by PCR multiplex method. According to the study results; C. pneumoniae DNA was found negative in all samples by PCR method. Viruses were detected in 43 (39.4 %), of the 109 children’s swab samples. The virus detection ratios by PCR multiplex method (with DFA only for RSV A and RSV B, cell culture only for influenza A and influenza B) were as follows; rhinoviruses: 16 (14.7 %), RSV:B 11 (10.1 %), influenza A: 8 (7.3 %), metapneumovirus: 4 (3.6 %), adenovirus: 4 (3.6 %), coronavirus: 1 (0.9 %), parainfluenzavirus type 3: 1 (0.9 %), parainfluenzavirus type 4: 1 (0.9 %) and RSV A: 1 (0.9 %) (Table 2).Table 2 Ratios of the viral agents detected in cases according to the DFA(only for RSV A and RSV B), cell culture(only for influenza A and influenza B) and multiplex PCR methods Agents Boys Girls % (n:109) Rhinovirus 10 6 14.7 % RSV Ba 5 3 7.3 % Influenza Ab 5 2 6.4 % Metapneumovirus 2 2 3.6 % Adenovirus 2 2 3.6 % Coronavirus – 1 0.9 % Parainfluenza 3 1 – 0.9 % Parainfluenza 4 1 – 0.9 % RSV A 1 – 0.9 % Influenza Bc – – 0 % aRSV B antigen of 8 patients were detected by DFA method but RSV B was detected in 11 patients by multiplex PCR. The authors RSV B positive cases in both DFA and multiplex PCR methos as 8 bInfluenza A was detected in 8 patients by multiplex PCR but only 7 of these 8 patients were detected as positive by cell culture method. We used Influenza A positive cases in both multiplex PCR and cell culture methods as 7
aRSV B antigen of 8 patients were detected by DFA method but RSV B was detected in 11 patients by multiplex PCR. The authors RSV B positive cases in both DFA and multiplex PCR methos as 8 bInfluenza A was detected in 8 patients by multiplex PCR but only 7 of these 8 patients were detected as positive by cell culture method. We used Influenza A positive cases in both multiplex PCR and cell culture methods as 7 cInfluenza B was detected in 3 patients by multiplex PCR method but no influenza B was detected by cell culture Viruses were detected in 43 samples; the most frequently detected virus was rhinovirus with 16 patients (37.2 %). This was followed by RSV B (25.6 %) and RSV type B was detected in 11 patients by the PCR method (Table 3).Table 3 Comparison of the detected RSV by PCR and DFA methods Number of patients PCR DFA PCR + DFA 109 11 RSV B 8 RSV B 8 RSV B 109 1 RSV A 1 RSV A 1 RSV A Sensitivity (%) 100 100 Specificity (%) 97 100 Total, n (%) 12 RSV (11 %) 9 RSV (8.2 %) 9 RSV (8.2 %) RSV type B was detected in 11 patients by the PCR method and RSV antigen in eight of these 11 patients was also positive by the DFA method
ents PCR DFA PCR + DFA 109 11 RSV B 8 RSV B 8 RSV B 109 1 RSV A 1 RSV A 1 RSV A Sensitivity (%) 100 100 Specificity (%) 97 100 Total, n (%) 12 RSV (11 %) 9 RSV (8.2 %) 9 RSV (8.2 %) RSV type B was detected in 11 patients by the PCR method and RSV antigen in eight of these 11 patients was also positive by the DFA method In the third order of frequency, influenza A virus was found in 8 of the patients and they were identified as influenza A H3 by PCR. Influenza B was found positive in 3 patients (Table 4). Metapneumovirus was detected in four patients. (9.3 %) and adenovirus in four patients (9.3 %), coronavirus in one patient (2.3 %), parainfluenzavirus type 3 in one patient (2.3 %), parainfluenzavirus type 4 in one patient (2.3 %) and RSV A in one patient (2.3 %) (Table 2).Table 4 Comparison of the detected influenza virus by PCR and cell culture methods Number of patients PCR Cell culture PCR + Cell culture 109 8 Influenza A (H3) 7 Influenza A 7 Influenza A 109 3 Influenza B – – Sensitivity (%) 100 100 Specificity (%) 96 100 Total, n (%) 11 Influenza (10 %) 7 Influenza A (6.4 %) 7 Influenza A (6.4 %) Influenza A H3 was detected as positive in eight patients by the PCR and influenza A H3N2 was specified in the cell culture of seven of these patients. Again when influenza B was found positive in three patients by the PCR, the influenza cultures of these three patients was found negative
(6.4 %) 7 Influenza A (6.4 %) Influenza A H3 was detected as positive in eight patients by the PCR and influenza A H3N2 was specified in the cell culture of seven of these patients. Again when influenza B was found positive in three patients by the PCR, the influenza cultures of these three patients was found negative No statistically significant difference was found between the boys and girls in terms of isolated viruses (p > 0.05). Statistical comparisons between groups were made using Chi square or Fisher’s exact tests. Cell Culture Method Influenza A H3N2 (16.3 %) was identified in the cell culture of seven of patients. No influenza B virus was detected in the cell culture. Immuno-Fluorescence Method RSV B and RSV A were detected positive in 8 and 1 patients by the DFA method, respectively. Sensitivity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 100 % and 100 %, respectively. Specificity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 97 % and 100 % respectively (Table 3). PCR and DFA positivity all together was evaluated as gold standard test. Sensitivity of the PCR and cell culture methods for the diagnosis of influenza infections were detected as 100 % and 100 %, respectively. Specificity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 96 % and 100 %, respectively (Table 4). DFA test positivity together with PCR is considered as gold standard.
Sensitivity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 100 % and 100 %, respectively. Specificity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 97 % and 100 % respectively (Table 3). PCR and DFA positivity all together was evaluated as gold standard test. Sensitivity of the PCR and cell culture methods for the diagnosis of influenza infections were detected as 100 % and 100 %, respectively. Specificity of the PCR and DFA methods for the diagnosis of RSV infections were detected as 96 % and 100 %, respectively (Table 4). DFA test positivity together with PCR is considered as gold standard. RSV B antigen of 8 patients were detected by DFA method but RSV B was detected in 11 patients by multiplex PCR. Influenza A was detected in 8 patients by multiplex PCR but only 7 of these 8 patients were detected as positive by cell culture method. Influenza B was detected in 3 patients by multiplex PCR method but no influenza B was detected by cell culture. Discussion The authors evaluated various agents causing ARTI in children for the first time in Turkey. In the literature evaluation, RSV was amongst the most common causative viral agent of pneumonia causing bronchiolitis in children younger than 2 y. The second viral agent was parainfluenza type 3 virus which causes pneumonia [5].
e authors evaluated various agents causing ARTI in children for the first time in Turkey. In the literature evaluation, RSV was amongst the most common causative viral agent of pneumonia causing bronchiolitis in children younger than 2 y. The second viral agent was parainfluenza type 3 virus which causes pneumonia [5]. Cruz-Canete et al, [8] reported influenza A positiveness as 11. 3 % in 203 pediatric patients under 5 y by PCR. In an another study by Ciblak et al, [10] 111 (68 %) and 52 (31 %) of the 163 positive samples were identified as influenza A and influenza B, respectively with immuno-capture ELISA between 2007–2008 season in Turkey. Carhan et al, [11] also reported that influenza A and influenza B were detected as 16.2 % and 7.6 % in 1157 clinical specimens, respectively. In a study by Akın et al, [7] RSV, influenza A and influenza B were detected in 20, 10 and 6 cases in 91 children with ARTI between the ages 0–19, respectively. In the present study, influenzae A virus was found positive in 7 (6.4 %) and 11 patients (10 %) by the cell culture and PCR methods, respectively. The present influenza A ratio is less than the results of Cruz-Canete et al, [8] and Carhan et al, [11]. Influenza B was detected in 3 patients by multiplex PCR but no influenza B was detected by cell culture; these accepted 3 positive cases were accepted as false positive .
cell culture and PCR methods, respectively. The present influenza A ratio is less than the results of Cruz-Canete et al, [8] and Carhan et al, [11]. Influenza B was detected in 3 patients by multiplex PCR but no influenza B was detected by cell culture; these accepted 3 positive cases were accepted as false positive . In a study performed by Lazzaro et al, [5] with 73 children, RSV was detected as 45 %. RSV was detected as 29.5 % in 98 % of 332 pediatric patients by Kanra et al, [12]. Gökalp et al, [13] detected RSV in 17 (21.35 %) and 26 (32.5 %) of 80 children between 0–24 mo by the cell culture and DFA methods, respectively. In a study performed by Hacímustafaoğlu et al, [14], 83 % of the pregnant women as well as all the babies of these mothers (>20 RU/ml) were anti-RSV IgG positive. In a study performed by Boivin et al, [15] 46 % and 51 % RSV were detected by the real-time PCR method in 204 nasopharyngeal samples of children. Out of 77 samples tested for RSV with DFA, 17 (22.1 %) were found RSV-positive with a mean age of 8.24 ± 7.21 mo in children by Gupta et al, [16]. Of the 126 patients, 46.66 % children were positive for RSV while 58.33 % were negative for RSV between the age of 4–24 mo by Hemalatha et al, [17]. Yeolekar et al, [18] collected nasopharyngeal aspirates from 385 children with acute respiratory tract infections and detected 143 (37.1 %) viral positivity for respiratory viruses. Of the six respiratory viruses, the most common was respiratory syncytial virus (RSV) in 100 (26 %) patients, followed by influenza viruses in 21 (5.4 %), parainfluenza in 8 (2.07 %), adenovirus in 3 (0.8 %). The present RSV results are much less than the results of this study. RSV B was found positive in 8, and 11 patients of 109 pediatric patients by DFA and PCR methods, respectively in the present study. RSV A was found positive in one patient by both DFA and real time PCR methods.
in 8 (2.07 %), adenovirus in 3 (0.8 %). The present RSV results are much less than the results of this study. RSV B was found positive in 8, and 11 patients of 109 pediatric patients by DFA and PCR methods, respectively in the present study. RSV A was found positive in one patient by both DFA and real time PCR methods. The real frequency of metapneumovirus infections in children is not known. During the winter months of the year 2000, according to the prospective follow up study results performed in Holland and Finland, metapnemovirus was detected in 9–10 % cases of the children with the inexplainable respiratory tract infection findings or acute wheezing [19, 20]. The infection ratio in the infants at the age of 7–12 mo (31 %) was more frequent than that of the 0–6 mo of children (19 %) in United States of America [6]. Yahia et al, [21] detected 8 % metapneumovirus in nasopharyngeal aspirates of 600 infants and children with respiratory infections. They also stated that the rate was significantly higher among children aged 2–24 mo compared to other age groups. In the present study, metapneumovirus was detected in four pediatric patients (3.6 %). The present results for metapneumovirus are in concardance with study results of Yahia et al, and other studies. Three of the present cases were in the 6–23 mo age range and one patient was in 24–59 mo age range.
to other age groups. In the present study, metapneumovirus was detected in four pediatric patients (3.6 %). The present results for metapneumovirus are in concardance with study results of Yahia et al, and other studies. Three of the present cases were in the 6–23 mo age range and one patient was in 24–59 mo age range. Xie et al, [22] investigated the viral pathogens of ARTI in 1914 (1281 male and 709 female) children of different age groups and outlined the epidemic feature of different viruses by reverse transcription PCR method. They found the positive rate of rhinovirus as 36.2 % in group of <1 y old. Xiao et al, [23] detected viruses in 871 samples (74.76 %), among which RSV (27.03 %) was the most common virus, followed by human rhinovirus (17.33 %) in 1165 hospitalized children with ARTI. They stated the highest positive rate was noted in the age group of 6 mo to 1 y and concluded that viral infection-associated acute respiratory tract infection shows a prevail in the age group of 6 mo to 1 y in winter as well. Vidaurreta et al, [24] reported that rhinovirus was the most frequent followed by respiratory syncytial virus in children <5 y old with acute respiratory infections. Viral diagnosis was achieved in 81 % hospitalized and 57 % of outpatients in their study. They concluded that the use of viral diagnostic techniques allowed the identification of an etiologic agent in most of the hospitalized patients and more than half of outpatients. The addition of RT-PCR for rhinovirus, allowed the identification of this etiologic agent. The authors found the rhinovirus rate as the highest (14.7 %). The present result are in concordance with the study results of Vidaurreta et al, [24] Xie et al, [22] and Xiao et al, [23]. The authors also detected 7 (43.7 %) rhinovirus cases of total 16 cases in children under 23 mo old similar to Xie’s study positive rate of rhinovirus as 36.2 % in group of <1 y old.
st (14.7 %). The present result are in concordance with the study results of Vidaurreta et al, [24] Xie et al, [22] and Xiao et al, [23]. The authors also detected 7 (43.7 %) rhinovirus cases of total 16 cases in children under 23 mo old similar to Xie’s study positive rate of rhinovirus as 36.2 % in group of <1 y old. Khor et al, [25] reported a retrospective study with a total of 10269 respiratory samples from all children (less than or equal to) 5 y old with respiratory tract infections received at the hospital’s diagnostic virology laboratory between 1982–2008. They reported adenoviruses as (141, 5.2 %) as the forth common virus after RSV (1913, 70.6 %), parainfluenza viruses (357, 13.2 %) and influenza viruses (297, 11.0 %). Zhang et al, [26] investigated the prevalence of respiratory viruses, including respiratory syncytial virus , influenza virus types A and B, parainfluenza virus 1–3, and adenovirus , in 412 hospitalized children. In their study, RSV was detected in 25.0 %, influenza virus types A and B in 19.4 %, parainfluenza 1–3 in 14.6 %, and adenovirus in 4.1 % of the total samples. They also reported that most viral infections occurred in the first 5 y of life, and the incidence of viral infection peaked during early spring and winter. Farshad et al, [27] reported the most commonly detected virus was parainfluenza virus 3 in 32 (15.8 %) cases followed by respiratory syncytial virus 26 (12.9 %); parainfluenza 1 and parainfluenza 2, each 13 (6.4 %); influenza A 16 (7.4 %); influenza B 7(3.5 %), and adenovirus 12 (5.9 %) in 202 hospitalized children (1 mo–5 y) with clinical evidence of ARTI. In the present study adenovirus infection rate was detected as 3.6 %. This was in the forth rank of etiological agents. The present results are in concordance with the results of Khor et al, [25] Zhang et al, [26] and Farshad et al, [27] (5.9 %).
) in 202 hospitalized children (1 mo–5 y) with clinical evidence of ARTI. In the present study adenovirus infection rate was detected as 3.6 %. This was in the forth rank of etiological agents. The present results are in concordance with the results of Khor et al, [25] Zhang et al, [26] and Farshad et al, [27] (5.9 %). Prill et al, [28] reported that coronavirus was detected in 113 (7.6 %) of 1481 hospitalized children with ARTI. In another study, Al Hajjar et al, [29] reported detections of 8.3 % metapneumoviruses and 2.8 % coronaviruses among 489 specimens from children less than 16 y old by PCR. They concluded that coronaviruses may cause severe ARTI with underlying conditions. Kristoffersen et al, [30] reported 68 (12.7 %) coronavirus in hospitalized Norwegian children with ARTI and concluded that children with coronavirus were older than children with RSV and tended to have chronic disease (other than asthma). Lau et al, [31] reported that 10 (1.6 %) of the 629 children (6 mo–5 y) had coronavirus infection. In the present study, only 1 coronovirus (0.9 %) case was detected and this result is less than other study findings.
h coronavirus were older than children with RSV and tended to have chronic disease (other than asthma). Lau et al, [31] reported that 10 (1.6 %) of the 629 children (6 mo–5 y) had coronavirus infection. In the present study, only 1 coronovirus (0.9 %) case was detected and this result is less than other study findings. Kabra et al, [1] investigated clinical samples of 95 children to identify pathogens responsible for acute severe lower respiratory tract infection in under five children by non-invasive methods (blood culture and serology). They concluded that viruses from nasopharyngeal aspirates could be isolated in 36 (38 %).Khor et al, [25] detected 357 (13.2 %) parainfluenza viruses (type 3) in 10269 respiratory samples from all children with respiratory viral infections (less than or equal to) 5 y old. Xie et al, [22] found the positive rate of rhinovirus as 12 % in group of <1 y old. Ren et al, [32] reported that parainfluenza viruses were detected in 246 (12.2 %) children with ARTI, of whom 25 (10.2 %) were positive for parainfluenza virus 4, 11 (4.5 %) for parainfluenza virus 2, 51 (20.7 %) for parainfluenza virus 1, 151 (61.4 %) for parainfluenza virus 3. The authors detected 1 parainfluenza 3 (0.9 %) and 1 parainfluenza 4 (0.9 %) in children younger than 23 mo old. The present results are not in concordance with the other results. In other words, the present results were much lower than the results of other studies.
enza virus 1, 151 (61.4 %) for parainfluenza virus 3. The authors detected 1 parainfluenza 3 (0.9 %) and 1 parainfluenza 4 (0.9 %) in children younger than 23 mo old. The present results are not in concordance with the other results. In other words, the present results were much lower than the results of other studies. The present study is important because it determined the virus frequency and examined various viruses in a single clinical sample in terms of respiratory tract etiology in 0–6 y aged children. ARTI are very common in the society. The number of metapneumovirus infections causing ARTI has recently been increased in the world as in the present study. Rhinoviruses was the most diagnosed viral pathogen among ARTI agents. The present results are in concordance with other epidemiological studies performed in the world. Conflict of Interest None Role of Funding Source This work was supported by a Research Fund of Istanbul University, project number: 477/27122005
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 11838568 BF02722930 10.1007/BF02722930 Special Article Upper respiratory tract infections Jain Neemisha Lodha R. Kabra S. K. skkabra@hotmail.com grid.413618.90000000417676103Present Address: Department of Pediatrics, Division of Pediatric Pulmonology, All India Institute of Medical Sciences, 110029 New Delhi, India 2001 68 12 1135 1138 © Dr. K C Chaudhuri Foundation 2001This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Acute respiratory infections accounts for 20–40% of outpatient and 12–35% of inpatient attendance in a general hospital. Upper respiratory tract infections including nasopharyngitis, pharyngitis, tonsillitis and otitis media constitute 87.5% of the total episodes of respiratory infections. The vast majority of acute upper respiratory tract infections are caused by viruses. Common cold is caused by viruses in most circumstances and does not require antimicrobial agent unless it is complicated by acute otitis media with effusion, tonsillitis, sinusitis, and lower respiratory tract infection. Sinusitis is commonly associated with common cold. Most instances of rhinosinusitis are viral and therefore, resolve spontaneously without antimicrobial therapy. The most common bacterial agents causing sinusitis areS. pneumoniae, H. influenzae, M. catarrhalis,S. aureus andS. pyogenes. Amoxycillin is antibacterial of choice. The alternative drugs are cefaclor or cephalexin. The latter becomes first line if sinusitis is recurrent or chronic. Acute pharyngitis is commonly caused by viruses and does not need antibiotics. About 15% of the episodes may be due to Group A beta hemolytic streptococcus (GABS). Early initiation of antibiotics in pharyngitis due to GABS can prevent complications such as acute rheumatic fever. The drug of choice is penicillin for 10–14 days. The alternative medications include oral cephalosporins (cefaclor, cephalexin), amoxicillin or macrolides.
to Group A beta hemolytic streptococcus (GABS). Early initiation of antibiotics in pharyngitis due to GABS can prevent complications such as acute rheumatic fever. The drug of choice is penicillin for 10–14 days. The alternative medications include oral cephalosporins (cefaclor, cephalexin), amoxicillin or macrolides. Key words Upper respiratory tract infectionsPharyngitisSinusitisNasopharyngitisissue-copyright-statement© Dr. K C Chaudhuri Foundation 2001
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 16077248 BF02724189 10.1007/BF02724189 Symposium on Pediatric Cardiology-ll Current perspectives on Kawasaki disease Gupta-Malhotra Monesha 713 500 5751Monesha.gupta@uth.tmc.edu 1 Rao P. Syamasundar 1 1 grid.267308.80000000092062401University of Texas Houston Medical School & Memorial Hermann Children’s Hospital, Houston, Texas 2 6431 Fannin Street, MSB 3.130, 77030 Houston, TX 2005 72 7 621 629 © Dr. K C Chaudhuri Foundation 2005This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.The etiology of Kawasaki disease (KD) remains unknown despite several years of dedicated research in this direction. Recently coronavirus infection and genetic polymorphisms have been implicated. Since first description of the disease there have been few changes in the diagnostic criteria except for newer recommendations of fever of at least 4 instead of 5 days duration. Recently, Echocardiography Criteria and Laboratory Criteria have been added to aid in the diagnosis of incomplete KD where all the historical diagnostic criteria are not present; this is now called the “incomplete form of KD” as opposed to “atypical form of KD”. The word “atypical” is reserved for unusual presentations of KD such as those with hemophagocytic syndrome or nerve palsy. The treatment of KD includes infusion of high dose immunoglobulin. Patients nonresponsive to immunoglobulin therapy are labeled as having “immunoglobulin resistant KD”. The treatment of immunoglobulin resistant KD can be challenging and new therapies that have tried with some success. Late outcomes after 4 decades of treating these patients have recently been published. There has been some concern about increased risk for premature atherosclerosis in patients with childhood KD who had coronary artery abnormalities.
resistant KD can be challenging and new therapies that have tried with some success. Late outcomes after 4 decades of treating these patients have recently been published. There has been some concern about increased risk for premature atherosclerosis in patients with childhood KD who had coronary artery abnormalities. Key words Kawasaki diseaseIntravenous gamma globulinCoronary artery aneurysmsissue-copyright-statement© Dr. K C Chaudhuri Foundation 2005
The Pandemic H1N1/09 virus is a new swine-origin influenza A(H1N1) virus strain responsible for the 2009 flu pandemic. It has also been called the human swine influenza (HSI) by various health agencies worldwide. The terminology of HSI versus non-HSI influenza remains confusing to the layperson [1]. In July 2009 the World Health Organization (WHO) called this a pandemic H1N1/09 virus to differentiate it from the current seasonal H1N1 viruses to avoid some of the stigma associated with other options (http://www.who.int/mediacentre/Pandemic_h1n1_presstranscript_2009_07_07.pdf). In hospital practice based on fever and contact history, we screen patients with symptoms compatible with an influenza-like illness (ILI) or upper respiratory tract infection (URTI) [1]. Nevertheless, the clinical presentations may be non-specific and fever or contact history is often absent. We report 8 cases of neonates with possible respiratory viral infections during the outbreak of pandemic H1N1 2009 and discuss many of the issues associated with the seemingly trivial infections in the neonates. Material and Methods We reviewed neonates admitted to a teaching hospital for the investigation of possible respiratory viral infections based on fever or respiratory symptoms or contact history during the outbreak of pandemic H1N1 2009 in Hong Kong. The Prince of Wales Hospital (PWH) is a university teaching hospital situated in the Eastern part of the New Territories in Hong Kong. The annual deliveries for this cluster were approximately 7000.
Material and Methods We reviewed neonates admitted to a teaching hospital for the investigation of possible respiratory viral infections based on fever or respiratory symptoms or contact history during the outbreak of pandemic H1N1 2009 in Hong Kong. The Prince of Wales Hospital (PWH) is a university teaching hospital situated in the Eastern part of the New Territories in Hong Kong. The annual deliveries for this cluster were approximately 7000. Eight neonates were admitted to the neonatal service from August 2009 through December 2009 for the investigation of possible respiratory viral infections based on fever or respiratory symptoms or contact history (Table 1). There was no pandemic H1N1 case but one case of Influenza A (H3N2). Table 1 Neonates investigated for influenza-like illness in 2009 Age (days) Sex Fever >37.5°C Symptoms Contact history NPA/culture Hospital stay (days) 10 F No Sneezing No Influenza A, H3N2 3 11 F No Sneezing, cough, shortness of breath Brother with URTI RSV 4 17 F No Apnea, cough, malaise, ↓appetite, ↓urine output Twin sister with cyanosis in Shenzhen with pneumonia, grandmother URTI Parainfluenza type 3 7 17 F No Sneezing, ↓appetite No Parainfluenza type 3 2 25 M No Running nose, cough, respiratory distress No Parainfluenza type 3 2 Birth F No Nil Mother GBS + pandemic H1N1 Negative 7 16 M 38.1°C Nil Brother with “flu” Negativea 7 17 F 37.9°C Vomited No Negative 3 GBS Group B streptococcus aUrine yielded Klebsiella sensitive to gentamicin
Age (days) Sex Fever >37.5°C Symptoms Contact history NPA/culture Hospital stay (days) 10 F No Sneezing No Influenza A, H3N2 3 11 F No Sneezing, cough, shortness of breath Brother with URTI RSV 4 17 F No Apnea, cough, malaise, ↓appetite, ↓urine output Twin sister with cyanosis in Shenzhen with pneumonia, grandmother URTI Parainfluenza type 3 7 17 F No Sneezing, ↓appetite No Parainfluenza type 3 2 25 M No Running nose, cough, respiratory distress No Parainfluenza type 3 2 Birth F No Nil Mother GBS + pandemic H1N1 Negative 7 16 M 38.1°C Nil Brother with “flu” Negativea 7 17 F 37.9°C Vomited No Negative 3 GBS Group B streptococcus aUrine yielded Klebsiella sensitive to gentamicin This 10-day-old neonate with mild sneezing but no contact history was admitted via the emergency department to the neonatal unit and was cared in an incubator. She was feeding well as usual and there was no cough or running nose. The mother thought that the child was “hot” to touch. Physical examination was unremarkable except for a papular erythematous rash over her neck. Temperature was 37.5°C. Initial complete blood counts, C-reactive protein, cerebrospinal fluid analysis, urinalysis and chest radiograph were normal. She was put on intravenous antibiotics (penicillin and gentamicin) pending blood culture and nasopharyngeal aspirate (NPA) results. As this admission occurred during the HSI pandemic, the attending physician asked for the incubator to be placed in a corner away from the other patients (also in incubators) in the same cubicle. The parents were denied visiting until the NPA results were available, which turned out to be non-HSI influenza A on the same day. The neonate was promptly transferred to an isolation unit. She remained well, cultures were negative, the antibiotics discontinued 3 days later, and the child was discharged home. Serotyping subsequently showed that the virus was H3N2.
results were available, which turned out to be non-HSI influenza A on the same day. The neonate was promptly transferred to an isolation unit. She remained well, cultures were negative, the antibiotics discontinued 3 days later, and the child was discharged home. Serotyping subsequently showed that the virus was H3N2. One girl was isolated immediately after delivery because the mother with Group B streptococcus was diagnosed with pandemic H1N1-09 during the peri-natal period. She remained well and had no evidence of H1N1 infection. Respiratory viruses were screened negative in two febrile neonates. Klebsiella pneumoniae was isolated in the urine of one neonate who had a brother with “flu” symptoms. He received a course of intravenous antibiotics for the urinary tract infection. The other neonate became afebrile spontaneously. There was no outbreak of respiratory infections in the neonatal service during these admissions. Using an exact delivery rate of 6519 in 2009, the incidences of proven neonatal influenza A, parainfluenza and RSV admissions were 0.015%, 0.046% and 0.015% per annum, respectively.
One girl was isolated immediately after delivery because the mother with Group B streptococcus was diagnosed with pandemic H1N1-09 during the peri-natal period. She remained well and had no evidence of H1N1 infection. Respiratory viruses were screened negative in two febrile neonates. Klebsiella pneumoniae was isolated in the urine of one neonate who had a brother with “flu” symptoms. He received a course of intravenous antibiotics for the urinary tract infection. The other neonate became afebrile spontaneously. There was no outbreak of respiratory infections in the neonatal service during these admissions. Using an exact delivery rate of 6519 in 2009, the incidences of proven neonatal influenza A, parainfluenza and RSV admissions were 0.015%, 0.046% and 0.015% per annum, respectively. Discussion In this series, respiratory viral infections occured within the first postnatal month. None of the neonates with proven respiratory viral infections were febrile. The symptoms of influenza or common respiratory viral infection in the neonate may be trivial and nonspecific, making prompt diagnosis difficult. This could create problems with triage at the emergency department. To our knowledge, these were among the youngest neonates with influenza A and respiratory viral infections reported in Hong Kong. The local policy is that an unwell neonate (with or without fever) will be admitted to the neonatal service in an incubator at a designated area pending nasopharyngeal swab for respiratory virus or other investigations if symptoms are non-respiratory or non-specific. The baby will be admitted to a neonatal intensive care service with negative-pressure isolation facility if he/she is critically ill. The patient will be admitted to the pediatric ICU instead if he/she is older than 28 days of age. Other option includes admission to a pediatric infection ward for respiratory viral infection if the child is less ill. Nevertheless, isolation facilities may be overwhelmed during an influenza epidemic. As H1N1 is not airborne, it is appropriate to monitor a neonate with suspected pandemic H1N1-09 in an incubator in designated cubicle pending rapid viral investigation. Interestingly, the pandemic H1N1-09 does not appear to be the prevalent respiratory virus in the neonates.
be overwhelmed during an influenza epidemic. As H1N1 is not airborne, it is appropriate to monitor a neonate with suspected pandemic H1N1-09 in an incubator in designated cubicle pending rapid viral investigation. Interestingly, the pandemic H1N1-09 does not appear to be the prevalent respiratory virus in the neonates. The initial management of a febrile neonate includes stabilization of vital signs and immediate initiation of broad empirical antimicrobial coverage until potentially serious bacterial infections are excluded [2, 3]. The use of antiviral agents for influenza A infection in the neonate is problematic [3]. Side effects with its usage in children have been reported [4]. Furthermore, there is no standard preparation for a neonate who obviously cannot swallow the capsular form of the medication. Adverse effects in the neonates are not known [4]. Another controversy is with the use of antiviral in parents, patients and staff who have cared for the patient [4]. Currently, oseltamirvir is optionally offered to symptomatic parents and staff. Acute respiratory infections and influenza may occasionally be very serious and fatal in children [2]. Pandemic influenza may well be more severe in the neonatal population because of the lack of antibody protection to a novel strain [5, 6]. The most important measures in a neonatal intensive care unit in the event of a pandemic are likely to be preventive ones. Influenza immunization, if available, is recommended only for infants ≥6 months [3].
l be more severe in the neonatal population because of the lack of antibody protection to a novel strain [5, 6]. The most important measures in a neonatal intensive care unit in the event of a pandemic are likely to be preventive ones. Influenza immunization, if available, is recommended only for infants ≥6 months [3]. Since the SARS epidemic in 2003 [1, 7–9], the citizens of Hong Kong has become phobic to various infections. Outbreaks of infections in any institutions would hit news headlines. During a pandemic, the admission of a “not-so-ill” neonate with a viral infection is like introducing a wolf covered with a lamb skin among a flock of lambs. Isolation of affected infants and strict adherence to infection-control precautions are critical to control spread within a neonatal unit.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer-Verlag India 19023529 209 10.1007/s12098-008-0209-0 Symposium on Steroid Therapy Pulmonary Diseases and Corticosteroids Sethi G.R. 12 Singhal Kamal Kumar 1 1 grid.414698.6000000041767743XDepartment of Pediatrics Maulana Azad Medical College, New Delhi, India 2 grid.414698.6000000041767743XMaulana Azad Medical College, New Delhi-, 110002 India 21 11 2008 2008 75 10 1045 1056 19 8 2007 19 8 2007 © Dr. K C Chaudhuri Foundation 2008This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Steroids (corticosteroids) are anti-inflammatory drugs. Corticosteroids are used in many pulmonary conditions. Corticosteroids have a proven beneficial role in asthma, croup (Laryngotracheobronchitis), decreasing the risk and severity of respiratory distress syndrome (RDS), allergic bronchopulmonary aspergillosis, interstitial lung disease, hemangioma of trachea, Pulmonary eosinophillic disorders. Role of corticosteroids is controversial in many conditions e.g. idiopathic pulmonary hemosiderosis, bronchiolitis, hypersensitivity pneumonitis, hyperplasia of thymus, bronchiolitis, acute respiratory distress syndrome, aspiration syndromes, atypical pneumonias, laryngeal diphtheria, AIDS, SARS, sarcoidosis, meconium aspiration syndrome (MAS), pulmonary haemorrhage, bronchitis, bronchiolitis obliterans with organizing pneumonia in JRA, histiocytosis, á-1 antitrypsin deficiency, bordtella pertusis, pulmonary involvement in histiocytosis. However these are used empirically in many of these conditions despite lack of clear evidence in favour. There is concern about their side effects, especially on growth. Systemic steroids are associated with significant adverse effects. Pulmonary conditions have a strategic advantage that inhaled corticosteroids are useful in many of these.
empirically in many of these conditions despite lack of clear evidence in favour. There is concern about their side effects, especially on growth. Systemic steroids are associated with significant adverse effects. Pulmonary conditions have a strategic advantage that inhaled corticosteroids are useful in many of these. Although inhaled preparations of corticosteroids have been developed to maximise effective treatment of lung diseases characterised by inflammation and reduce the frequency of harmful effects, these have not been eliminated. There are situations where only systemic steroids are useful. Clinicians must weigh the benefits against the potential detrimental effects. It is recommended that standard protocols for use of steroids available in literature should be followed, always keeping a watch on the potential hazards of prolonged use. Key words SteroidsPulmonary diseasesInterstitial lung diseaseissue-copyright-statement© Dr. K C Chaudhuri Foundation 2008
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 7188198 BF02752663 10.1007/BF02752663 Symposium : Pediatric Emergencies Septic shock—an update Kumar Ashir M.B.B.S., M.D. grid.67105.350000000121643847Department of Pediatrics, Case Western Reserve University School of Medicicne at Saint Luke’s Hospital, Cleveland, Ohio 1982 49 5 745 750 © Department of Pediatrics All India Institute Of Medical Science 1982This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Keywords Septic ShockNaloxoneMetabolic AcidosisDisseminate Intravascular CoagulationTissue Hypoxiaissue-copyright-statement© Department of Pediatrics All India Institute Of Medical Science 1982
Introduction Severe Hand, Foot, and Mouth Disease induced by enterovirus 71 (EV71) infection is a known health risk for infants. More than 80 % of critically infected infants have pulmonary edema (PE) or hemorrhage [1]. PE is fatal, and most affected infants die within 24 h of developing PE [2]. The pathogenesis of EV71-induced PE is uncertain and has been studied only rarely. Wu et al. used pulmonary artery catheterization to monitor pulmonary circulation hemodynamics in 5 infants with EV71-induced PE and found that pulmonary artery wedge pressure (PAWP) was normal or slightly elevated [3]. Therefore, pulmonary capillary leakage may be a key factor in PE development. Angiopoietin-2 (Ang-2) is reportedly related to increased vascular permeability. Ang-1 is its natural antagonist. Ang-1 and Ang-2 are ligands for the endothelial cell-specific receptor tyrosine kinase Tie-2. Tie-2 is expressed throughout the surface of endothelial cells and has low activity [4]. Ang-2 antagonizes Tie-2, and Ang-1 activates Tie-2. Tie-2 activation helps decrease vascular permeability and prevents endothelial cell death [5, 6]. Ang-2 is normally stored in Weibel–Palade bodies and is rapidly released upon stimulation to mediate endothelium activation and sensitize endothelial response to inflammatory cytokines [7, 8]. Ang-2 levels increase in septic shock and are associated with vascular leakage and the development of acute respiratory distress syndrome (ARDS) [9]. Whether Ang-2 is also associated with EV71-induced PE remains unknown.
mediate endothelium activation and sensitize endothelial response to inflammatory cytokines [7, 8]. Ang-2 levels increase in septic shock and are associated with vascular leakage and the development of acute respiratory distress syndrome (ARDS) [9]. Whether Ang-2 is also associated with EV71-induced PE remains unknown. In the present study, the authors measured Ang-2 levels in the serum and PE fluid of infants with EV71 infection, and observed the effects of human recombinant Ang-2 and infected infant serum on the intercellular junctions of human pulmonary microvascular endothelial cells (HPMECs). The aim was to explore the relationship between Ang-2 and PE to further clarify the pathogenesis of PE. Material and Methods All of the infants included in this study were admitted to the intensive care unit of the Binzhou Medical University Affiliated Hospital (Binzhou, China) between April 2013 and June 2014. The study was approved by the hospital’s Medical Ethics Committee, and the parents of the infants provided informed consent.
Methods All of the infants included in this study were admitted to the intensive care unit of the Binzhou Medical University Affiliated Hospital (Binzhou, China) between April 2013 and June 2014. The study was approved by the hospital’s Medical Ethics Committee, and the parents of the infants provided informed consent. The included infants met the following criteria: (1) EV71 infection diagnostic criteria [10] including presenting symptoms of fever and maculopapular rash on the hand, foot, and buttock, mouth papules, or herpangina, with positive nucleic acid detection via throat or rectal swab or herpes fluid sampling; (2) Other criteria [11] including (a) sustained high fever (axillary temperature higher than 39 °C with poor response to conventional antipyretics), (b) neurological manifestations (the emergence of depression, vomiting, frightfulness, limb shaking), (c) respiratory abnormalities [irregular breath or breath frequency exceeding 30–40/min (by age) in a resting state], (d) circulatory dysfunction [increased heart rate (>140–150/min, by age), cold limbs, piebald skin, elevated blood pressure], (e) elevated peripheral white blood cell (WBC) count (peripheral blood WBC exceeding 15 × 109/L), and (f) elevated blood sugar (emergent stress hyperglycemia exceeding 8.3 mmol/L).
sting state], (d) circulatory dysfunction [increased heart rate (>140–150/min, by age), cold limbs, piebald skin, elevated blood pressure], (e) elevated peripheral white blood cell (WBC) count (peripheral blood WBC exceeding 15 × 109/L), and (f) elevated blood sugar (emergent stress hyperglycemia exceeding 8.3 mmol/L). The EV71-infected infants were divided into PE and non-PE groups according to the presence or absence of PE, respectively. PE was defined as the appearance of pulmonary crackles, alveolar congestion on chest radiography, or fresh red/pink blood in the endotracheal tube. Infants in the preoperative period of elective inguinal hernia surgery were enrolled in the control group. Information about vital signs, pulmonary symptoms, and chest radiography were collected for EV71-infected infants after admission. Cerebrospinal fluid (CSF) pressure was measured, and the CSF was analyzed. Infants with PE were immediately treated with orotracheal intubation and positive pressure ventilation. Alveolar edema fluid was collected via suction catheters when abundant blood-tinged secretion overflowed the intubation. The secretion was centrifuged, and the supernatant was used for analysis. Routine blood tests were performed to measure the levels of serum total protein, albumin, blood glucose, and creatine kinase isoenzymes (CK-MB) and the ratio of the partial pressure of arterial oxygen to the fraction of inspired oxygen (PaO2/FiO2). All serum and alveolar edema fluid samples were stored in a refrigerator at –80 °C until analysis.
rformed to measure the levels of serum total protein, albumin, blood glucose, and creatine kinase isoenzymes (CK-MB) and the ratio of the partial pressure of arterial oxygen to the fraction of inspired oxygen (PaO2/FiO2). All serum and alveolar edema fluid samples were stored in a refrigerator at –80 °C until analysis. EV71-infected infants were administered antiviral therapy, human immunoglobulin and methylprednisolone to suppress inflammatory reactions, mannitol to reduce intracranial pressure, and symptomatic treatment. Infants with PE were provided heart strengthening and diuresis treatments. Similar methods were used to record preoperative vital signs and perform routine blood tests in infants in the control group. After routine preoperative tests, the discarded serum samples were kept in a refrigerator at –80 °C for analysis. Ang-2 levels in serum and PE fluid were measured with enzyme-linked immunosorbent assay (R&D Systems, USA) according to the manufacturer’s instructions.
Similar methods were used to record preoperative vital signs and perform routine blood tests in infants in the control group. After routine preoperative tests, the discarded serum samples were kept in a refrigerator at –80 °C for analysis. Ang-2 levels in serum and PE fluid were measured with enzyme-linked immunosorbent assay (R&D Systems, USA) according to the manufacturer’s instructions. HPMECs (Sciencell, USA) were cultured in endothelial basal medium 2 supplemented with 5 % fetal bovine plasma and growth factors according to the manufacturer’s instructions. HPMECs were grown to confluence on glass coverslips and then divided into four groups. In group 1, 0.2 ml serum from the control group was added; in group 2, 0.2 ml of human recombinant Ang-2 (R&D Systems) was added; in group 3, 0.2 ml of serum from the PE group was added; and in group 4, 0.2 ml of serum from the PE group and 0.1 ml 10 ng/ml human recombinant Ang-1 (R&D Systems) was added. All coverslips were incubated for 24 h, and the cells were fixed for 30 min in 4 % paraformaldehyde. The monolayers were incubated overnight with anti-F-actin monoclonal antibody (R&D Systems) and anti-vascular endothelial (VE)-cadherin monoclonal antibody (R&D Systems) at 4 °C. The cells were stained with AlexaFluor 488 goat anti-mouse IgG (Abcam, USA) for F-actin, AlexaFluor 647 goat anti-rabbit IgG (Abcam) for VE-cadherin, and 4′,6-diamidino-2-phenylindole for nuclear staining, and the coverslips were mounted with 95 % glycerol. The stained cells were observed under a confocal fluorescence microscope to examine any gap formation between the endothelial cells.
USA) for F-actin, AlexaFluor 647 goat anti-rabbit IgG (Abcam) for VE-cadherin, and 4′,6-diamidino-2-phenylindole for nuclear staining, and the coverslips were mounted with 95 % glycerol. The stained cells were observed under a confocal fluorescence microscope to examine any gap formation between the endothelial cells. The data are presented as means ± standard deviation. Comparisons among three groups were performed with one-way analysis of variance followed by the Student–Newman–Keuls multiple-range test or Tamhane’s T2 test. Comparisons between two groups were made with the t-test. A P value of <0.05 was considered statistically significant.
e presented as means ± standard deviation. Comparisons among three groups were performed with one-way analysis of variance followed by the Student–Newman–Keuls multiple-range test or Tamhane’s T2 test. Comparisons between two groups were made with the t-test. A P value of <0.05 was considered statistically significant. Results A total of 161 infants with critical EV71 infection were admitted to the hospital during the study period. Of these, 39 infants had PE. Among the infants with PE, 19 died and 18 had large amounts of blood-tinged secretions overflowing the tracheal intubation (collected for the analysis). A total of 122 infants in the non-PE group survived. Compared with infants in the non-PE group, those in the PE group had a higher respiratory rate (37.3 ± 4.2 vs. 52.7 ± 4.4 breaths/min; P < 0.001) and a higher heart rate (144.2 ± 17.7 vs. 181.3 ± 30.1 beats/min; P < 0.001; Table 1). At admission, the blood pressures of 9 PE infants dropped distinctly or were unobtainable, whereas 30 PE infants showed elevated blood pressure. Oxygen saturation (PaO2/FiO2) in the PE group was significantly lower than that in the non-PE group (148.4 ± 79.9 vs. 383.1 ± 47.1; P < 0.001). The severity of PE depends on oxygenation failure and was graded as severe, moderate, and mild at PaO2/FiO2 ratios of 100, 200, and 300 mmHg, respectively. Nineteen PE infants with PaO2/FiO2 ratios below 200 before ventilation died, and 11 of these infants died within 24 h of hospitalization. Compared with infants in the non-PE group, surviving infants in the PE group stayed in the intensive care unit for significantly longer periods (3.3 ± 0.5 vs. 7.2 ± 1.2 d; P < 0.001). The average ventilation time of the surviving infants was 4.2 ± 0.3 d. Concurrently, 30 infants in the preoperative period of elective inguinal hernia surgery were selected after age-matching with PE infants. Table 1 shows the clinical data for the infants in the three groups.Table 1 Comparison of clinical data among the three infant groups
n time of the surviving infants was 4.2 ± 0.3 d. Concurrently, 30 infants in the preoperative period of elective inguinal hernia surgery were selected after age-matching with PE infants. Table 1 shows the clinical data for the infants in the three groups.Table 1 Comparison of clinical data among the three infant groups Variables Control group Non-PE group PE group Sex (male/female) 16/14 65/57 21/18 Age (mo) 13.2 ± 5.6 14.3 ± 5.9 13.5 ± 5.7 Temperature (°C) 36.7 ± 0.3 38.4 ± 0.8# 38.9 ± 1.1# Heart rate (bpm) 108.6 ± 11.1 144.2 ± 17.7# 181.3 ± 30.1#* Respiratory rate 28.3 ± 2.1 37.3 ± 4.2# 52.7 ± 4.4#* Blood pressure SBP (mmHg) 83.3 ± 2.2 101.5 ± 9.2# 115.1 ± 17.8#Δ DBP (mmHg) 43.5 ± 2.9 66.2 ± 12.1 # 78.9 ± 16.8# Δ WBC count (×1012/L) 10.2 ± 2.3 10.2 ± 2.8 22.0 ± 9.1#* Albumin (g/L) 46.1 ± 2.4 43.2 ± 3.0 33.3 ± 4.7#* GLU (mmol/L) 5.8 ± 0.7 6.3 ± 1.3 15.5 ± 9.7#* PaO2/FiO2 464.3 ± 4.3 383.1 ± 47.1# 148.4 ± 79.9#* CK-MB (U/L) 22.5 ± 5.2 36.6 ± 8.8 43.0 ± 13.5# Cerebrospinal fluid Pressure (mmH2O) 183.3 ± 33.5 213.4 ± 29.0* Karyocytes (×106/L) 62.5 ± 52.2 86.1 ± 85.3 Protein (mg/dl) 22.5 ± 6.2 26.0 ± 6.7 LVEF 71.1 ± 4.2 72.4 ± 6.7 67.5 ± 11.3 bpm beats per minute; CK-MB Creatine kinase-MB isoenzyme; DBP Diastolic blood pressure; LVEF Left ventricle ejection fraction; PaO 2 /FiO 2 Ratio of partial pressure of arterial oxygen to fraction of inspired oxygen; PE Pulmonary edema; SBP Systolic blood pressure; WBC White blood cell # P < 0.05 compared with the control group; Δ P < 0.05 compared with the non-PE group; *P < 0.01 compared with the non-PE group
bpm beats per minute; CK-MB Creatine kinase-MB isoenzyme; DBP Diastolic blood pressure; LVEF Left ventricle ejection fraction; PaO 2 /FiO 2 Ratio of partial pressure of arterial oxygen to fraction of inspired oxygen; PE Pulmonary edema; SBP Systolic blood pressure; WBC White blood cell # P < 0.05 compared with the control group; Δ P < 0.05 compared with the non-PE group; *P < 0.01 compared with the non-PE group CSF pressure increased markedly in the PE and non-PE groups but was higher in the former. Nucleated cell counts were normal or moderately increased in the non-PE group and even higher in the PE group, but the difference was not statistically significant. The majority of these nucleated cells were monocytes. CSF protein levels were normal in both groups. Compared with infants in the non-PE group, those in the PE group had a higher blood sugar level (6.3 ± 1.3 vs. 15.5 ± 9.7 mmol/L; P = 0.002) and WBC count (10.2 ± 2.8 vs. 22.0 ± 9.1 × 109/L; P < 0.001). Serum albumin level was lower in the PE group than in the non-PE group (33.3 ± 4.7 vs. 43.2 ± 3.0 g/L; P < 0.001). No statistically significant differences were found in WBC count or blood sugar and serum albumin levels between the non-PE and control groups.
and WBC count (10.2 ± 2.8 vs. 22.0 ± 9.1 × 109/L; P < 0.001). Serum albumin level was lower in the PE group than in the non-PE group (33.3 ± 4.7 vs. 43.2 ± 3.0 g/L; P < 0.001). No statistically significant differences were found in WBC count or blood sugar and serum albumin levels between the non-PE and control groups. PE fluid was acquired from only 18 infants with severe PE. The total protein, albumin, and lactate dehydrogenase levels of the fluid are given in Table 2. The PE fluid-to-serum (P/S) ratio of total protein was 0.9 ± 0.2, and all P/S ratios of albumin were 1.0 ± 0.3.Table 2 Biochemical test results for pulmonary edema fluid from 18 infants with enterovirus 71-induced pulmonary edema TP (g/L) TP P/S ALB (g/L) ALB P/S LDH (U/L) LDH P/S Ang-2 (pg/ml) Ang-2 P/S 55.3 ± 16.2 0.9 ± 0.2 31.1 ± 4.1 1.0 ± 0.3 1233.6 ± 157.7 3.4 ± 07 2973.2 ± 1038.1 1.2 ± 0.2 ALB Albumin; Ang-2 Angiopoietin-2; LDH Lactate dehydrogenase; P/S Pulmonary edema fluid/serum ratio of the corresponding protein; TP Total protein
PE fluid was acquired from only 18 infants with severe PE. The total protein, albumin, and lactate dehydrogenase levels of the fluid are given in Table 2. The PE fluid-to-serum (P/S) ratio of total protein was 0.9 ± 0.2, and all P/S ratios of albumin were 1.0 ± 0.3.Table 2 Biochemical test results for pulmonary edema fluid from 18 infants with enterovirus 71-induced pulmonary edema TP (g/L) TP P/S ALB (g/L) ALB P/S LDH (U/L) LDH P/S Ang-2 (pg/ml) Ang-2 P/S 55.3 ± 16.2 0.9 ± 0.2 31.1 ± 4.1 1.0 ± 0.3 1233.6 ± 157.7 3.4 ± 07 2973.2 ± 1038.1 1.2 ± 0.2 ALB Albumin; Ang-2 Angiopoietin-2; LDH Lactate dehydrogenase; P/S Pulmonary edema fluid/serum ratio of the corresponding protein; TP Total protein The Ang-2 levels in the non-PE group were higher than those in the control group, although the difference was not statistically significant (333.2 ± 79.7 pg/ml vs. 199.9 ± 26.7 pg/ml; P = 0.115; Fig. 1). Ang-2 levels in the PE group (2819.2 ± 908.7 pg/ml) were higher than those in the non-PE and control groups (P < 0.001). Compared with Ang-2 levels in the serum, those in the PE fluid were similar or slightly higher (Table 2).Fig. 1 Serum angiopoietin-2 levels in the three groups. No statistically significant difference in serum angiopoietin-2 levels was noted between the non-pulmonary edema group and the control group (333.2 ± 79.7 vs. 199.9 ± 26.7 pg/ml; P = 0.115). Compared with serum angiopoietin-2 levels in the control and non-pulmonary edema groups, angiopoietin-2 in the pulmonary edema group was higher (both, P < 0.001). # P < 0.01 compared with the control group. ▼ P < 0.01 compared with the non-pulmonary edema group
ity. The VE-cadherin molecule is related to F-actin. When inflammatory mediators stimulate the endothelium, F-actin rearranges and centripetal tension increases. Changes in the F-actin skeleton affect the endothelial connections and lead to the formation of gaps in the endothelium, thereby increasing permeability [17]. Several inflammatory cytokines—including granulocyte colony-stimulating factor, interleukin (IL)-6, IL-10, IL-13, and interferon-γ—that can increase endothelial permeability are elevated in the serum of EV71-infected infants [18–20]. To exclude the effects of other factors, the authors incubated HPMECs with Ang-1, the natural antagonist of Ang-2, combined with infected infant serum and found that F-actin expression decreased, VE-cadherin staining increased, and cell connections remained intact. The present experimental results indicated that Ang-2 from infected infant serum played a central role in damaging the endothelial connection, and this damage may be the key contributory factor in the development of PE. Meanwhile, it is also indicated that some inflammatory mediators in the serum of EV71-infected PE infants had high expressions, and several inflammatory cytokines could increase the vascular permeability. Thus, further studies are needed to verify the effects of elevated Ang-2 levels in PE fluid and serum on vascular leakage in EV71-induced PE.
cated that some inflammatory mediators in the serum of EV71-infected PE infants had high expressions, and several inflammatory cytokines could increase the vascular permeability. Thus, further studies are needed to verify the effects of elevated Ang-2 levels in PE fluid and serum on vascular leakage in EV71-induced PE. Conclusions The results of this study showed that the PE fluid of EV71-induced PE infants is rich in proteins and that the serum of PE infants break the cell connections of HPMECs, which implicates increased vascular leakage in the pathogenesis of EV71-induced PE. The breakage of HPMEC connections by Ang-2 from the serum of infants with PE was reversed by human recombinant Ang-1, which suggests that Ang-2 is associated with the development and progression of PE induced by EV71. The authors thank the Binzhou Center for Disease Control for their help in collecting specimens and providing the virus analysis data.
Conclusions The results of this study showed that the PE fluid of EV71-induced PE infants is rich in proteins and that the serum of PE infants break the cell connections of HPMECs, which implicates increased vascular leakage in the pathogenesis of EV71-induced PE. The breakage of HPMEC connections by Ang-2 from the serum of infants with PE was reversed by human recombinant Ang-1, which suggests that Ang-2 is associated with the development and progression of PE induced by EV71. The authors thank the Binzhou Center for Disease Control for their help in collecting specimens and providing the virus analysis data. Contributions XW: Principal investigator, oversaw the study design, conducted most of the data analysis, and wrote most of the manuscript; ZQ: Study physician, oversaw patient care, and assisted with interpreting the results and editing the paper; ZL: Oversaw the laboratory measurements and assisted with interpreting the results and editing the manuscript; DH: Assisted with statistical analysis and editing the paper; TW: Collected serum and pulmonary edema fluid samples, and assisted with interpreting the results and editing the manuscript; YX: Collected the clinical data; TS: Completed cell experiments; JW: Completed sample analyses; FZ: Supervised many of the study participants. All authors have read and approved the final manuscript as submitted. XW will act as guarantor for this paper. Conflict of Interest None.
Contributions XW: Principal investigator, oversaw the study design, conducted most of the data analysis, and wrote most of the manuscript; ZQ: Study physician, oversaw patient care, and assisted with interpreting the results and editing the paper; ZL: Oversaw the laboratory measurements and assisted with interpreting the results and editing the manuscript; DH: Assisted with statistical analysis and editing the paper; TW: Collected serum and pulmonary edema fluid samples, and assisted with interpreting the results and editing the manuscript; YX: Collected the clinical data; TS: Completed cell experiments; JW: Completed sample analyses; FZ: Supervised many of the study participants. All authors have read and approved the final manuscript as submitted. XW will act as guarantor for this paper. Conflict of Interest None. Source of Funding All phases of this study were supported by the Projects of Science and Technology of Shandong Province (ZR2014HM112) and the Taishan Scholar Project of Shandong Province.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer-Verlag India 18245943 14 10.1007/s12098-008-0014-9 Clinical Brief Persistent thrombocytopenia following dengue shock syndrome Kohli Utkarsh Saharan Sunil Lodha Rakesh rakesh_lodha@hotmail.com Kabra S. K. grid.413618.90000000417676103Department of Pediatrics, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, 110029 India 20 5 2008 2008 75 1 82 83 22 12 2006 31 10 2007 Dr. K C Chaudhuri Foundation 2008This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Though thrombocytopenia is one of the hallmarks of dengue hemorrhagic fever/ dengue shock syndrome, persistence of the same is rare. We report an 11 year-old child with dengue shock syndrome, who developed persistent thrombocytopenia. The possible mechanisms are discussed. Key words ThrombocytopeniaDengue shock syndromeissue-copyright-statement Dr. K C Chaudhuri Foundation 2008
Introduction Meningococcal disease is a global problem. It has a rapid onset with varied presentations and wide regional variation in disease pattern. The endemic disease is rare but epidemic form occurs commonly in many regions of the world especially described in the ‘meningitis belt’ in sub- Saharan Africa, parts of Asia and also in India. Meningococcal disease mostly affects children in the school going age and adults working in close contact such as in military barracks. The disease requires early and prompt antibiotic treatment and supportive therapy. The outcome of the disease depends on the time required to seek medical help i.e., the ‘house to hospital time’ and also on the rapidity of administration of the first antibiotic dose i.e., the ‘door to needle time’. Meghalaya situated at an altitude of 1,961 m above sea level has a predominantly rural tribal population. An epidemic of meningococcal disease occurred in this region during 2008–2009. The present study documents the occurrence of the disease in this part of the world, and also highlights the various clinical manifestations, laboratory findings and management outcome.
sea level has a predominantly rural tribal population. An epidemic of meningococcal disease occurred in this region during 2008–2009. The present study documents the occurrence of the disease in this part of the world, and also highlights the various clinical manifestations, laboratory findings and management outcome. Material and Methods This descriptive retrospective study over the period of the epidemic, January 2008 through June 2009 is being reported from the Department of Pediatric Disciplines, NEIGRIHMS, Shillong. One hundred ten children diagnosed as either ‘meningococcemia’ or ‘meningococcal meningitis’ or ‘meningococcemia with meningitis’ during the study period were identified from discharge summaries and inpatient records. Their charts were retrieved and reviewed thoroughly. At admission, blood and cerebrospinal fluid (CSF) were sent to the laboratory immediately for culture and sensitivity testing, cytology and gram staining. Complete blood count (CBC) and peripheral blood smear for malarial parasite, random blood sugar (RBS), liver function test (LFT), coagulation profile, renal function test (RFT), serum electrolytes and chest x-ray (CXR) were done on the day of admission in all patients and repeated periodically if necessary. MRI brain was done when clinically indicated. The cases of meningococcal meningitis and meningococcemia in the present case series were labelled as probable meningococcal meningitis, confirmed meningococcal meningitis, probable meningococcaemia and confirmed meningococcaemia as per standard guidelines [1].
Material and Methods This descriptive retrospective study over the period of the epidemic, January 2008 through June 2009 is being reported from the Department of Pediatric Disciplines, NEIGRIHMS, Shillong. One hundred ten children diagnosed as either ‘meningococcemia’ or ‘meningococcal meningitis’ or ‘meningococcemia with meningitis’ during the study period were identified from discharge summaries and inpatient records. Their charts were retrieved and reviewed thoroughly. At admission, blood and cerebrospinal fluid (CSF) were sent to the laboratory immediately for culture and sensitivity testing, cytology and gram staining. Complete blood count (CBC) and peripheral blood smear for malarial parasite, random blood sugar (RBS), liver function test (LFT), coagulation profile, renal function test (RFT), serum electrolytes and chest x-ray (CXR) were done on the day of admission in all patients and repeated periodically if necessary. MRI brain was done when clinically indicated. The cases of meningococcal meningitis and meningococcemia in the present case series were labelled as probable meningococcal meningitis, confirmed meningococcal meningitis, probable meningococcaemia and confirmed meningococcaemia as per standard guidelines [1]. Patients were treated for the first 6 mo with injection ceftriaxone but later with parenteral chloramphenicol due to observation of clinical drug resistance in the form of delayed or no response to ceftriaxone in 48–72 h. Antibiotics were administered for a minimum of 7 d in all patients along with supportive care and monitoring. Injection dexamethasone was used in all cases with meningitis for 2 d. Shock was treated with normal saline and inotropes (dopamine and dobutamine), whenever indicated and hydrocortisone.
eftriaxone in 48–72 h. Antibiotics were administered for a minimum of 7 d in all patients along with supportive care and monitoring. Injection dexamethasone was used in all cases with meningitis for 2 d. Shock was treated with normal saline and inotropes (dopamine and dobutamine), whenever indicated and hydrocortisone. Results A total of 110 children were diagnosed as having either ‘meningococcemia’ or ‘meningococcal meningitis’ or ‘meningococcemia with meningitis’. The demographic profile and clinical presentations are outlined in Table 1. Among these cases, 61.8 % were boys and 38.2 % were girls (boys:girls = 1.62:1). The mean age of presentation was 8.48 ± 5.09 y (4 mo–18 y). Fever was the most common symptom (100 %) followed by headache (56.4 %), vomiting (53.6 %), altered sensorium (25.5 %), purpura and rashes (23.6 %), seizures (9.1 %), abdominal symptoms (4.5 %), irritability and excessive crying (4.5 %). Meningeal signs were present in 86 cases (78.2 %) and bulging anterior fontanalle in 3 out of 13 cases (23 %) below the age of 18 mo. Shock was seen in 42 cases (38.2 %) (29 compensated and 13 decompensated). The average number of isotonic saline boluses required was 40 ml/kg (range: 20 ml/kg to 100 ml/kg). Fifteen cases (13.6 %) required inotropic support and hydrocortisone singly or in combination. The average duration of inotropic support was 24–72 h.Table 1 Demographic, clinical, laboratory and outcome profile of the patients
erage number of isotonic saline boluses required was 40 ml/kg (range: 20 ml/kg to 100 ml/kg). Fifteen cases (13.6 %) required inotropic support and hydrocortisone singly or in combination. The average duration of inotropic support was 24–72 h.Table 1 Demographic, clinical, laboratory and outcome profile of the patients Mean ± SD or no. (%) Demographic data Mean age 8.48±5.09 y M:F 1.62:1 Clinical data Fever 110 (100) Headache 62 (56.4) Vomiting 59 (53.6) Purpura/rashes 26 (23.6) Altered sensorium /low GCS 28 (25.5) Seizure 10 (9.1) Abdominal symptoms 5 (4.5) Irritability and excess cry 5 (4.5) Meningeal signs 86 (78.2) Bulging anterior fontanalle (<18 mo of age) 3/13 (23) Shock 42 (38.2) Laboratory data Hemoglobin 9.4±1.8 g/dl Total leucocyte count 16,071±14525/ mm3 Platelet count 310,531±211,421/mm3 Deranged LFT 11 (10) Prolong PT 18 (16.4) CSF TC Range 5–60000 CSF Low sugar 74 (67.3) CSF Positive gram stain 27 (24.5) Positive culture in CSF 29 (26.4) Blood culture positive 13 (11.8) Total culture positive 39 (35.5) Outcome Ventilatory support 7 d (4.2±3.2 d) Death 7 (6.4)
Mean ± SD or no. (%) Demographic data Mean age 8.48±5.09 y M:F 1.62:1 Clinical data Fever 110 (100) Headache 62 (56.4) Vomiting 59 (53.6) Purpura/rashes 26 (23.6) Altered sensorium /low GCS 28 (25.5) Seizure 10 (9.1) Abdominal symptoms 5 (4.5) Irritability and excess cry 5 (4.5) Meningeal signs 86 (78.2) Bulging anterior fontanalle (<18 mo of age) 3/13 (23) Shock 42 (38.2) Laboratory data Hemoglobin 9.4±1.8 g/dl Total leucocyte count 16,071±14525/ mm3 Platelet count 310,531±211,421/mm3 Deranged LFT 11 (10) Prolong PT 18 (16.4) CSF TC Range 5–60000 CSF Low sugar 74 (67.3) CSF Positive gram stain 27 (24.5) Positive culture in CSF 29 (26.4) Blood culture positive 13 (11.8) Total culture positive 39 (35.5) Outcome Ventilatory support 7 d (4.2±3.2 d) Death 7 (6.4) The laboratory investigations of all the cases are summarized in Table1. Culture (either blood or CSF) was positive in 39 cases (35.5 %) (CSF: 29, blood: 13). In three cases (2.7 %), growth was seen both in the blood and CSF. Gram negative diplococci in CSF was seen in 27 cases; of which 8 cases were culture negative. All cases were identified as serogroup A and were susceptible to ceftriaxone and chloramphenicol by in-vitro antimicrobial testing. The mean blood leukocyte count was 16,071 ± 14525/cumm. The CSF cell count ranged from 5 to 60,000/cu mm and hypoglycorrhacia were seen in 67.3 % of the cases. Ten percent of the cases had deranged LFT and 16.4 % had coagulopathy.
nd were susceptible to ceftriaxone and chloramphenicol by in-vitro antimicrobial testing. The mean blood leukocyte count was 16,071 ± 14525/cumm. The CSF cell count ranged from 5 to 60,000/cu mm and hypoglycorrhacia were seen in 67.3 % of the cases. Ten percent of the cases had deranged LFT and 16.4 % had coagulopathy. Majority of the cases were seen in the months of December 2008 and January to March 2009 (Fig. 1). Sixty nine percent of the cases were seen in children above 5 y of age (Fig. 2).Fig. 1 Month wise distribution of cases from Jan 2008 to June 2009 Fig 2 Age wise distribution of cases Meningococcal meningitis and meningococcemia were diagnosed in 68 cases (61.8 %) and 22 cases (20 %) respectively with a corresponding mortality of 2.9 % (2/68) and 18.2 % (4/22). Twenty children (18.2 %) presented with both meningococcemia and meningitis with 1 death. There was no difference in mortality or morbidity between the culture positive or culture negative cases. Of the 68 children with meningococcal meningitis, 44 had probable meningitis while 24 were confirmed. Of the 22 children with meningococcemia, 15 had probable meningococcemia while 7 were confirmed. Of the 20 children with meningococcemia and meningitis, 12 were probable while 8 were confirmed (Fig. 3).Fig 3 Study flow chart
68 children with meningococcal meningitis, 44 had probable meningitis while 24 were confirmed. Of the 22 children with meningococcemia, 15 had probable meningococcemia while 7 were confirmed. Of the 20 children with meningococcemia and meningitis, 12 were probable while 8 were confirmed (Fig. 3).Fig 3 Study flow chart The important complications have been summarized in Table 2. Raised ICP was the most common (28.2 %) and was diagnosed clinically by the presence of bulging anterior fontanelle, bradycardia/tachycardia, papilledema and hypertension. Herpes labialis was observed in 9.1 % of cases. Three important metabolic complications of meningococcal infection observed in the present case series were SIADH (8 cases, 7.3 %), diabetes insipidus (5 cases, 4.5 %) and cerebral salt wasting syndrome (1 case, 0.9 %). All the cases with diabetes insipidus and cerebral salt wasting syndrome expired. Meningococcal purpura fulminans were seen in 5 cases (4.5 %) whereas 6 cases (5.5 %) developed arthritis, and 2 cases each had subdural empyema and optic neuritis. Mortality was 6.4 %.Table 2 Complications in all the cases
1 case, 0.9 %). All the cases with diabetes insipidus and cerebral salt wasting syndrome expired. Meningococcal purpura fulminans were seen in 5 cases (4.5 %) whereas 6 cases (5.5 %) developed arthritis, and 2 cases each had subdural empyema and optic neuritis. Mortality was 6.4 %.Table 2 Complications in all the cases Complications No. (%) Raised intracranial pressure 31 (28.2) Coagulopathy 18 (16.4) Hepatopathy 11 (10) Herpes labialis 10 (9.1) SIADH 8 (7.3) Pneumonia 7 (6.4) Arthritis and effusion 6 (5.5) Purpura fulminans 5 (4.5) Respiratory failure 5 (4.5) Sixth nerve palsy 5 (4.5) Diabetes insipidus 5 (4.5) Subdural empyema 2 (1.8) Optic neuritis 2 (1.8) ARDS 2 (1.8) ARF 2 (1.8) Cerebral salt wasting syndrome 1 (0.9) Third nerve palsy 1 (0.9) Cerebritis 1 (0.9) Hearing impairment 1 (0.9)
rthritis and effusion 6 (5.5) Purpura fulminans 5 (4.5) Respiratory failure 5 (4.5) Sixth nerve palsy 5 (4.5) Diabetes insipidus 5 (4.5) Subdural empyema 2 (1.8) Optic neuritis 2 (1.8) ARDS 2 (1.8) ARF 2 (1.8) Cerebral salt wasting syndrome 1 (0.9) Third nerve palsy 1 (0.9) Cerebritis 1 (0.9) Hearing impairment 1 (0.9) Discussion Epidemic meningococcal disease was first described by Vieusseaux in 1805 from Switzerland [2]. Meningococcal infections are commonly found in developing countries such as in the African meningitis belt and occasionally in developed countries like the United States. Serogroup A is more prevalent in developing countries whereas, in the developed countries the disease is mostly caused by serogroup B and C [3]. In India, meningococcal disease is endemic in Delhi with sporadic cases reported in the past [1]. Isolated cases of meningococcal meningitis were also reported from several states of India involving Haryana, Uttar Pradesh, Rajasthan, Sikkim, Gujarat, Jammu & Kashmir, West Bengal, Chandigarh, Kerala and Orissa in 1985 [4]. Most of these outbreaks have been caused by serogroup A [5]. N. meningitidis was the dominant pathogen isolated in Surat between 1985 and 87 [6]. In early 2005, spurt of cases of Neiserria meningococcemia and meningitis due to serogroup A have been reported from Delhi and adjoining areas [7]. No previous reports exist from north east India.
s have been caused by serogroup A [5]. N. meningitidis was the dominant pathogen isolated in Surat between 1985 and 87 [6]. In early 2005, spurt of cases of Neiserria meningococcemia and meningitis due to serogroup A have been reported from Delhi and adjoining areas [7]. No previous reports exist from north east India. Approximately 69 % were above 5 y of age. Maximum cases reported were below 1–2 y of age from USA for endemic disease [8]. In epidemic outbreaks a shift to higher age occurs [9]. In Sudan, 58 % were above 5 y in a group A—N. meningitidis outbreak [10]. In Ghana however the peak incidence was found in 10–14 y old children [11]. Neonatal meningococcal meningitis is rare and there was no case of neonatal meningitis in the present study.
[8]. In epidemic outbreaks a shift to higher age occurs [9]. In Sudan, 58 % were above 5 y in a group A—N. meningitidis outbreak [10]. In Ghana however the peak incidence was found in 10–14 y old children [11]. Neonatal meningococcal meningitis is rare and there was no case of neonatal meningitis in the present study. Meningococcal infection is characteristically fulminant presenting with fever, severe headache, vomiting, neck stiffness, positive meningeal signs, photophobia, drowsiness and confusion. Deterioration and death can occur in hours. The disease spectrum usually ranges from meningococcal meningitis to meningococcemia. Meningitis may or may not be present with rash. Seizures occur in 40 % of cases. Meningococcemia is more abrupt presenting with chills, nausea, vomiting, myalgias and the classical purpuric or petechial rash with or without bullae formation. Absence of meningitis is a poor prognostic factor. Septicaemia was found in 20 % cases. Urmila et al. from Delhi reported that 67 % children had meningococcal meningitis, 20 % had meningococcemia and 13 % had both with mortality of 4.5 %, 25 % and 69 %, respectively [12]. This is similar to findings in the present study.
sence of meningitis is a poor prognostic factor. Septicaemia was found in 20 % cases. Urmila et al. from Delhi reported that 67 % children had meningococcal meningitis, 20 % had meningococcemia and 13 % had both with mortality of 4.5 %, 25 % and 69 %, respectively [12]. This is similar to findings in the present study. Shock was the presenting symptom in 38 % of the index cases. Of these, 69 % had compensated and 31 % had decompensated shock compared to 26 % in other reports [12]. Shock is endotoxin mediated and due to factors such as widespread capillary leak, loss of vasomotor tone and maldistribution of intravascular volume, impaired myocardial function and impaired cellular function. Early recognition of shock is crucial for early intervention and improved outcome [13]. Tachycardia may be the only sign present in the early phase of the disease and is enough to mandate fluid resuscitation. Circulatory management aims to maintain tissue perfusion and oxygenation. Repeated fluid boluses with 20 ml/kg of isotonic saline are to be given initially till shock resolves. In case shock persists after 60 ml/kg of fluid, central venous pressure (CVP) line is inserted and fluid resuscitation continued with addition of dopamine and/or dobutamine. Some children require as high as 100–200 ml/kg of fluid resuscitation but such patients also require mechanical ventilation. About 13.6 % of the index cases required inotropic support either alone or in combination for an average duration of 24–72 h. Some studies have shown that 4.5 % albumin is more useful as a resuscitating fluid [14]. Albumin is routinely used in the UK with significant reduction in mortality in the last 20 y (decrease up to 2 %) in patients with meningococcal disease and albumin use may play a role along with other factors [15]. The authors do not have any personal experience of using albumin. Survival rate reaches 94 % when shock is reversed within 75 min of presentation [13].
icant reduction in mortality in the last 20 y (decrease up to 2 %) in patients with meningococcal disease and albumin use may play a role along with other factors [15]. The authors do not have any personal experience of using albumin. Survival rate reaches 94 % when shock is reversed within 75 min of presentation [13]. Rash was observed in 23.6 %, while this sign ranged from 7.3 % to 100 % in other studies [16, 17]. Meningococcal purpura fulminans is a hemorrhagic condition associated with meningococcal septicemia with features of hypotension, disseminated intravascular coagulation (DIC), and purpura leading to tissue necrosis and small vessel thrombosis. In the present study, 5 cases (4.5 %) presented with purpura fulminans and of them 3 died. Schaad UB [18] has described arthritis in 10 % of patients with meningococcal disease. In the present study, 5.5 % presented with arthritis involving big joints. Arthritis may occur early in the disease due to direct bacterial seeding of the joints or in the sub-acute or convalescent phase of the illness secondary to immune-complex reactions. Treatment of bacterial arthritis consists of analgesics, antibiotics and drainage of joint fluid if needed. Immune complex reactions are usually treated with non-steroidal anti-inflammatory drugs or steroids. Some may require intravenous immunoglobin [19]. Reactivation of latent herpes simplex virus infections (primarily herpes labialis) is common during meningococcal infection as observed in the present study with good response to local acyclovir.
Schaad UB [18] has described arthritis in 10 % of patients with meningococcal disease. In the present study, 5.5 % presented with arthritis involving big joints. Arthritis may occur early in the disease due to direct bacterial seeding of the joints or in the sub-acute or convalescent phase of the illness secondary to immune-complex reactions. Treatment of bacterial arthritis consists of analgesics, antibiotics and drainage of joint fluid if needed. Immune complex reactions are usually treated with non-steroidal anti-inflammatory drugs or steroids. Some may require intravenous immunoglobin [19]. Reactivation of latent herpes simplex virus infections (primarily herpes labialis) is common during meningococcal infection as observed in the present study with good response to local acyclovir. Coagulopathy is frequent and multifactorial, and was seen in 16.4 % of the present cases. Mild clotting abnormalities are well tolerated. In severe cases fresh frozen plasma (FFP) is recommended. The authors have used intravenous vitamin K and if required FFP with good results. Currently the best treatment for meningococcal related coagulopathy is the optimal management of shock. Dodge and Swartz [20] reported seizures in 10 % in the acute stage of the disease, focal cerebral signs in 10 %, and 15 of 39 patients had cranial nerve involvement early in the course of disease. In the present study, 9.1 % of the cases presented with seizures in the acute stage and cranial nerve involvement was present in 7.3 % cases.
20] reported seizures in 10 % in the acute stage of the disease, focal cerebral signs in 10 %, and 15 of 39 patients had cranial nerve involvement early in the course of disease. In the present study, 9.1 % of the cases presented with seizures in the acute stage and cranial nerve involvement was present in 7.3 % cases. SIADH was detected in 4 of 39 patients by Dodge and Swartz [20]. In the present study, SIADH was found in 8 cases (7.3 %) and was managed with fluid restriction and low dose diuretic (furosemide) therapy. Five cases (4.5 %) had diabetes insipidus (DI), requiring aggressive management with hypotonic fluids, vasopressin and mechanical ventilation and one had cerebral salt wasting (CSW). All the index patients with DI and CSW had 100 % mortality. Although Pollard RB [21] has reported that deafness has not been a common complication of meningococcal meningitis in the antibiotic era, there was one case with bilateral sensorineural hearing defect in the present study. Pneumonia, epiglotitis and otitis media can occur. Pneumonia is seen in 5 to 15 % of invasive meningococcal disease cases, particularly with serogroups Y and W-135 [22]. In the present study, pneumonia was present in 6.4 % cases. Recovery may be complicated by ARDS, anuria and multi organ failure. In some cases ARDS develops within a few hours after admission and in the present study 2 cases each developed ARDS and ARF.
ccal disease cases, particularly with serogroups Y and W-135 [22]. In the present study, pneumonia was present in 6.4 % cases. Recovery may be complicated by ARDS, anuria and multi organ failure. In some cases ARDS develops within a few hours after admission and in the present study 2 cases each developed ARDS and ARF. In a study from Punjab (Ludhiana), 56.5 % were culture positive and all isolates were sensitive to most of the common antibiotics [23]. Urmila J et al reported 26 positive cultures (13/98 blood cultures and 13/89 CSF cultures) [12]. Low rate of culture positivity in the present study (35.5 %) may be due to prior use of antibiotics outside or delay in transporting the specimen.
tive and all isolates were sensitive to most of the common antibiotics [23]. Urmila J et al reported 26 positive cultures (13/98 blood cultures and 13/89 CSF cultures) [12]. Low rate of culture positivity in the present study (35.5 %) may be due to prior use of antibiotics outside or delay in transporting the specimen. Antibiotic therapy remains the cornerstone of therapy in meningococcal disease. Three factors that influence the success of antibiotic therapy are timing of the antibiotic, tissue penetration and antibiotic resistance. Broad spectrum antibiotics like penicillin G, ceftriaxone and cefotaxime remain widely used. Increasing resistance to penicillin is being reported and ceftriaxone remains the recommended first line therapy in the present scenario. However in the authors’ experience they had patients with good response to ceftriaxone in the beginning of the epidemic. After about 6 mo of the epidemic, there was poor clinical response to ceftriaxone and the unit antibiotic policy was revised to intravenous chloramphenicol for 7 d with good response. They now routinely use parenteral chloramphenicol as the first line therapy in meningococcal disease. There are other reports of ciprofloxacin as well as ceftriaxone resistance from India [24, 25]. The second line therapy consists of vancomycin and azithromycin.
o intravenous chloramphenicol for 7 d with good response. They now routinely use parenteral chloramphenicol as the first line therapy in meningococcal disease. There are other reports of ciprofloxacin as well as ceftriaxone resistance from India [24, 25]. The second line therapy consists of vancomycin and azithromycin. The NICE guidelines recommend dexamethasone therapy for suspected or confirmed bacterial meningitis above 3 mo of age [26]. The authors used injection dexamethasone in all meningococcal meningitis cases for 2 d. Steroids are not indicated in meningococcal shock unless there is suspicion of hypoadrenalism. Overall fatality rate of invasive meningococcal infection is 5–16 %, although these rates are difficult to assess as some studies only take into account meningococcal meningitis, while others reflect overall fatality from meningococcal disease [27, 28]. Reported mortality from meningococcemia ranges from 18 % to 35 % [29]. For overall invasive meningococcal infection, the fatality rate in the present study was low (6.4 %). For meningococcemia, fatality rate in the present study was 18.2 % which is similar to other studies [29]. Low mortality in the present study can be explained by the fact that patients reached the hospital fast due to good information, education and communication activities by the local health authorities, combined with a low threshold for diagnosis and aggressive management of shock, rapidity of administration of the first antibiotic dose (door to needle time) and continuous monitoring in a well equipped pediatric intensive care unit.
d information, education and communication activities by the local health authorities, combined with a low threshold for diagnosis and aggressive management of shock, rapidity of administration of the first antibiotic dose (door to needle time) and continuous monitoring in a well equipped pediatric intensive care unit. Conclusions This is the first epidemic report of invasive meningococcal disease from north east India. Although the majority of patients had meningitis, the full range of manifestations were also seen. This study highlights that clinical resistance to commonly used antibiotics such as ceftriaxone can be seen where chloramphenicol is an alternative effective choice. Mortality reduces significantly with early diagnosis and prompt interventions like early shock management, antibiotic therapy and frequent monitoring in an intensive care set up. Although invasive meningococcal infection did not have much impact on the morbidity and mortality of children from this region compared to other parts of the world, it remains one of the major causes of life threatening infections requiring continuous vigilance. Contributions RD conceived the idea of the study and approved the final manuscript and will act as guarantee of the paper; NMD, HB, SGD, PJ and DB were involved in data retrieval, analysis and writing of the paper; ABK and WVL were involved in the laboratory diagnosis and analysis of the microbiological data. Conflict of Interest None. Role of Funding Source None.
Introduction Exogenous lipoid pneumonia (ELP) is a rare condition resulting from aspiration or inhalation of oil-based substances, with both acute and chronic forms. Chronic ELP results from long-term, recurrent inhalation exposure to oil, while acute ELP is secondary to accidental aspiration of a large quantity of lipid material over a short period of time [1, 2]. The majority of patients with acute ELP recover without long-term morbidity. However, in a few instances, it may result in severe inflammatory response, acute respiratory failure, chronic alveolar and interstitial inflammation, and fibrosis, causing residual damage to the lungs [3–5]. The authors retrospectively identified 33 pediatric cases of acute ELP resulting from the accidental inhalation of oily material. The main purpose of this survey was to present clinical and imagenological characteristics of acute ELP, explore its risk factors, and assess the potential role of multiple bronchoalveolar lavages (BALs) and steroid therapy in the treatment of children with acute ELP.
ng from the accidental inhalation of oily material. The main purpose of this survey was to present clinical and imagenological characteristics of acute ELP, explore its risk factors, and assess the potential role of multiple bronchoalveolar lavages (BALs) and steroid therapy in the treatment of children with acute ELP. Material and Methods The study group comprised 33 pediatric patients admitted to the Guangzhou Women and Children’s Medical Center, Guangdong, China, between May 2011 and July 2014, for whom medical records and imagenological data were available. All patients but one had a history of acute ingestion of oil-based substances. All patients satisfied the following diagnostic criteria: clinical presentation of acute respiratory or febrile illness combined with either radiological features diagnostic of lipoid pneumonia, or confirmation of the exogenous origin of the lipid through BAL. This study was conducted in accordance with the declaration of Helsinki. This study was conducted with approval from the Ethics Committee of Guangzhou Women and Children’s Medical Center, Guangzhou Medical University. Written informed consent was obtained from all participants’ guardians.
igin of the lipid through BAL. This study was conducted in accordance with the declaration of Helsinki. This study was conducted with approval from the Ethics Committee of Guangzhou Women and Children’s Medical Center, Guangzhou Medical University. Written informed consent was obtained from all participants’ guardians. A retrospective study was performed on 33 pediatric patients with acute ELP. For each patient, the authors collected demographic data, clinical presentation, imagenological characteristics, categories of oil ingested, laboratory data, treatment, therapy response, BAL findings, and outcomes. Oxygen saturation was measured with digital oximetry. Chest radiography and/or high-resolution computer tomography (CT) were performed in all patients. Diagnostic bronchoscopy was performed immediately after admission. Diagnostic bronchoscopy with BAL was performed once or more in all patients; 24 cases received BAL in combination with regional steroid (regional steroid means that inhaled corticosteroid such as budesonide was injected only into the affected segments or lobes through bronchoscopy in order to alleviate immunologic injury of lungs) therapy. It is instilled by using a syringe attached to the flexible pediatric bronchoscope. Fourteen persistent and severe cases received an empirical course of low-dose systemic steroids, and 11 were given pulmonary function tests. The patients were followed up periodically in the outpatient department. Twelve patients underwent follow-up chest radiographs at a mean interval of 1 mo (range: 5 d – 3 mo). Twenty-one received follow-up CT scans at a mean interval of 3 mo (range: 2 wk – 6 mo).
mic steroids, and 11 were given pulmonary function tests. The patients were followed up periodically in the outpatient department. Twelve patients underwent follow-up chest radiographs at a mean interval of 1 mo (range: 5 d – 3 mo). Twenty-one received follow-up CT scans at a mean interval of 3 mo (range: 2 wk – 6 mo). Results The study group consisted of 23 boys (69.7 %) and 10 girls (30.3 %), with ages ranging from 4 mo to 4 y, as shown in Fig. 1. The male-to-female ratio was 2.3:1. The time elapsed between intake of oil-based substances and admission to the hospital ranged from 2 h to 13 d. The categories of oil inhaled are illustrated in Table 1. Most of the pediatric patients [25 (75.8 %) of 33] came from rural areas, but no seasonal or yearly variation in the frequency of acute ELP was detected. By the time of the admission, most of the patients presented with respiratory distress and other symptoms, including tachypnea (n = 21), cough (n = 25), mild fever (n = 18), progressive dyspnea (n = 12), gasping (n = 8), and pneumorrhagia (n = 5). Two patients were asymptomatic. Fifteen cases received oxygen by nasal catheter or face mask, because their oxygen saturation levels were under 90 %. Twenty-three cases received antibiotics, and six received mechanical ventilation because of complicated acute respiratory distress syndrome (ARDS). The mean time between the onset of symptoms and the diagnostic bronchoscopy was 4.5 d.Fig. 1 Age distribution of 33 children at the onset of acute ELP (mean 23.1 ± 9.5 mo) Table 1 The types of oils inhaled in 33 children with acute ELP
Results The study group consisted of 23 boys (69.7 %) and 10 girls (30.3 %), with ages ranging from 4 mo to 4 y, as shown in Fig. 1. The male-to-female ratio was 2.3:1. The time elapsed between intake of oil-based substances and admission to the hospital ranged from 2 h to 13 d. The categories of oil inhaled are illustrated in Table 1. Most of the pediatric patients [25 (75.8 %) of 33] came from rural areas, but no seasonal or yearly variation in the frequency of acute ELP was detected. By the time of the admission, most of the patients presented with respiratory distress and other symptoms, including tachypnea (n = 21), cough (n = 25), mild fever (n = 18), progressive dyspnea (n = 12), gasping (n = 8), and pneumorrhagia (n = 5). Two patients were asymptomatic. Fifteen cases received oxygen by nasal catheter or face mask, because their oxygen saturation levels were under 90 %. Twenty-three cases received antibiotics, and six received mechanical ventilation because of complicated acute respiratory distress syndrome (ARDS). The mean time between the onset of symptoms and the diagnostic bronchoscopy was 4.5 d.Fig. 1 Age distribution of 33 children at the onset of acute ELP (mean 23.1 ± 9.5 mo) Table 1 The types of oils inhaled in 33 children with acute ELP Category N (number) Balsam 7 White oil 6 Lubricant 4 Kerosene 4 Diesel oil 3 Sewing machine oil 3 Fish-liver oil 3 Paraffine 2 Sesamal oil 1
Results The study group consisted of 23 boys (69.7 %) and 10 girls (30.3 %), with ages ranging from 4 mo to 4 y, as shown in Fig. 1. The male-to-female ratio was 2.3:1. The time elapsed between intake of oil-based substances and admission to the hospital ranged from 2 h to 13 d. The categories of oil inhaled are illustrated in Table 1. Most of the pediatric patients [25 (75.8 %) of 33] came from rural areas, but no seasonal or yearly variation in the frequency of acute ELP was detected. By the time of the admission, most of the patients presented with respiratory distress and other symptoms, including tachypnea (n = 21), cough (n = 25), mild fever (n = 18), progressive dyspnea (n = 12), gasping (n = 8), and pneumorrhagia (n = 5). Two patients were asymptomatic. Fifteen cases received oxygen by nasal catheter or face mask, because their oxygen saturation levels were under 90 %. Twenty-three cases received antibiotics, and six received mechanical ventilation because of complicated acute respiratory distress syndrome (ARDS). The mean time between the onset of symptoms and the diagnostic bronchoscopy was 4.5 d.Fig. 1 Age distribution of 33 children at the onset of acute ELP (mean 23.1 ± 9.5 mo) Table 1 The types of oils inhaled in 33 children with acute ELP Category N (number) Balsam 7 White oil 6 Lubricant 4 Kerosene 4 Diesel oil 3 Sewing machine oil 3 Fish-liver oil 3 Paraffine 2 Sesamal oil 1 The appearance of the bronchoalveolar lavage (BAL) fluid was opalescent with a supernatant halo of fat in all but five cases, for which the BAL fluid was madder red and contained floating fat globules through microscope (Fig. 2). The most common laboratory observations were leukocytosis [25 (75.8 %) of 33], neutrophilia [23 (69.7 %) of 33], and anemia [8 (24.2 %) of 33]. Serum biochemical examination showed elevation in sedimentation rates [24 (72.7 %) of 33], as well as in lactate dehydrogenase [18 (54.5 %) of 33] and C-reactive protein [17 (51.5 %) of 33] levels. Pulmonary function tests showed obstructive ventilatory defect in nine cases. Four patients had a documented infection seen in the BAL culture; the infective agent was Staphylococcus epidermidis in one case and Hemophilus influenzae in three cases. Viral serologic studies revealed the presence of Respiratory syncytial virus in three patients, Adenovirus in 2, Parainfluenza virus in 1, and Mycoplasma pneumoniae in 3.Fig. 2 Floating lipid-laden in the BAL
lture; the infective agent was Staphylococcus epidermidis in one case and Hemophilus influenzae in three cases. Viral serologic studies revealed the presence of Respiratory syncytial virus in three patients, Adenovirus in 2, Parainfluenza virus in 1, and Mycoplasma pneumoniae in 3.Fig. 2 Floating lipid-laden in the BAL All patients showed bilateral pulmonary infiltrates, and segmental or lobar infection distribution, which predominantly involved the lower and middle lobes on chest radiographs. Pulmonary opacities were found in eight cases, and four patients presented a cystic image in the half or the bilateral lower and middle lobes. The most common finding in the initial CT scans was consolidation (Fig. 3). The most common location was the bilateral lower lobes, followed by the right lower lobe, the right middle lobe, the left lower lobe, and the lingular lobe. Two cases involved the whole lung. The other main findings of CT scans were ground-glass opacities and hyperinflation. Pleural effusions were evident on the CT scans in six patients, and cystic images were present in 5 (Fig. 4).Fig. 3 High-resolution CT scan of the chest on the day of admission revealing areas of airspace consolidation in bilateral lower lobes in a 2-y-old child with acute ELP Fig. 4 Lung windows from high-resolution CT scan of the chest on the day of admission revealing many cystic images and consolidation in the right lobe in a 3-y-old child with acute ELP
All patients showed bilateral pulmonary infiltrates, and segmental or lobar infection distribution, which predominantly involved the lower and middle lobes on chest radiographs. Pulmonary opacities were found in eight cases, and four patients presented a cystic image in the half or the bilateral lower and middle lobes. The most common finding in the initial CT scans was consolidation (Fig. 3). The most common location was the bilateral lower lobes, followed by the right lower lobe, the right middle lobe, the left lower lobe, and the lingular lobe. Two cases involved the whole lung. The other main findings of CT scans were ground-glass opacities and hyperinflation. Pleural effusions were evident on the CT scans in six patients, and cystic images were present in 5 (Fig. 4).Fig. 3 High-resolution CT scan of the chest on the day of admission revealing areas of airspace consolidation in bilateral lower lobes in a 2-y-old child with acute ELP Fig. 4 Lung windows from high-resolution CT scan of the chest on the day of admission revealing many cystic images and consolidation in the right lobe in a 3-y-old child with acute ELP All patients were followed up at authors’ clinic within 2 wk to 6 mo after treatment. At follow up, all of the cases showed remission of clinical symptoms such as cough, tachypnea, and oxygen deprivation from 2 wk to 2 mo after onset. None of the patients died. All patients had normal chest image results within 3 mo; 8 of 12 patients had normal results within 1 mo. The CT scans were normal in 11 out of 21 patients by one month after treatment, and 8 out of 21 in 3 mo. Two patients, one of whom had a complicated infection at the restoration stage, showed complete improvement by 6 mo after treatment.
chest image results within 3 mo; 8 of 12 patients had normal results within 1 mo. The CT scans were normal in 11 out of 21 patients by one month after treatment, and 8 out of 21 in 3 mo. Two patients, one of whom had a complicated infection at the restoration stage, showed complete improvement by 6 mo after treatment. Discussion Lipoid pneumonia can be classified into endogenous and exogenous forms; the exogenous form can further be classified into acute and chronic forms. Exogenous lipoid pneumonia (ELP) is often overlooked as a cause of lung disease because of its nonspecific symptoms and radiographic appearance. Because the lesions manifest variable patterns and distribution in radiographic findings, the abnormalities may be misinterpreted as bacterial pneumonia or interstitial lung disease [5–7]. The diagnosis is suggested by the detailed clinical history and is confirmed by the finding of free lipids or lipids in the alveolar cell vacuoles in the bronchoalveolar lavage. The diagnosis of ELP is usually easy when a history of ingestion or inhalation of oily material is available, as in the present cases. Based on the presence of lipid-laden BAL fluid, and the fact that 2 h to 13 d had elapsed since the intake of oil-based substances by the time the patients were admitted, these cases were confirmed as those of acute ELP. Bronchoscopy with BAL is an effective method for establishing the diagnosis of lipoid pneumonia in the absence of any information on ingestion of oily material.
that 2 h to 13 d had elapsed since the intake of oil-based substances by the time the patients were admitted, these cases were confirmed as those of acute ELP. Bronchoscopy with BAL is an effective method for establishing the diagnosis of lipoid pneumonia in the absence of any information on ingestion of oily material. Clinically, patients present with nonspecific symptoms, such as persistent cough, progressive dyspnea, fever, and recurrent infections. Sometimes, aspiration of oily material remains unnoticed because it does not induce a normal protective cough reflex; this can lead to severe, even fatal cases. Possible complications include bacterial infection, progressive fibrosis, bronchiectasis, hemoptysis, and in severe cases, respiratory failure or death [2, 4, 8]. In the index study, the majority of patients with acute ELP showed symptoms and forewarning signs similar to the findings of other reports [1, 8–10]. Secondary bacterial infection is common in acute ELP, but infection was detected in only four patients in the BAL culture, even though most patients presented with fever, leukocytosis, neutrophilia, and elevation of C-reactive protein levels in the serum. Further researches are necessary to explore the reason why detection rate of BAL culture is so low. It is worth mentioning that ARDS was serious and very high-frequency complications of acute ELP in the index group compared to other reports [1, 7]. Pneumorrhagia, which was present in five of the present patients, is not a common phenomenon among adult patients. It can be explained by the fact that oil-based substances erode and injure the tender and soft mucosal lining of bronchi of infants more easily than that of adults and exacerbated by induced inflammatory cytokine storm; consequently, infants comprise the majority of the patient population. Two of the pneumorrhagia cases had inhaled fish-liver oil. Fish-liver oil is sold without a prescription, and no information is provided to the consumers or clinicians on the possible negative effects or hazards of using such products.
tokine storm; consequently, infants comprise the majority of the patient population. Two of the pneumorrhagia cases had inhaled fish-liver oil. Fish-liver oil is sold without a prescription, and no information is provided to the consumers or clinicians on the possible negative effects or hazards of using such products. There are many factors that increase the risk of aspiration of oily substances in early childhood and the common underlying conditions are as follows: impairment or developmental delays in neurologic or neuromuscular control of the processes of breathing and/or swallowing; gastroesophageal reflux; cleft palate; nasal instillation; and forced oral administration in a supine position [11, 12]. However, none of the index patients had any of these physiological predisposing factors. It is critical to prevent accidental ingestion of oils because most of the patients were infants whose swallowing function was not fully developed. Their parents had put oil-based substances within their reach, leading to accidental aspiration. There are many oil-based substances that cause acute ELP, such as vegetable oil (olive), animal oil (milk and cod-liver oil), and mineral oil. Host tissue reactions to the inhaled substances differ according to the chemical characteristics of the substance. In the present group, aspiration of balsam and white oil were the most common causes of ELP. In authors’ region, balsam (vegetable oil) is burnt as an incense in religious ceremonies. Balsam oil may impair mucociliary transport. Following balsam ingestion, the initial response in the alveoli is the phagocytosis of emulsified oil by alveolar macrophages. These lipid-laden macrophages are activated to release pro-inflammatory cytokines to elicit foreign body reactions associated with the infiltration of lymphocytes and plasma cells into the alveolar septum. Parents thus need to be aware of the risks, and discourage the uncontrolled use of balsam, especially in places where they can be accessed by the very young and the elderly. Preventive measures to avoid accidental inhalation of oils by children, and parental education about indiscriminate use of oily materials are necessary.
s thus need to be aware of the risks, and discourage the uncontrolled use of balsam, especially in places where they can be accessed by the very young and the elderly. Preventive measures to avoid accidental inhalation of oils by children, and parental education about indiscriminate use of oily materials are necessary. Radiographic images of lipoid pneumonia show basal or diffuse opacities, together with bilateral pulmonary infiltrates. The most frequent CT findings are airspace consolidations, ground-glass opacities, the crazy paving pattern, and interlobular septal thickening [12–15]. A review of literature revealed that the consolidations were significantly more frequent in children, while the crazy paving pattern was more commonly seen in adults [15]. None of these is specific radiological feature of ELP. All of the index patients showed bilateral pulmonary infiltrates, and high-resolution CT revealed bilateral and extensive alveolar consolidations in most of the cases. Only two of the patients’ CT scans revealed areas of ground-glass attenuation, and none revealed the paving pattern. These findings are consistent with those reported previously.
showed bilateral pulmonary infiltrates, and high-resolution CT revealed bilateral and extensive alveolar consolidations in most of the cases. Only two of the patients’ CT scans revealed areas of ground-glass attenuation, and none revealed the paving pattern. These findings are consistent with those reported previously. Several modalities of treatment have been tried to prevent or halt the progress of damage in lipoid pneumonia, but there is no consensus regarding the correct treatment. Steroid therapy is one modality that has been used by several clinicians; some authors also suggest that removal of intrapulmonary fat using BAL may alleviate symptoms related to severe lipoid pneumonia [16–20]. In the present cases, authors used systemic steroid therapy as one of the treatment modalities for persistent and severe acute ELP, as it may prevent damage of alveolar and capillary endothelium, decrease the inflammatory response and ongoing fibrosis. Bronchoscopy with BAL is a successful strategy recommended for the diagnosis of lipoid pneumonia because of the presence of floating lipid-laden macrophages in the BAL. Besides their diagnostic value, multiple BALs have therapeutic implications for children with ELP. The index cases showed clinical improvement after 1 to 5 wk of therapy, and showed almost complete radiological clearance within 3 mo. It suggests that multiple BALs are an efficient method for removing intra-alveolar mineral oil and offer considerable improvement in clinical, radiological, and laboratory parameters. Pulmonary function tests showed obstructive ventilatory defect in nine cases; due to the young age of most of the index patients, this test could not be performed in most cases, as abnormal lung function tests may require several months of recovery [12]. Further, the follow-up investigation ignored post-treatment lung function, and thus no conclusions can be drawn regarding that aspect of recovery. Further studies are required to confirm the duration of abnormal lung function in children treated for acute ELP. Limitation of this report is that authors did not carry out a comparison of clinical, radiological data and follow-up data between the patients in whom lavage and steroids were used and those in whom they were not used. This is because authors used systemic steroid therapy as one of the treatment modalities just for persistent and severe acute ELP.
hat authors did not carry out a comparison of clinical, radiological data and follow-up data between the patients in whom lavage and steroids were used and those in whom they were not used. This is because authors used systemic steroid therapy as one of the treatment modalities just for persistent and severe acute ELP. The natural history and outcome of ELP are variable, and depend on the type, volume, distribution, duration of the oil aspirated and a delay in BAL procedure. Mortality has been reported to be as high as 13–50 % by other researchers [2, 14], but in the index series, none of the patients died and had chronic respiratory problems. With treatment, majority of the patients with acute ELP showed clinical and radiographic improvement, similar to the usual course of pneumonia. The explanation possible could be young age of the cases and that they received timely diagnosis and appropriate administration. In conclusion, acute ELP as a result of aspiration of oily material still occurs in pediatric population. It can mimic other diffuse lung diseases because of its nonspecific clinical presentation and radiographic signs. The index study demonstrates that multiple BALs combined with steroid therapy result in significant improvement of clinical, radiologic and laboratory parameters in children with acute ELP. Systemic steroid therapy can be tried as one of the modalities, and is useful as a treatment for persistent and severe acute ELP. In addition, traditional habits (such as the use of oil for folk remedies or religious ceremonies) may predispose children to ELP, even in the absence of other risk factors. Pneumorrhagia and ARDS may represent the main complications of acute ELP in children.
s useful as a treatment for persistent and severe acute ELP. In addition, traditional habits (such as the use of oil for folk remedies or religious ceremonies) may predispose children to ELP, even in the absence of other risk factors. Pneumorrhagia and ARDS may represent the main complications of acute ELP in children. Contributions GL: Wrote the article, bronchoscopy operation and will act as guarantor for the paper; YX, JY and PW: Collection of case data in department of respiration; LH: Collection of case data in pediatric intensive care unit (PICU); ZT: Bronchoscopy operation; ZX: Bronchoscopy operation and modification of the article. Compliance with Ethical Standards Conflict of Interest None. Source of Funding None.
Introduction On 11 May 2009, the first Indian case of H1N1 was confirmed. Subsequently, one of India’s largest documented H1N1 outbreaks occurred in Pune, with the first pediatric case reported in July 2009. Subsequently, Sassoon General Hospital (SGH), Pune established a separate isolation ward and ICU for suspected H1N1 patients. To date, data on the current pandemic suggests that children under 18 y of age represent almost half of all 2009 H1N1 influenza cases, with many having at least one underlying medical condition, particularly asthma [1–4]. In published reports, the majority of hospitalized children received antivirals; however, they appear to have significant mortality [5]. A recent publication reported that factors independently associated with in-hospital mortality in adults and children were, requirement for invasive ventilation at intensive care unit (ICU) admission, older age and presence of any co-existing conditions [6]. Understanding the factors associated with increase morbidity and mortality among Indian children with H1N1 could identify opportunities to prevent deaths due to present and future influenza pandemics in India. Therefore, the authors analyzed the factors associated with mortality, among children admitted to the largest public hospital in Pune, during the H1N1 pandemic.
morbidity and mortality among Indian children with H1N1 could identify opportunities to prevent deaths due to present and future influenza pandemics in India. Therefore, the authors analyzed the factors associated with mortality, among children admitted to the largest public hospital in Pune, during the H1N1 pandemic. Material and Methods Sassoon General Hospitals (SGH)-Byramjee Jeejeebhoy Medical College (BJMC) is a large Maharashtra Government tertiary care public and teaching hospital, which serves Pune city (city with population of approximately 4 million) and surrounding peri-urban and rural areas. Available hospital records were retrospectively reviewed for children with PCR-confirmed 2009 H1N1 infection, who were less than 12 y of age on admission to SGH and were admitted between 7 August 2009 and 31 January 2010 to the pediatric swine flu isolation ICU and ward. Children were admitted to ICU if they had severe respiratory distress or hemodynamic instability requiring continuous monitoring and ICU care. Pathological specimens from children who died were reviewed for histopathological changes and secondary bacterial infections by gram staining. Clinical and demographic data were extracted from available hospital records, using a standardized case report form (CRF). The CRF’s were quality assured for completeness and accuracy and were entered via single data entry in a MS Access database.
Material and Methods Sassoon General Hospitals (SGH)-Byramjee Jeejeebhoy Medical College (BJMC) is a large Maharashtra Government tertiary care public and teaching hospital, which serves Pune city (city with population of approximately 4 million) and surrounding peri-urban and rural areas. Available hospital records were retrospectively reviewed for children with PCR-confirmed 2009 H1N1 infection, who were less than 12 y of age on admission to SGH and were admitted between 7 August 2009 and 31 January 2010 to the pediatric swine flu isolation ICU and ward. Children were admitted to ICU if they had severe respiratory distress or hemodynamic instability requiring continuous monitoring and ICU care. Pathological specimens from children who died were reviewed for histopathological changes and secondary bacterial infections by gram staining. Clinical and demographic data were extracted from available hospital records, using a standardized case report form (CRF). The CRF’s were quality assured for completeness and accuracy and were entered via single data entry in a MS Access database. The following data were collected: demographic characteristics like age, gender and location of residence; clinical characteristics on admission including duration of symptoms, co-morbid illnesses; clinical findings at presentation; and hospital course including use of antibiotics, corticosteroids and antiviral drugs, requirement of bubble continuous positive airway pressure (CPAP)or mechanical ventilation, presence of co-infections, laboratory and radiologic findings. The primary outcome of the study was in-hospital mortality. Necropsy data were available and included in the analysis for all children who died. Tissue sections of lung and liver were formalin fixed, paraffin embedded and hematoxylin and eosin stained. Gram staining of lung tissue blocks was also performed on all lung necropsy specimens. No personal patient identifiers were extracted on the CRF’s.
vailable and included in the analysis for all children who died. Tissue sections of lung and liver were formalin fixed, paraffin embedded and hematoxylin and eosin stained. Gram staining of lung tissue blocks was also performed on all lung necropsy specimens. No personal patient identifiers were extracted on the CRF’s. All children admitted with ILI, underwent nasopharyngeal (NP) aspirate or swab specimen collection for the presence of H1N1 specific viral nucleic acid on the day of hospitalization. Influenza-like illness was defined by the documentation of fever (temperature >100°F), and/or cough or sore throat, with any of the following symptoms: myalgia or arthralgia, respiratory distress, or vomiting or diarrhea. Patient specimens were analyzed at the National Institute of Virology (NIV), a World Health organization (WHO)-certified national reference virology laboratory in Pune, India within 24 h of collection. Reverse-transcriptase PCR assay was performed according to the protocol recommended by the U.S. Centers for Disease Control and Prevention (CDC) [7]. For the purposes of this analysis, a child was defined as infected with 2009 H1N1 influenza based on laboratory confirmation of the presence of H1N1 specific viral nucleic acid in nasopharyngeal specimen collected on hospitalization. The study was reviewed and approved by the ethics committee of SGH and the institutional review board (IRB) of the Johns Hopkins University School of Medicine.
Patient specimens were analyzed at the National Institute of Virology (NIV), a World Health organization (WHO)-certified national reference virology laboratory in Pune, India within 24 h of collection. Reverse-transcriptase PCR assay was performed according to the protocol recommended by the U.S. Centers for Disease Control and Prevention (CDC) [7]. For the purposes of this analysis, a child was defined as infected with 2009 H1N1 influenza based on laboratory confirmation of the presence of H1N1 specific viral nucleic acid in nasopharyngeal specimen collected on hospitalization. The study was reviewed and approved by the ethics committee of SGH and the institutional review board (IRB) of the Johns Hopkins University School of Medicine. Data Analysis An epidemic curve of children presenting to the hospital with ILI, and among those with PCR confirmed 2009 H1N1was created. Demographic and clinical characteristics, on admission and in hospital, were summarized as a whole and also stratified by age categories less than 1 y, 1–5 y and more than 5 y. Categorical variables were summarized using frequencies, and non-normal continuous variables using medians and IQR. Categorical and continuous data across age categories were compared at 5% level of significance, using a Fisher’s exact test and nonparametric analysis of variance (Kruskal-Wallis test) respectively. The primary outcome of the study was mortality defined as in hospital death. Logistic regression was used to identify risk factors for mortality. All analysis was done using STATA software version 9.1.
f significance, using a Fisher’s exact test and nonparametric analysis of variance (Kruskal-Wallis test) respectively. The primary outcome of the study was mortality defined as in hospital death. Logistic regression was used to identify risk factors for mortality. All analysis was done using STATA software version 9.1. Results Between 7 August 2009 and 31 January 2010, a total of 1219 patients with ILI were admitted to the H1N1 ward and ICU, of which 775 (64%) were children <12 y old. Ninety-two children (12%) had PCR-confirmed 2009 H1N1 influenza infection. Epidemic curve shown in Fig. 1, suggests an initial peak in late August and September (wk 4–8). Subsequently, there was a waxing and waning in the number of cases followed by another mild increase in the number of H1N1cases beginning in November 2009 and continuing through January 2010.Fig. 1 Children with Influenza-like Illness (ILI) <12 y of age admitted to SGH and among those who were PCR confirmed H1N1 infected: August 2009–January 2010
xing and waning in the number of cases followed by another mild increase in the number of H1N1cases beginning in November 2009 and continuing through January 2010.Fig. 1 Children with Influenza-like Illness (ILI) <12 y of age admitted to SGH and among those who were PCR confirmed H1N1 infected: August 2009–January 2010 Among the 92 H1N1-confirmed cases, 43 (47%) were males and the median age was 2.5 y (IQR 1.3–6), with 16 (17%) cases less than 1 y of age. Thirteen (14%) cases had a confirmed H1N1 positive contact. Table 1 shows the demographic and clinical characteristics including signs and symptoms on admission and in-hospital, stratified by age. An underlying co-morbid condition was noted in 13(14%) of H1N1 cases: congenital heart disease (n = 6), asthma (n = 4), diaphragmatic hernia (n = 1), seizure disorder (n = 1) and gastroesphageal reflux disease (n = 1). Co-infections were noted in 13 (14%) of H1N1 cases: HIV (n = 4), dengue (n = 4), tuberculosis (n = 2), malaria (n = 2) and typhoid (n = 1). Nutritional assessment at admission revealed that 96% of the H1N1 cases had adequate nutrition and 4% had moderate acute malnutrition as per 2006 WHO growth standards [8].Table 1 Demographic and clinical characteristics of hospitalized children, less than 12 y of age, with PCR-confirmed 2009 H1N1 influenza infection in Pune, India Characteristics Overall Age P <1 Y 1–5 Y ≥5 Y N = 92 N = 16 N = 43 N = 33 Male Gender 43 (47%) 11 (69%) 21 (49%) 11 (33%) 0.06
Among the 92 H1N1-confirmed cases, 43 (47%) were males and the median age was 2.5 y (IQR 1.3–6), with 16 (17%) cases less than 1 y of age. Thirteen (14%) cases had a confirmed H1N1 positive contact. Table 1 shows the demographic and clinical characteristics including signs and symptoms on admission and in-hospital, stratified by age. An underlying co-morbid condition was noted in 13(14%) of H1N1 cases: congenital heart disease (n = 6), asthma (n = 4), diaphragmatic hernia (n = 1), seizure disorder (n = 1) and gastroesphageal reflux disease (n = 1). Co-infections were noted in 13 (14%) of H1N1 cases: HIV (n = 4), dengue (n = 4), tuberculosis (n = 2), malaria (n = 2) and typhoid (n = 1). Nutritional assessment at admission revealed that 96% of the H1N1 cases had adequate nutrition and 4% had moderate acute malnutrition as per 2006 WHO growth standards [8].Table 1 Demographic and clinical characteristics of hospitalized children, less than 12 y of age, with PCR-confirmed 2009 H1N1 influenza infection in Pune, India Characteristics Overall Age P <1 Y 1–5 Y ≥5 Y N = 92 N = 16 N = 43 N = 33 Male Gender 43 (47%) 11 (69%) 21 (49%) 11 (33%) 0.06 Underlying Co-morbidity 13 (14%) 2(6%) 7 (16%) 4 (18%) 0.59 Asthma 4 (4%) 0 2 (5%) 2 (6%) 0.62 Congenital Heart Disease 6 (7%) 1 (6%) 3 (7%) 2 (6%) 0.99 Diaphragmatic hernia 1 0 1 (2%) 0 >0.95 Seizure disorder 1 0 1 (2%) 0 >0.95 GERD 1 1 (6%) 0 0 0.16 Clinical Symptoms and Signs on Admission
Male Gender 43 (47%) 11 (69%) 21 (49%) 11 (33%) 0.06 Underlying Co-morbidity 13 (14%) 2(6%) 7 (16%) 4 (18%) 0.59 Asthma 4 (4%) 0 2 (5%) 2 (6%) 0.62 Congenital Heart Disease 6 (7%) 1 (6%) 3 (7%) 2 (6%) 0.99 Diaphragmatic hernia 1 0 1 (2%) 0 >0.95 Seizure disorder 1 0 1 (2%) 0 >0.95 GERD 1 1 (6%) 0 0 0.16 Clinical Symptoms and Signs on Admission Duration of any symptoms Median (IQR) days 4 (3–7) 5 (2.5–7.5) 4 (3–7) 5 (3–7) 0.70 Fever 88 (96%) 13 (81%) 43 (100%) 32 (97%) 0.006 Cough 88 (96%) 14 (88%) 42 (97%) 32 (97%) 0.21 Shortness of breath 44 (48%) 5 (31%) 23 (53%) 16 (48%) 0.31 Rhinorrhea 21 (23%) 4 (25%) 10 (23%) 7 (21%) 0.95 Sore throat 15 (16%) 1 (6%) 5 (12%) 9 (27%) 0.09 Diarrhea 8 (9%) 2 (13%) 3 (7%) 3 (9%) 0.80 Nausea/Vomiting 7 (8%) 1 (6%) 2 (5%) 4 (12%) 0.47 Laboratory Abnormalities Anemia 42 (46%) 5 (31%) 29 (67%) 8 (24%) <0.001 Thrombocytopenia 31 (34%) 4 (25%) 16 (37%) 11 (33%) 0.68 Leucopenia 22 (24%) 1 (6%) 10 (23%) 11 (33%) 0.11 Abnormality on Chest X-ray 0.16 Diffuse alveolar infiltrate 12 (13%) 2 (13%) 2 (5%) 8 (24%) Multi-lobar infiltrate 60 (65%) 11 (69%) 31 (72%) 18 (55%) Uni-lobar Infiltrate 20 (22%) 3 (19%) 10 (23%) 7 (21%) In Hospital Course Antiviral within 48 h 14 (15%) 4 (25%) 4 (9%) 6 (18%) 0.28 Corticosteroid Use 21 (23%) 3 (19%) 10 (23%) 8 (24%) 0.91 Secondary Bacterial Infection 15 (16%) 2 (13%) 8 (19%) 5 (15%) 0.87
Anemia 42 (46%) 5 (31%) 29 (67%) 8 (24%) <0.001 Thrombocytopenia 31 (34%) 4 (25%) 16 (37%) 11 (33%) 0.68 Leucopenia 22 (24%) 1 (6%) 10 (23%) 11 (33%) 0.11 Abnormality on Chest X-ray 0.16 Diffuse alveolar infiltrate 12 (13%) 2 (13%) 2 (5%) 8 (24%) Multi-lobar infiltrate 60 (65%) 11 (69%) 31 (72%) 18 (55%) Uni-lobar Infiltrate 20 (22%) 3 (19%) 10 (23%) 7 (21%) In Hospital Course Antiviral within 48 h 14 (15%) 4 (25%) 4 (9%) 6 (18%) 0.28 Corticosteroid Use 21 (23%) 3 (19%) 10 (23%) 8 (24%) 0.91 Secondary Bacterial Infection 15 (16%) 2 (13%) 8 (19%) 5 (15%) 0.87 Co-infections 13 (14%) 1 (6%) 7 (16%) 5 (15%) 0.67 HIV 4 (4%) 0 2 (5%) 2 (6%) 0.95 Malaria 2 (2%) 0 2 (5%) 0 0.66 Dengue 4 (4%) 1 (6%) 1 (2%) 2 (6%) 0.51 Typhoid Fever 1 (1%) 0 1 (2%) 0 >0.95 Tuberculosis 2 (2%) 0 1 (2%) 1 (3%) >0.95 Complications other than death Empyema 5 (5%) 0 5 (12%) 0 0.09 ARDS/ALI 17 (18%) 3 (19%) 4 (9%) 10 (30%) 0.07 Encephalitis 4 (4%) 0 1 (2%) 3 (9%) 0.38 Renal Failurea 2 (2%) 0 1 (2%) 1 (3%) 0.79 Congestive heart failure 6 (7%) 1 (6%) 2 (5%) 3 (9%) 0.85 ICU Admission 88 (96%) 16 (100%) 42 (98%) 30 (91%) 0.23 Required Ventilation 36 (39%) 8 (50%) 18 (42%) 10 (30%) 0.35 Mechanical Ventilation 20 (56%) 3 (38%) 7 (39%) 10 (100%) 0.002 Bubble CPAP 16 (44%) 5 (62%) 11 (61%) 0 0.001 Death 15 (16%) 1 (6%) 4 (9%) 10 (30%) 0.02
ive heart failure 6 (7%) 1 (6%) 2 (5%) 3 (9%) 0.85 ICU Admission 88 (96%) 16 (100%) 42 (98%) 30 (91%) 0.23 Required Ventilation 36 (39%) 8 (50%) 18 (42%) 10 (30%) 0.35 Mechanical Ventilation 20 (56%) 3 (38%) 7 (39%) 10 (100%) 0.002 Bubble CPAP 16 (44%) 5 (62%) 11 (61%) 0 0.001 Death 15 (16%) 1 (6%) 4 (9%) 10 (30%) 0.02 ICU Intensive care unit; Anemia Hb less than 10 mg/dl; Thrombocytopenia Platelets less than 105/dl; Leucopenia White blood cells less than 4,000/dl; GERD Gastro-esophageal reflux disease; ARDS/ALI Acute respiratory distress syndrome/Acute lung injury defined as diffuse alveolar infiltrate along with PaO2/FiO2 ratio less than 200 and 300 respectively. aDefined as 50% increase from baseline creatinine. All H1N1 cases received the antiviral drug oseltamivir on admission at the dosage recommended by the CDC [9]. The median time from illness onset to initiation of oseltamivir was 3 d and 14 (15%) children received oseltamivir within 48 h of symptom onset. Two (2%) had received oseltamivir prior to admission. On admission, all children who were subsequently confirmed to have H1N1 were also empirically started on broad spectrum antibiotics (3rd generation cephalosporin), and 13 (14%) received vancomycin, although all children had received antibiotics prior to admission by an outside provider.
oseltamivir prior to admission. On admission, all children who were subsequently confirmed to have H1N1 were also empirically started on broad spectrum antibiotics (3rd generation cephalosporin), and 13 (14%) received vancomycin, although all children had received antibiotics prior to admission by an outside provider. Bacterial co-infections isolated from blood cultures and/or endotracheal aspirates were identified in 15 (16%) children; gram-negative infections included Acinetobacter baumanii (n = 4), Pseudomonas aeruginosa (n = 3), Citrobacter freundii (n = 1) and Escherichia coli (n = 1), and gram positive infections included coagulase-negative Staphylococci spp. (n = 3) and methicillin resistant Staphylococcus aureus (n = 3). The most common clinical complications observed were acute respiratory distress syndrome (ARDS) (n = 17, 18%), empyema (n = 5, 5%), and encephalitis (n = 4, 4%). Eighty-eight (96%) H1N1 cases required ICU care. All received oxygen therapy on admission. Thirty six (39%) required ventilatory support on admission; 16 (44%) received non invasive ventilation (nasal bubble CPAP) and 20 (56%) received mechanical ventilation. Among ICU admitted cases, the median time from symptoms onset to initiation of oseltamivir was 2 d (range, 0–3 d). A short course of corticosteroids was administered to 21 (24%) children.
y support on admission; 16 (44%) received non invasive ventilation (nasal bubble CPAP) and 20 (56%) received mechanical ventilation. Among ICU admitted cases, the median time from symptoms onset to initiation of oseltamivir was 2 d (range, 0–3 d). A short course of corticosteroids was administered to 21 (24%) children. Among 88 ICU-admitted cases, 15 (16%) died, of which 7 (47%) died within the first 48 h of hospital admission. All children (n = 16) who received non-invasive ventilation (bubble CPAP) survived. The median age of children who died was 6 y (IQR, 2–6.4 y) and the median time from onset of symptoms to death was 8 d (IQR, 5–11 d). The median duration of hospital stay among those who died was 1 d (IQR, 1–4 d). Among those who survived and were on mechanical ventilation, the median duration of hospital stay was significantly higher than those who died (11 d vs. 1 d, p 0.02). The duration of symptoms before admission was significantly lower in those who survived on assisted ventilation compared to those who died (median 3 d vs. 6 d, 95% CI :0.49–32.4; p 0.06).
on mechanical ventilation, the median duration of hospital stay was significantly higher than those who died (11 d vs. 1 d, p 0.02). The duration of symptoms before admission was significantly lower in those who survived on assisted ventilation compared to those who died (median 3 d vs. 6 d, 95% CI :0.49–32.4; p 0.06). Mortality was associated with SpO2 <80% at admission (OR 32.8, 95%CI: 5.8–185.5; p < 0.001); presence of diffuse alveolar infiltrate (DAI) on admission (OR 45, 95%CI:5.4–370.0; p < 0.001) and presence of ARDS on admission (OR 345, 95%CI: 33.5–3564; p < 0.001) (Table 2). There was a strong trend with late presentation to hospital (admission to the hospital ≥72 h of symptom onset) being associated with 4-fold increased odds of mortality; however this was not statistically significant (p = 0.06).However, late presentation to the hospital combined with need for mechanical ventilation on admission was associated with statistically significant increased risk of mortality (OR 494, 95%CI: 41.7–5848.9; p < 0.001).Lastly, there was also a strong trend with the presence of co-morbid condition being associated with an almost 5-fold increased odds of mortality (OR, 4.56, 95%CI: 0.91–23; p = 0.07).Table 2 Univariate analysis by logistic regression evaluating the risk factors for mortality Characteristic Died N = 15 (%) Survived N = 77 (%) Odds Ratio 95% CI P
Mortality was associated with SpO2 <80% at admission (OR 32.8, 95%CI: 5.8–185.5; p < 0.001); presence of diffuse alveolar infiltrate (DAI) on admission (OR 45, 95%CI:5.4–370.0; p < 0.001) and presence of ARDS on admission (OR 345, 95%CI: 33.5–3564; p < 0.001) (Table 2). There was a strong trend with late presentation to hospital (admission to the hospital ≥72 h of symptom onset) being associated with 4-fold increased odds of mortality; however this was not statistically significant (p = 0.06).However, late presentation to the hospital combined with need for mechanical ventilation on admission was associated with statistically significant increased risk of mortality (OR 494, 95%CI: 41.7–5848.9; p < 0.001).Lastly, there was also a strong trend with the presence of co-morbid condition being associated with an almost 5-fold increased odds of mortality (OR, 4.56, 95%CI: 0.91–23; p = 0.07).Table 2 Univariate analysis by logistic regression evaluating the risk factors for mortality Characteristic Died N = 15 (%) Survived N = 77 (%) Odds Ratio 95% CI P Age <1 y 1 (7) 15 (19) Referent – – 1–5 y 4 (27) 39 (51) 1.54 (0.16, 14.90) 0.71 ≥5 y 10 (67) 23 (30) 6.52 (0.76, 56.33) 0.09 Male Gender 7 (47) 36 (47) 0.99 (0.33, 3.02) 0.995 Hindu Religion 14 (93) 60 (78) 3.97 (0.49, 32.4) 0.20 Duration of Symptoms <72 h 2 (13) 31 (40) Referent – – ≥72 h 13 (87) 46 (60) 4.38 (0.92, 20.78) 0.06 Co-morbidity 4 (27) 9 (12) 2.28 (0.81, 6.45) 0.13 Asthma 1 (7) 3 (4) 1.76 (0.17, 18.2) 0.63 Co-infections 1 (7) 12 (16) 0.43 (0.06, 3.05) 0.36 O2 Saturation <80% 7 (47) 2 (3) 32.8 (5.8, 185.5) <0.001 Admission CXR Findings Diffuse Alveolar Infiltrate 10 (67) 2 (3) 45 (5.4, 370) <0.001 Multilobar 3 (20) 57 (74) 0.47 (0.07,3.06) 0.43 Unilobar 2 (13) 18 (23) Referent – – Corticosteroid Treatment in Ventilated Children 9 (60) 12 (16) 8.12 (2.44, 27.05) 0.001 Antiviral Treatment <48 h of symptom onset 1 (7) 13 (17) 0.35 (0.04, 2.9) 0.33 ARDS/ALI 14 (93) 3 (4) 345.3 (33.5, 3564.1) <0.001 Bacterial Infection 5 (33) 10 (13) 3.4 (0.95, 11.8) 0.06
06) 0.43 Unilobar 2 (13) 18 (23) Referent – – Corticosteroid Treatment in Ventilated Children 9 (60) 12 (16) 8.12 (2.44, 27.05) 0.001 Antiviral Treatment <48 h of symptom onset 1 (7) 13 (17) 0.35 (0.04, 2.9) 0.33 ARDS/ALI 14 (93) 3 (4) 345.3 (33.5, 3564.1) <0.001 Bacterial Infection 5 (33) 10 (13) 3.4 (0.95, 11.8) 0.06 ‡ p-values are based on logistic regression. DAI Diffuse alveolar infiltrate; ARDS/ALI Acute respiratory distress syndrome/acute lung injury, defined as diffuse alveolar infiltrate along with PaO2/FiO2 ratio less than 200 and 300 respectively. Fourteen (15%) children admitted to ICU received oseltamivir within 48 h of symptom onset and survived while one of the children who died, received oseltamivir within 48 h of symptom onset. Pneumonia on admission was seen in all the children and was associated with higher mortality if presented with diffuse alveolar infiltrate. Secondary bacterial infections particularly, nosocomial infection was associated with higher mortality; however this was not statistically significant (OR 3.4, 95% CI: 0.95–11.8; p = 0.06).
on admission was seen in all the children and was associated with higher mortality if presented with diffuse alveolar infiltrate. Secondary bacterial infections particularly, nosocomial infection was associated with higher mortality; however this was not statistically significant (OR 3.4, 95% CI: 0.95–11.8; p = 0.06). Necropsy performed on all 15 children who died showed ARDS pattern (n = 9) (Fig. 2a), necrotizing pneumonitis (n = 4), diffuse hemorrhage (n = 4) and interstitial pneumonia (n = 4) consistent with severe viral and/or bacterial infection (Table 3). A polymorphonuclear infiltrate was seen in 9 cases (Fig. 2b), suggestive of a secondary bacterial infection. Further gram staining of lung tissue blocks showed presence of gram positive infection in 8 (53%) patients. Liver necropsy revealed varied pathology ranging from fatty changes to sub massive necrosis (data not shown).Fig. 2 a. Well formed hyaline membrane with some partially atelectatic alveoli with sparse infiltrate of macrophages. b. Alveoli filled with dense exudate of polymorphs with scanty mononuclear cell, fibrin deposition, intra alveolar hemorrhage, necrosis of alveolar wall with micro abscess formation and marked congestion of alveolar capillaries Table 3 Characteristics, including lung necropsy results of 15 children infected with 2009 H1N1 influenza who died
Necropsy performed on all 15 children who died showed ARDS pattern (n = 9) (Fig. 2a), necrotizing pneumonitis (n = 4), diffuse hemorrhage (n = 4) and interstitial pneumonia (n = 4) consistent with severe viral and/or bacterial infection (Table 3). A polymorphonuclear infiltrate was seen in 9 cases (Fig. 2b), suggestive of a secondary bacterial infection. Further gram staining of lung tissue blocks showed presence of gram positive infection in 8 (53%) patients. Liver necropsy revealed varied pathology ranging from fatty changes to sub massive necrosis (data not shown).Fig. 2 a. Well formed hyaline membrane with some partially atelectatic alveoli with sparse infiltrate of macrophages. b. Alveoli filled with dense exudate of polymorphs with scanty mononuclear cell, fibrin deposition, intra alveolar hemorrhage, necrosis of alveolar wall with micro abscess formation and marked congestion of alveolar capillaries Table 3 Characteristics, including lung necropsy results of 15 children infected with 2009 H1N1 influenza who died Age Sex Co-morbidity Duration of Symptoms before Hospitalization Duration of Hospitalization Lung Necropsy Gram Stain Findings Lung Necropsy Pathology Findings 1 3 y F Asthma 3 d 1 d Gram positive cocci in clusters Necrotizing pneumonitis with micro abscess formation, PMN infiltrates, and hyaline membrane formation 2 7 y F None 6 d 3 d No organisms seen Hyaline membrane formation 3 9 mo M None 8 d 4 d No organisms seen Necrotizing pneumonitis with PMN infiltrates 4 15 mo F None 6 d 1 h Gram positive cocci in clusters Acute hemorrhagic pneumonitis, and PMN infiltrates 5 5 y F None 4 d 2 d Gram positive cocci in chains Acute hemorrhagic pneumonitis with hyaline membrane, and PMN infiltrates 6 6 y M Congenital heart disease 7 d 2 d No organisms seen Pulmonary hemorrhage with ARDS 7 6 y M None 8 d 1 d Gram positive cocci in clusters Interstitial pneumonia, hyaline membrane,and PMN infiltrates 8 2 y F None 5 d 1 d No organisms seen Necrotizing pneumonia, hyaline membrane,and PMN infiltrates 9 5 y F None 4 d 22 h Gram positive cocci in clusters Alveoli filled with PMN and fibrin, necrotizing pneumonia, hyaline membrane and alveolar lining necrosis. 10 6.5 y M Epilepsy 8 d 11 h No organisms seen Focal intra-alveolar hemorrhage, mononuclear cell infiltrates, hyaline membrane and interstitial pneumonia. 11 6.5 y M None 2 d 13 d Gram positive cocci in chains Mononuclear cell infiltrate, thick alveolar wall with hyaline membrane and early diffuse alveolar damage with patchy pneumonitis. 12 6 y M None 6 d 7 d No organisms seen Interstitial mononuclear infiltrate, alveoli filled with neutrophils and few macrophages and evidence of viral pneumonitis. 13 11 y M Interstitial Lung Disease 4 d 7 d Gram positive cocci in chains Diffuse alveolar damage, alveoli with anthracotic pigment, bronchiolar wall necrosis and focal PMN infiltration in interstitium. 14 1.5 y F None 4 d 1 d Gram positive cocci in clusters Interstitial pneumonitis with mononuclear cell infiltrate and interstitial pneumonitis. 15 8 y F Thalassemia Major, Splenectomy 4 d 1 d No organisms seen Mononuclear infiltrate, diffuse alveolar damage with thick hyaline membrane and interstitial septate fibrosis.
14 1.5 y F None 4 d 1 d Gram positive cocci in clusters Interstitial pneumonitis with mononuclear cell infiltrate and interstitial pneumonitis. 15 8 y F Thalassemia Major, Splenectomy 4 d 1 d No organisms seen Mononuclear infiltrate, diffuse alveolar damage with thick hyaline membrane and interstitial septate fibrosis. PMN polymorphonuclear cells Discussion Since the beginning of the present pandemic in Pune, India, until 31st January 2010;686 adult and 932 pediatric patients with influenza-like illness were screened at various screening centers (unpublished report from NIV, Pune, India) and 12,668 (2%) underwent nasopharyngeal swab testing. Of these, 2487 (20%) were confirmed to have 2009 H1N1 infection and 714 (28.7%) were in the 0–12 y age group. The authors evaluated the risk factors associated with mortality in their setting and found that lower admission O2 saturation, corticosteroid treatment in children with ARDS requiring mechanical ventilation, diffuse alveolar infiltrate and presence of ARDS was associated with increased mortality in children with pandemic 2009 H1N1 influenza infection. In addition, the authors found a trend towards late presentation to the hospital and bacterial co-infection also being associated with increased risk of mortality (though these were not statistically significant).
e of ARDS was associated with increased mortality in children with pandemic 2009 H1N1 influenza infection. In addition, the authors found a trend towards late presentation to the hospital and bacterial co-infection also being associated with increased risk of mortality (though these were not statistically significant). The present case series of hospitalized children with 2009 H1N1 influenza infection during the H1N1 India pandemic depicts the severity of illness seen in hospitalized young children. H1N1 infection caused significant pneumonia and ARDS, and resulted in ICU admissions and deaths in 96% and 16% of children, respectively. The reported influenza-like presentations such as fever, cough, sore throat, and myalgia as well as gastrointestinal symptoms in the present setting was comparable to previous reports of H1N1 in children [10–12]. Neurological symptoms and complications such as, altered mentation and seizures along with influenza like symptoms were also noted in the present study and were similar to what has been previously reported [12]. High-income settings have reported obesity in a significant proportion of adults and children with H1N1 infection [1–3]. In contrast, the authors did not find an association between nutritional status and risk of H1N1 illness in the present hospitalized cohort; nutritional assessment in the present center revealed that 96% of those children admitted were neither obese nor undernourished by standard anthropometric measurements.
ion [1–3]. In contrast, the authors did not find an association between nutritional status and risk of H1N1 illness in the present hospitalized cohort; nutritional assessment in the present center revealed that 96% of those children admitted were neither obese nor undernourished by standard anthropometric measurements. In contrast to reports from the developed world [1–4] of the current H1N1 pandemic, underlying medical conditions were lower in the present case series. Asthma only accounted for 4% in the present group, whereas in other studies it has been reported to be 12% or higher [1–4]. HIV has been associated with H1N1 in published reports [13] and the authors identified 4% of their children co-infected with HIV, which is higher than the population prevalence of HIV in children in the authors’ area (unpublished data). Nevertheless, the presence of a co-morbid condition showed a trend towards increased mortality in the present series.
in published reports [13] and the authors identified 4% of their children co-infected with HIV, which is higher than the population prevalence of HIV in children in the authors’ area (unpublished data). Nevertheless, the presence of a co-morbid condition showed a trend towards increased mortality in the present series. All children received oseltamivir and empiric antimicrobials on admission to the present center. Although the present data shows that survival and deaths among children who have received oseltamivir within 48 h of symptom onset is not statistically significant, the authors recommend early initiation of oseltamivir under pandemic situation. In spite of receiving antimicrobials prior to admission and upon admission, 16% had confirmed bacterial co-infection during the course of their hospitalization. This included both gram negative and gram positive organisms and is consistent with previous reports [14]. The presence of secondary bacterial infection showed a trend towards increased mortality by 3 fold. Dengue [15] and HIV [16] co-infection with H1N1 has been recently reported, but for the first time, the present case series is reporting co-infections like malaria, tuberculosis and typhoid fever in patients with confirmed 2009 H1N1 infection. However, these co-infections were not associated with increased mortality in the present cohort.
[16] co-infection with H1N1 has been recently reported, but for the first time, the present case series is reporting co-infections like malaria, tuberculosis and typhoid fever in patients with confirmed 2009 H1N1 infection. However, these co-infections were not associated with increased mortality in the present cohort. The mortality rate of 16% noted in the present study is consistent with prior reports of current pandemic for children [1–3]. The authors found that lower admission O2 saturation, diffuse alveolar infiltrate on admission, corticosteroid treatment in children with ARDS requiring mechanical ventilation and presence of ARDS was associated with increased mortality in children with pandemic 2009 H1N1 influenza infection. The fact that mechanical ventilation was required on admission in patients who died, suggests that these children presented late in the course of their illness. Late presentation to the health care system remains a major challenge in influenza pandemics and is frequently associated with poor outcomes, including higher risk of mortality. Mass media and community efforts during a pandemic need to emphasize earlier presentation to health care centers equipped to address pandemic influenza with special care taken to transfer critically ill patients in well equipped ambulances.
s frequently associated with poor outcomes, including higher risk of mortality. Mass media and community efforts during a pandemic need to emphasize earlier presentation to health care centers equipped to address pandemic influenza with special care taken to transfer critically ill patients in well equipped ambulances. Necropsy performed on the children who died demonstrated presence of ARDS pattern, necrotizing pneumonitis, and diffuse alveolar hemorrhage as the probable cause of mortality. The histological findings are similar to that a recent report [17]. The gram staining of lung tissue blocks in the present series revealed that more than half had an underlying gram positive bacterial infection suggestive of streptococcal and staphylococcal infections. CDC has reported bacterial co-infection in almost one third of all fatal H1N1 cases in United States and majority of these infections were streptococcal and staphylococcal infections [14]. The present study had a potential limitation. Since SGH was the only referral center for critically ill patients with suspected H1N1 infection in Pune, India during the early pandemic, the patients represented the most critically ill children in the community with H1N1 and are not representative of the typical cases of childhood H1N1 in the community.
limitation. Since SGH was the only referral center for critically ill patients with suspected H1N1 infection in Pune, India during the early pandemic, the patients represented the most critically ill children in the community with H1N1 and are not representative of the typical cases of childhood H1N1 in the community. The authors’ experience in India suggests that mortality may be associated with late presentation to tertiary care centers and severe illness at presentation, including severe respiratory distress and ARDS. In addition, secondary bacterial infection may also be clinically significant contributor to mortality. In resource-constrained settings such as the present one, the authors recommend early referral and admission of critically ill children, prompt initiation of empirical oseltamivir and broad spectrum antibiotics in order to have better outcomes. Acknowledgements The authors acknowledge the help and support received from Yogesh Salunkhe, Vaibhav Meshram, Shiji Kattakalil, Sushil Tripathi; Mayur Chaudhari, Nitin Manwani, Bhumika Shah, Samta Maniyar, Vinit Wankhede, Vivek Shivhare, Prajakta Doshi, Rahul Daware, Rahul Verma, Chandrakant Sahare, Bharat Chaudhari, Vinayak Kodur; Vishal Patil Heena Joshi,Dileep Kadam, Shivhari Ghorpade, Kalpana Kelkar, Balasaheb Ghongane, Gopal Khadse, Anand Thorat, Pandurang Pawar, Akhilesh Mishra, Mandeep Chadha during preparation of this manuscript. Contributions All authors participated in data analysis and manuscript preparation. Conflict of Interest None. Role of Funding Source None.
Introduction Ventilator associated pneumonia (VAP) is one of the major causes of hospital acquired infections. Despite improvements in aseptic techniques, antibiotic therapy, and supportive care, VAP continues to be a major cause of morbidity and mortality of ICU patients. The incidence continues to be high in spite of improved understanding of the risk factors of VAP. There is no consensus on the preventive strategies akin to adults, in form of bundle approach in children. In 2004, the National Nosocomial Infections Surveillance (NNIS) system of the Centers for Disease Control and Prevention (CDC) reported a mean VAP rate of 2.9 per 1000 ventilator days for participating PICUs in the United States [1], while pediatric studies across the globe report an incidence of 2–17% [2–5]. There are very few studies from developing countries including India reporting the incidence of VAP in chidren. One study from North India reported incidence of VAP to be between 17 and 30% [6]. The risk factors for VAP in infants and children vary somewhat from those in adults. Inoculation of the formerly sterile lower respiratory tract typically occurs from aspiration of secretions, colonization of the aero-digestive tract, use of contaminated equipment, medications, presence of a genetic syndrome, re-intubation, enteral feeding, transport out of the pediatric intensive care unit (PICU) and duration of mechanical ventilation [7]. Common etiological agents causing VAP are Pseudomonas spp., Staphylococcus aureus, and various Gram negative bacilli. The proportion of these organisms varies between the PICUs [6, 8].
, re-intubation, enteral feeding, transport out of the pediatric intensive care unit (PICU) and duration of mechanical ventilation [7]. Common etiological agents causing VAP are Pseudomonas spp., Staphylococcus aureus, and various Gram negative bacilli. The proportion of these organisms varies between the PICUs [6, 8]. The authors conducted a prospective cohort study in the pediatric ICU of their tertiary care hospital, to determine the incidence, evaluate the risk factors, and to document the etiological agents of VAP in mechanically ventilated children. Material and Methods The study was carried out in the Pediatric Intensive Care Unit of a tertiary care hospital in Northern India. The PICU is an 8-bedded unit admitting more than 300 children in a year. It is staffed by two consultants, 3 senior residents and 3 junior residents. The nurse to patient ratio is 1:1 to 1:2. The ventilators used in the unit include Drager Evita 4, Maquet Servo I and Viasys Avea. The unit uses heated wire humidifiers with reusable circuits. The circuits and humidifier are subjected to chemical disinfection. The circuits are changed every 72 h or earlier if there is soiling of circuits with secretions.
1:2. The ventilators used in the unit include Drager Evita 4, Maquet Servo I and Viasys Avea. The unit uses heated wire humidifiers with reusable circuits. The circuits and humidifier are subjected to chemical disinfection. The circuits are changed every 72 h or earlier if there is soiling of circuits with secretions. The study protocol was approved by the Ethics committee of the institute. All patients admitted from June 2012 through March 2014 were enrolled unless they met any one of the following exclusion criteria: children with <24 h of PICU stay, mechanically ventilated in emergency room or ward >12 h, mechanically ventilated for more than 12 h before shifting from other hospital and refusal of consent by parents/ care givers.
une 2012 through March 2014 were enrolled unless they met any one of the following exclusion criteria: children with <24 h of PICU stay, mechanically ventilated in emergency room or ward >12 h, mechanically ventilated for more than 12 h before shifting from other hospital and refusal of consent by parents/ care givers. Children were enrolled after obtaining written informed consent from parents/legal guardians. A detailed history and examination were recorded, including demographic data (age at the time of intubation, gender and admission diagnosis); potential risk factors of VAP; use of medications (inhaled bronchodilators, proton-pump inhibitors, infusions or doses of benzodiazepines, infusions or doses of neuromuscular blocking agents; nutrition method (total parenteral nutrition, gastric feeds via nasogastric tube or gastric tube); route of mechanical ventilation (nasotracheal, orotracheal, or tracheostomy); procedures (need for re-intubation); laboratory data: maximum white cell count, lowest PaO2 from arterial source; chest radiograph data: development of new infiltrate, consolidation or cavity; and culture data: results of blood and non bronchoscopic bronchoalveolar lavage (BAL). All patients were followed for development of ventilator associated pneumonia until the time of transfer, or death. Diagnosis of VAP was based on criteria given by Centers for Disease Control and Prevention (CDC) [9].
tion or cavity; and culture data: results of blood and non bronchoscopic bronchoalveolar lavage (BAL). All patients were followed for development of ventilator associated pneumonia until the time of transfer, or death. Diagnosis of VAP was based on criteria given by Centers for Disease Control and Prevention (CDC) [9]. Enrolled patients were monitored daily for parameters such as heart rate, respiratory rate, temperature, presence of crepitations on auscultation, character of airway secretion and PaO2/ FiO2 ratio. If participants satisfied two or more criteria for the diagnosis of VAP, they were subjected to investigations such as total and differential leukocyte count, chest x-ray, tracheal aspirate and non-bronchoscopic bronchoalveolar lavage. Tracheal aspirate and non-bronchoscopic BAL samples were sent to Bacteriology laboratory of the institute for culture. Culture reports along with antibiotic sensitivity pattern of the isolates were obtained. Non-bronchoscopic BAL were subjected to semi-quantitative culture and culture reports with >104 colony forming units/ mL were considered significant [9]. A diagnosis of VAP was made if there was presence of radiological changes (new infiltrates/ consolidation/ cavity) along with a positive non-bronchoscopic BAL semi-quantitative culture report. Cases with a positive non-bronchoscopic BAL semi-quantitative culture only in the absence of radiological changes of VAP were diagnosed to have ventilator associated tracheobronchitis (VAT). Simplified Clinical Pulmonary Infection Score (CPIS) (Table 1) was computed daily for the enrolled patients. This consisted of components such as temperature, blood leukocyte count, tracheal secretions, PaO2/ FiO2 ratio and chest radiograph findings.Table 1 Simplified clinical pulmonary infection score
ronchitis (VAT). Simplified Clinical Pulmonary Infection Score (CPIS) (Table 1) was computed daily for the enrolled patients. This consisted of components such as temperature, blood leukocyte count, tracheal secretions, PaO2/ FiO2 ratio and chest radiograph findings.Table 1 Simplified clinical pulmonary infection score Component Value Points Temperature oC ≥36.5 and ≤ 38.4 0 ≥38.5 and ≤ 38.9 1 ≥39.0 and ≤ 36.0 2 Blood Leukocytes per mm3 ≥4000 and ≤ 11,000 0 <4000 or > 11,000 1 Tracheal Secretions Few 0 Moderate 1 Large 2 Purulent +1 Oxygenation PaO2/FiO2, mmHg >240 or presence of ARDS 0 ≤240 and absence of ARDS 2 Chest Radiograph No infiltrate 0 Patchy or diffuse infiltrate 1 Localized infiltrate 2 ARDS Acute respiratory distress syndrome Existing literature suggests an incidence of VAP in India between 17 and 30%. To estimate an incidence (P) of 25%, with precision (D) of 10% and 95% confidence, sample size of 72 was needed {n = (1.96)2 X P (1-P)/D2; (P = 0.25; D = 0.10)}. Incidence of VAP was calculated by the total episodes of VAP divided by the total number of mechanically ventilated children. Etiological agents were calculated as simple frequency of individual agents in VAP. Statistical package Stata 11.0 (StataCorp, College Station, TX, USA) was used for statistical analysis.
Existing literature suggests an incidence of VAP in India between 17 and 30%. To estimate an incidence (P) of 25%, with precision (D) of 10% and 95% confidence, sample size of 72 was needed {n = (1.96)2 X P (1-P)/D2; (P = 0.25; D = 0.10)}. Incidence of VAP was calculated by the total episodes of VAP divided by the total number of mechanically ventilated children. Etiological agents were calculated as simple frequency of individual agents in VAP. Statistical package Stata 11.0 (StataCorp, College Station, TX, USA) was used for statistical analysis. For identification of risk factors, all children enrolled in the study were divided into two groups – those with VAP and those without VAP. For each of the categorical variable, a 2 × 2 table was generated to compare the occurrence of that variable in each of the two groups. Chi-square test was applied for each of these 2 × 2 tables to compute the p-value and risk estimate was done by calculating the odds ratio and 95% CI. Using bivariate analysis, variables were compared between VAP and non-VAP group. Variable found to be significant on bivariate analysis were subjected to multivariate analysis. To calculate optimal cut-off values for CPIS scores for identification of VAP, receiver operator characteristic (ROC) curve was constructed. Most appropriate cut-off for clinical VAP and microbiologic VAP were derived.
roup. Variable found to be significant on bivariate analysis were subjected to multivariate analysis. To calculate optimal cut-off values for CPIS scores for identification of VAP, receiver operator characteristic (ROC) curve was constructed. Most appropriate cut-off for clinical VAP and microbiologic VAP were derived. Results One hundred and twenty eight children were screened for inclusion. Among them 31 patients were excluded as they met the exclusion criteria and parents of 11 refused consent. Therefore, a total of 86 children were enrolled. Among these 62 (72%) were boys with a median (IQR) age of 30 mo (4–84 mo) and median weight and height were 9.5 kg and 79 cm, respectively. Diagnosis at the time of enrolment included sepsis, acyanotic congenial heart disease, nephrotic syndrome, acute febrile encephalopathy, Guillain Barré syndrome, lower respiratory tract infection (LRTI) and dengue in decreasing frequency (Table 2). Indications for need for mechanical ventilation included: respiratory failure as judged by clinical and/or arterial blood gas analysis, poor sensorium as judged by Glasgow coma scale, shock, maintenance of a stable airway or cardiorespiratory arrest (Table 3). Median duration of illness at the time of enrolment in study was 4 d.Table 2 Diagnosis at the time of enrolment (n = 86)
piratory failure as judged by clinical and/or arterial blood gas analysis, poor sensorium as judged by Glasgow coma scale, shock, maintenance of a stable airway or cardiorespiratory arrest (Table 3). Median duration of illness at the time of enrolment in study was 4 d.Table 2 Diagnosis at the time of enrolment (n = 86) Diagnosis Number (%) Sepsis 14 (16) Acyanotic congenital heart disease 12 (14) Nephrotic syndrome 7 (8.1) Acute febrile encephalopathy 5 (5.8) Acute liver failure 5 (5.8) Hemolytic uremic syndrome 5 (5.8) Guillain Barré syndrome 4 (4.6) Lower respiratory tract infection 4 (4.6) Acute gastroenteritis 4 (4.6) Dengue 3 (3.4) Apparent life threatening events 3 (3.4) HIV encephalopathy 2 (2.3) Distal renal tubular acidosis 2 (2.3) Persistent pulmonary hypertension 2 (2.3) West syndrome 2 (2.3) Others* 12 (13.9) *One case (1.2%) each of Malaria, Megaloblastic anemia, Neuro-enteric cyst, Chronic kidney disease, Acid ingestion, Hypertensive encephalopathy, Diabetic ketoacidosis, Inborn error of metabolism, Necrotizing enterocolitis, Snake bite, Acute lymphoblastic leukemia, Congenital rubella syndrome HIV Human immunodeficiency virus Table 3 Indications for ventilation (n = 86) Indication for ventilation Number (%) Respiratory failure 39 (45.3) Poor sensorium 22 (25.6) Shock 10 (11.6) Cardio-respiratory arrest 9 (10.5) Airway protection 6 (7) Total 86
Diagnosis Number (%) Sepsis 14 (16) Acyanotic congenital heart disease 12 (14) Nephrotic syndrome 7 (8.1) Acute febrile encephalopathy 5 (5.8) Acute liver failure 5 (5.8) Hemolytic uremic syndrome 5 (5.8) Guillain Barré syndrome 4 (4.6) Lower respiratory tract infection 4 (4.6) Acute gastroenteritis 4 (4.6) Dengue 3 (3.4) Apparent life threatening events 3 (3.4) HIV encephalopathy 2 (2.3) Distal renal tubular acidosis 2 (2.3) Persistent pulmonary hypertension 2 (2.3) West syndrome 2 (2.3) Others* 12 (13.9) *One case (1.2%) each of Malaria, Megaloblastic anemia, Neuro-enteric cyst, Chronic kidney disease, Acid ingestion, Hypertensive encephalopathy, Diabetic ketoacidosis, Inborn error of metabolism, Necrotizing enterocolitis, Snake bite, Acute lymphoblastic leukemia, Congenital rubella syndrome HIV Human immunodeficiency virus Table 3 Indications for ventilation (n = 86) Indication for ventilation Number (%) Respiratory failure 39 (45.3) Poor sensorium 22 (25.6) Shock 10 (11.6) Cardio-respiratory arrest 9 (10.5) Airway protection 6 (7) Total 86 Among 86 enrolled patients 33 (38.4%) developed ventilator associated pneumonia according to CDC criteria; 21 (24.4%) were microbiologically confirmed. Hence, the incidence of ventilator associated pneumonia was 38.4% according to CDC clinical criteria and 24.4% were microbiologically confirmed. Occurrence of VAP episodes using the CDC criteria was 41 episodes per 1000 ventilator days, while that of microbiologically confirmed episodes was 27 episodes per 1000 ventilator days. Average time to develop VAP was 10.5 d.
umonia was 38.4% according to CDC clinical criteria and 24.4% were microbiologically confirmed. Occurrence of VAP episodes using the CDC criteria was 41 episodes per 1000 ventilator days, while that of microbiologically confirmed episodes was 27 episodes per 1000 ventilator days. Average time to develop VAP was 10.5 d. Non-bronchoscopic BAL yielded various bacterial etiologies, among which Acinetobacter was the most common (10/21) 47% followed by Pseudomonas (6/21) 28% and Klebsiella was positive in 3 cases (14%). One case each was positive for Enterobacter and E. coli. Notably, none of the isolates were gram-positive bacteria. Among the bacteria isolated, Acinetobacter was uniformly sensitive to Colistin with four isolates being sensitive exclusively to Colistin and Tigecycline. Other isolated organisms were fairly sensitive to most of the common antibiotics.
nterobacter and E. coli. Notably, none of the isolates were gram-positive bacteria. Among the bacteria isolated, Acinetobacter was uniformly sensitive to Colistin with four isolates being sensitive exclusively to Colistin and Tigecycline. Other isolated organisms were fairly sensitive to most of the common antibiotics. Risk factors of VAP identified by bivariate analysis were the use of proton pump inhibitor (PPI) [In the group who developed VAP, 19 (90.4%) received PPIs while of those who did not develop VAP, 42 (64.6%) received PPI], enteral feeding and change of endo-tracheal tube (p < 0.05). Other risk factors which were analyzed but found to be not significant included, age (p = 0.16), gender (p = 0.93), head end elevation (p = 0.87), sedation (p = 0.38), neuromuscular blocking agent (p = 1.0) and use of aerosol (p = 0.08) (Table 4). The authors did not find relation between day of feeding and development of VAP. On multivariate analysis, use of PPI (p = 0.03) and enteral feeding (p < 0.01) were found to be statistically significant (Table 5).Table 4 Risk factors for microbiologically confirmed VAP: bi-variate analysis
aerosol (p = 0.08) (Table 4). The authors did not find relation between day of feeding and development of VAP. On multivariate analysis, use of PPI (p = 0.03) and enteral feeding (p < 0.01) were found to be statistically significant (Table 5).Table 4 Risk factors for microbiologically confirmed VAP: bi-variate analysis Factors VAP group N = 21 Non-VAP N = 65 P value Odds ratio 95% CI Age in months; mean ± SD 32.24 ± 36.07 50.52 ± 48.16 0.16 0.99 0.97–1.0 Boys 15 (71.4%) 47 (72.3%) 0.93 1.0 0.3–3.1 Use of PPI 19 (90.4%) 42 (64.6%) 0.027 5.2 1.1–24.3 Enteral feeding 15 (71.4%) 18 (27.7%) <0.001 6.5 2.1–19.4 Head end elevation 13 (61.9%) 39 (60%) 0.87 1.08 0.3–2.9 Sedation 18 (85.7%) 49 (75.3%) 0.38 1.9 0.5–7.5 Use of NMBA 3 (14.2%) 8 (12.3%) 1.0 1.1 0.2–4.9 Endotracheal tube change 9 (42%) 12 (18%) 0.024 3.3 1.1–9.6 Use of aerosol 5 (23.8%) 6 (9.2%) 0.082 3.0 0.8–11.3 VAP Ventilator associated pneumonia; PPI Proton pump inhibitor; NMBA Neuromuscular blocking agents Table 5 Risk factors for development of VAP: multi-variate analysis Factors P value Odds ratio 95% CI Use of PPI 0.03 8.47 (1.19–60.33) Enteral feeding 0.0001 12.22 (2.58–57.78) Ten (11.62%) out of 86 patients fulfilled the CDC criteria for VAT. Endo-tracheal aspirate was negative in all of them. Four of these patients progressed to ventilator associated pneumonia (3 CDC criteria positive VAP and 1 microbiologically proven VAP). Simplified CPIS scoring was calculated and ROC curve was constructed for both group of VAP patients, who were diagnosed using CDC criteria and those microbiologically confirmed.
Ten (11.62%) out of 86 patients fulfilled the CDC criteria for VAT. Endo-tracheal aspirate was negative in all of them. Four of these patients progressed to ventilator associated pneumonia (3 CDC criteria positive VAP and 1 microbiologically proven VAP). Simplified CPIS scoring was calculated and ROC curve was constructed for both group of VAP patients, who were diagnosed using CDC criteria and those microbiologically confirmed. When CDC criteria were used to diagnose VAP, score of ≥4 was obtained as the cut-off with sensitivity of 88.89% and specificity of 84.38%. The positive likelihood ratio was 5.6 and the negative likelihood ratio was 0.13. The area under the curve was 0.95 which is graded excellent (Fig. S1). For diagnosis of microbiologically confirmed VAP, CPIS of ≥5 was obtained as the cut-off with sensitivity of 70.0% and specificity of 72.73%. The positive Likelihood Ratio was 2.5 and the negative Likelihood Ratio was 0.4. The area under the curve was 0.80 which is graded good (Fig. S2). While assessing for outcome, 35.9% of patients in non-VAP group expired but VAP group (CDC criteria) had a mortality of 42.4%. Most common cause of death was septic shock with multi-organ dysfunction. Remaining all patients recovered.
When CDC criteria were used to diagnose VAP, score of ≥4 was obtained as the cut-off with sensitivity of 88.89% and specificity of 84.38%. The positive likelihood ratio was 5.6 and the negative likelihood ratio was 0.13. The area under the curve was 0.95 which is graded excellent (Fig. S1). For diagnosis of microbiologically confirmed VAP, CPIS of ≥5 was obtained as the cut-off with sensitivity of 70.0% and specificity of 72.73%. The positive Likelihood Ratio was 2.5 and the negative Likelihood Ratio was 0.4. The area under the curve was 0.80 which is graded good (Fig. S2). While assessing for outcome, 35.9% of patients in non-VAP group expired but VAP group (CDC criteria) had a mortality of 42.4%. Most common cause of death was septic shock with multi-organ dysfunction. Remaining all patients recovered. Discussion In this prospective cohort study, 86 mechanically ventilated children admitted in a PICU of a single center were analyzed, to determine the incidence of VAP, to evaluate the associated risk factors, and to document the etiological agents for the same. The incidence of ventilator associated pneumonia was found to be 38.3% by CDC criteria while 24.4% were microbiologically confirmed VAP. The most common organism isolated was Acinetobacter. Independent risk factors were found to be enteral feeding and use of proton pump inhibitor. Simplified Clinical Pulmonary Infection Score of ≥4 had a good sensitivity and specificity for diagnosis of CDC defined VAP. Incidence of ventilator associated tracheobronchitis (VAT) was found to be 11.6%.
ed was Acinetobacter. Independent risk factors were found to be enteral feeding and use of proton pump inhibitor. Simplified Clinical Pulmonary Infection Score of ≥4 had a good sensitivity and specificity for diagnosis of CDC defined VAP. Incidence of ventilator associated tracheobronchitis (VAT) was found to be 11.6%. Studies documenting VAP in children are few, and incidence varies according to geographic regions. Incidence rate reported from developed countries has been in the range of 15–17% [2–5], while in developing countries it is 25–35% [7]. Srinivasan et al. from Boston had reported an incidence of 32% using CDC defined VAP in pediatric patients [10]. Elward et al. in their study from Missouri revealed a VAP rate of 11.6 episodes per 1000 ventilator days [2]. While, the present study has documented incidence rate to be 41 episodes per 1000 ventilator days. This is probably due to differences in the patient profile, nutritional status and resource availability. The present study results are similar to another Indian study done by Awasthi et al. where the incidence of VAP was reported to be 36.2% [11]. The inclusion criteria and the definition used in this study were the same as in present study. Comparison of incidence from various studies should be done with caution, taking into account the profile of patients being studied and also the criteria used for diagnosis. High incidence of VAP has been reported for many a decades and it remains almost the same. Study by Gupta et al. from Delhi, India, showed a decrease of VAP incidence from 20.2 to 14.6 episodes per 1000 ventilator days after an educational intervention [12].
ients being studied and also the criteria used for diagnosis. High incidence of VAP has been reported for many a decades and it remains almost the same. Study by Gupta et al. from Delhi, India, showed a decrease of VAP incidence from 20.2 to 14.6 episodes per 1000 ventilator days after an educational intervention [12]. In the present study, the incidence of Ventilator associated tracheobronchitis (VAT) was estimated to be 11.62%. This was based on CDC definition of clinical and radiological features. Endotracheal aspirate (ETA) was negative for organisms in all those suspected of VAT. The European Respiratory Society, European Society of Clinical Microbiology and Infectious Diseases, and European Society of Intensive Care Medicine taskforce suggest a positive culture of respiratory secretions as a mandatory item in the diagnosis of VAT. Though CDC definition for VAT requires only one of the clinical criteria to be fulfilled, the documentation of 11.62% was done in the presence of purulent secretion as a mandatory criteria to avoid confusions in case of ETA being sterile. Hence, this clinical definition could well be adopted for VAT though ETA positivity is useful for making decision about treating VAT. Craven et al. reported the incidence of VAT to be 11% in adults [13], though they used microbiological confirmation to be mandatory in the diagnosis of ventilator associated tracheobronchitis. Simpson et al. reported a much lower (3.4%) incidence of VAT in a mixed medical surgical PICU [14].
ecision about treating VAT. Craven et al. reported the incidence of VAT to be 11% in adults [13], though they used microbiological confirmation to be mandatory in the diagnosis of ventilator associated tracheobronchitis. Simpson et al. reported a much lower (3.4%) incidence of VAT in a mixed medical surgical PICU [14]. Non-bronchoscopic bronchoalveolar lavage with quantitative culture was used as the diagnostic modality for microbiological documentation in the index study. According to Centers for Disease Control and Prevention (CDC) criteria, endotracheal aspirate (ETA) is used in the diagnosis of both ventilator associated pneumonia and ventilator associated tracheobronchitis. Either semi-quantitative culture showing moderate to heavy growth or a quantitative culture showing ≥106 cfu/ml is taken to be positive. CDC has also stated that in the diagnosis of VAT, bronchoalveolar lavage is usually not used or is <104 cfu/ml. In the present study, authors used bronchoalveolar lavage for VAP and endotracheal aspirate (ETA) for ventilator associated tracheobronchitis (VAT) [9]. The most common organisms responsible for VAP in the present study were gram negative bacilli. Other studies have also reported gram-negative bacteria as the most frequent isolates (42–65%) [15, 16]. A review of all the available studies has shown Acinetobacter to be emerging pathogen in Asian countries including India [17]. This is in accordance to the findings in the present study.
were gram negative bacilli. Other studies have also reported gram-negative bacteria as the most frequent isolates (42–65%) [15, 16]. A review of all the available studies has shown Acinetobacter to be emerging pathogen in Asian countries including India [17]. This is in accordance to the findings in the present study. Independent risk factors identified in present study were use of PPI and enteral feeding. Various studies have shown varying results of male and female predisposition for the same. But this could probably be due to the difference in the rates of admission and enrolment. Study by Patria et al. had shown similar results with enteral feeding and re-intubation as independent risk factors for VAP [16]. Children enroled in present study received proton pump inhibitor – pantoprazole as the stress ulcer prophylaxis during their PICU stay. This clinically correlates to the possibility of micro-aspiration in an alkaline environment leading to VAP. Gopalareddy et al. used ETA for the presence of pepsin and have shown that 70% of mechanically ventilated children are prone for gastric aspiration [18]. The risk of VAP was greatly increased in patients who underwent re-intubation. A similar high incidence of VAP was found to be associated with re-intubation in other studies as well [19]. Possible explanations could be increase in duration of ventilation and aspiration of gastric contents during the interval between extubation and re-intubation. This underlines the importance of proper weaning protocols in the prevention of VAP and the associated mortality.
h re-intubation in other studies as well [19]. Possible explanations could be increase in duration of ventilation and aspiration of gastric contents during the interval between extubation and re-intubation. This underlines the importance of proper weaning protocols in the prevention of VAP and the associated mortality. Simplified Clinical Pulmonary Infection Score (CPIS) has been found to be fairly sensitive and specific in the bedside diagnosis of VAP. The present study revealed a score of ≥4 to have a good value for diagnosing VAP based on CDC criteria and a score of ≥5 for microbiologically confirmed VAP. Sachdev et al. found a value of 8 to be sensitive and specific and they used microbiological positivity as the gold standard [20], but no other pediatric studies have validated the same. The greater difference in the cut-off value between the study by Sachdev et al. and present study could be explained by the fact that their study included children with a CPIS score of more than 6. In the present study CPIS was not used for inclusion of children and so lower values were expected.
ve validated the same. The greater difference in the cut-off value between the study by Sachdev et al. and present study could be explained by the fact that their study included children with a CPIS score of more than 6. In the present study CPIS was not used for inclusion of children and so lower values were expected. Conclusions Some limitations were noted and must be acknowledged in this study. The number of study subjects was less, thereby limiting power of the analysis. Despite these limitations, the present study conducted upon a robust methodology, reveals a high incidence of VAP in children and simultaneously discloses the commonest etiological organisms and risk factors for VAP. This can possibly lead the way for implementation of improved ways of prevention and treatment of VAP in children in similar settings. Electronic supplementary material Fig. S1 (DOCX 79 kb) Fig. S2 (DOCX 102 kb) Contributions VG: Developed protocol, data collection, manuscript writing; AM: Involved in data collection; JS: Involved in development of protocol, data analysis; AK: Involved in development of protocol and microbiology investigations; RL: Involved in protocol development, data analysis and manuscript writing and will act as guarantor for the paper; SKK: Involved in protocol development, data collection, analysis and manuscript writing. Compliance with Ethical Standards Conflict of Interest None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 17090900 BF02859281 10.1007/BF02859281 Original Article Clinical features, complications and atypical manifestations of children with severe forms of dengue hemorrhagic fever in South India Kamath Shrishu R. Ranjit Suchitra 044-28294429chitrasona@rediffmail.com grid.413839.40000000418023550Pediatric Intensive Care Unit, Apollo Hospitals, G/A, Ranga Nivas, 40 Barnaby Rd, Kilpauk, 6000 10 Chennai, 2006 73 10 889 895 © Dr. K C Chaudhuri Foundation 2006This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Objective To review clinical features and outcome of children with severe forms of dengue hemorrhagic fever (DHF) presenting to a pediatric intensive care unit (PICU) with particular focus on clinical presentation and outcome. Methods Retrospective chart review of patients admitted to the Pediatric Intensive Care Unit (PICU) of a referral children's hospital in South India with DHF over 1.5 years (2001–January 2003).
17090900 BF02859281 10.1007/BF02859281 Original Article Clinical features, complications and atypical manifestations of children with severe forms of dengue hemorrhagic fever in South India Kamath Shrishu R. Ranjit Suchitra 044-28294429chitrasona@rediffmail.com grid.413839.40000000418023550Pediatric Intensive Care Unit, Apollo Hospitals, G/A, Ranga Nivas, 40 Barnaby Rd, Kilpauk, 6000 10 Chennai, 2006 73 10 889 895 © Dr. K C Chaudhuri Foundation 2006This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Objective To review clinical features and outcome of children with severe forms of dengue hemorrhagic fever (DHF) presenting to a pediatric intensive care unit (PICU) with particular focus on clinical presentation and outcome. Methods Retrospective chart review of patients admitted to the Pediatric Intensive Care Unit (PICU) of a referral children's hospital in South India with DHF over 1.5 years (2001–January 2003). Results Of 858 patients with dengue fever/DHF admitted to the hospital during the study period, 109 cases with severe forms of disease required PICU admission, of which 9 patients died. 77 were under 5 years of age. The commonest indication for PICU admission was persistent shock (39 patients) followed by requirement for positive pressure ventilation in 29 patients (10 of whom had Acute Respiratory Distress Syndrome [ARDS]) and neurological symptoms in 24 patients. An important finding was the presence of diastolic dysfunction in 3 children. Six deaths of refractory shock included 4 who had ARDS and DIC and 2 who had shock with DIC 3 patients had abdominal compartment syndrome (ACS) has not been previously described in children with DSS and may lead to fluid refractory shock if not corrected. All patients had thrombocytopenia which was a defining feature of the syndrome, while 74 were also coagulopathic and 6 had severe fatal DIC. Hepatic dysfunction was more severe in children with prolonged shock, however, only a fifth of cases (5/24) with neurological manifestations were in shock. Other significant reasons for neurological presentation included cerebral edema, and encephalopathy secondary to hepatic dysfunction. 2 children had features of Acute Disseminated Encephalomyelitis (ADEM), previously only described in adults with dengue.
h of cases (5/24) with neurological manifestations were in shock. Other significant reasons for neurological presentation included cerebral edema, and encephalopathy secondary to hepatic dysfunction. 2 children had features of Acute Disseminated Encephalomyelitis (ADEM), previously only described in adults with dengue. Conclusion It was found that complications such as DIC, diastolic dysfunction, abdominal compartment syndrome, ARDS and hepatic dysfunction were more frequent in severe established shock. However, most neurological events were unrelated to the perfusion status. Children referred late were harder to resuscitate. There were 9 PICU deaths (case fatality rate of 8.35%). Severe refractory shock, DIC, ARDS, hepatic failure and neurological manifestations singly or in combination were the commonest causes of death in the present study. Key words Dengue hemorrhangic feverDengue shock syndromeAcute respiratory distress syndromeCompartment syndromeDiastolic dysfunctionissue-copyright-statement© Dr. K C Chaudhuri Foundation 2006
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 11770243 BF02722358 10.1007/BF02722358 Article Nosocomial infections in pediatric intensive care units Lodha Rakesh skkabra@hotmail.com Chandra Uma Natchu Mouli Nanda Mrinal Kabra S. K. grid.413618.90000000417676103Department of Pediatrics, All India Institute of Medical Sciences, Ansari Nagar, 110029 New Delhi, India 2001 68 11 1063 1070 © Dr. K C Chaudhuri Foundation 2001This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Nosocomial infections are a significant problem in pediatric intensive care units. While Indian estimates are not available, western PICUs report incidence of 6–8%. The common nosocomial infections in PICU are bloodstream infections (20–30% of all infections), lower respiratory tract infections (20–35%), and urinary tract infections (15–20%); there may be some differences in their incidence in different PICUs. The risk of nosocomial infections depends on the host characteristics, the number of interventions, invasive procedures, asepsis of techniques, the duration of stay in the PICU and inappropriate use of antimicrobials. Most often the child had endogenous flora, which may be altered because of hospitalization, are responsible for the infections. The common pathogens involved areStaphylococcus aureus, coagulase negativestaphylococci, E. coli Pseudomonas aeruginosa, Klebsiella, enterococci, andCandida. Nosocomial pneumonias predominantly occur in mechanically ventilated children. There is no consensus on the optimal approach for their diagnosis. Bloodstream infections are usually attributable to the use of central venous lines; use of TPN and use of femoral site for insertion increase the risk. Urinary tract infections occur mostly after catheterization and can lead to secondary bacteremia. The diagnostic criteria have been discussed in the review.
diagnosis. Bloodstream infections are usually attributable to the use of central venous lines; use of TPN and use of femoral site for insertion increase the risk. Urinary tract infections occur mostly after catheterization and can lead to secondary bacteremia. The diagnostic criteria have been discussed in the review. With proper preventive strategies, the nosocomial infection rates can be reduced by up to 50%; handwashing, judicious use of interventions, and proper asepsis during procedures remain the most important practices. Key words Nosocomial infectionsIntensive careChildrenPreventionissue-copyright-statement© Dr. K C Chaudhuri Foundation 2001
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 17090907 BF02859289 10.1007/BF02859289 Symposium: Gastroenterology & Hepatology—III Acute liver failure Bansal Sanjay Dhawan Anil anil.dhawan@kcl.ac.uk Paediatric Liver Centre King's College Hospital Denmark Hill, SE5 9RS London, 2006 73 10 931 934 © Dr. K C Chaudhuri Foundation 2006This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Acute liver failure in children is a rare but potentially fatal disease. Causes of ALF in neonatal period are different from those in early or late childhood. Despite the improvement in the paediatric intensive care, liver transplantation remains the only effective treatment. Use of newer treatment modalities (liver assist devices and hepatocyte transplantation) is still in experimental phase. Management requires early recognition, prompt diagnosis of treatable condition, supportive therapy and prevention of complications hence these children should ideally be treated in a specialist unit. Key words Acute liver failureChildrenLiver transplantationissue-copyright-statement© Dr. K C Chaudhuri Foundation 2006
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer-Verlag India 18810353 175 10.1007/s12098-008-0175-6 Letter to the Editor Dengue, HIV and thrombocytopenia Garg Pankaj 2 Seneviratne Suranjith L. Suranjith.Seneviratne@imperial.nhs.uk 1 2 grid.419277.e0000000107400996Department of Pediatrics and Clinical Epidemiology, Sitaram Bhartia Institute of Science and Research, New Delhi, India 1 grid.426467.50000000121088951St Mary’s Hospital and Imperial College, London, UK 22 9 2008 2008 75 11 1187 1187 © Dr. K C Chaudhuri Foundation 2008This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Keywords Dengue VirusImmune Thrombocytopenic PurpuraTyphusDengue InfectionScrub Typhusissue-copyright-statement© Dr. K C Chaudhuri Foundation 2008
Introduction As the spread of dengue fever and dengue hemorrhagic fever is increasing, atypical manifestations are also on the rise [1]. Recent observations indicate that the clinical profile of dengue is changing, and that neurological and other atypical manifestations are being reported more frequently [2–6]. There are very few reports available in the literature highlighting clinical course and management of acute demyelinating encephalomyelitis (ADEM) and abdominal compartment syndrome (ACS) in dengue infection. The authors present 2 cases of dengue hemorrhagic fever to highlight clinical features and management of these complications. Case Reports Case 1 A 14-y-old boy was admitted with high fever since 8 d, vomiting, pain in abdomen and decreased urine output since 1 d. On admission, the systolic blood pressure was 70 mm Hg with poor perfusion requiring fluid rescusitation and inotropic support. Relevant investigations were done. Hematocrit was very high – Hb 20.7 g % , PCV 61.5 and platelet count was 110 × 103/mm3. Dengue IgG was strongly positive, IgM was negative and blood bactec was negative. Radiograph chest revealed right pleural effusion. Clinical picture and investigations suggested diagnosis of dengue shock syndrome. Patient was electively intubated and ventilated in view of poor perfusion and unstable hemodynamics. Patient required multiple fluid boluses and upward titration of inotrope and vasopressor support. Serial monitoring of PCV was done.PCV values were as follows: 61.5 at admission, 54.8 at 8 h, 50 at 10 h and 37 at 14 h of admission.
electively intubated and ventilated in view of poor perfusion and unstable hemodynamics. Patient required multiple fluid boluses and upward titration of inotrope and vasopressor support. Serial monitoring of PCV was done.PCV values were as follows: 61.5 at admission, 54.8 at 8 h, 50 at 10 h and 37 at 14 h of admission. At 10 h of admission, patient had poor perfusion, cold peripheries, oliguria and severe hypertension with BP of 150/120 mm Hg suggestive of severe vasoconstriction. Also, abdomen felt very firm and rigid. Clinical picture suggested abdominal compartment syndrome. Ascitic tap was done and continuous ascitic drain was kept. Also, milrinone drip was started and adrenalin drip reduced to decrease vasoconstriction. Ascitic fluid drainage was continued. Patient responded well with improvement in perfusion and subsidence of severe hypertension. Approximately 2.7 l of ascitic fluid was drained, following which abdomen became soft. Patient was extubated after 24 h of ventilation and thereafter made an uneventful recovery.
nstriction. Ascitic fluid drainage was continued. Patient responded well with improvement in perfusion and subsidence of severe hypertension. Approximately 2.7 l of ascitic fluid was drained, following which abdomen became soft. Patient was extubated after 24 h of ventilation and thereafter made an uneventful recovery. Case 2 An 8-y-old girl was referred to the authors’ hospital with history of fever since 6 d and one episode of hemoptysis following which she became breathless. On admission, she was cyanosed, restless with laboured breathing and therefore, was intubated and ventilated. On ET suctioning, fresh blood and blood stained secretions were suctioned. High ventilator settings were required to maintain adequate oxygen saturation (>90%). Radiograph chest done was suggestive of ARDS. Patient required PRBC, FFP and platelet transfusions. She also required fluids, dopamine and nor-adrenalin infusion to maintain adequate blood pressure and perfusion. PT/ PTT sent prior to giving any blood products was normal and platelet count was 87000/mm3. Dengue IgG was strongly positive whereas Dengue IgM was negative. Clinical picture and lab investigations suggested diagnosis of dengue shock syndrome. Inotropes were omitted on day 4 and patient could be weaned from ventilator on day 5 of admission.
iving any blood products was normal and platelet count was 87000/mm3. Dengue IgG was strongly positive whereas Dengue IgM was negative. Clinical picture and lab investigations suggested diagnosis of dengue shock syndrome. Inotropes were omitted on day 4 and patient could be weaned from ventilator on day 5 of admission. Post extubation, child was doing well and had normal sensorium. However, 12 h post extubation, she had 2 episodes of generalised tonic clonic seizure. CBC and metabolic work up done were normal. Sensorium remained normal and loading dose of phenytoin was given. Next day, patient had multiple episodes of convulsions following which sensorium became altered with drowsiness, aggressive behaviour and hallucinations. Loading dose of phenobarbitone and IV valparin were given. Patient remained afebrile during these events. CT scan of the brain was done which suggested bilateral frontal and occipital lobe hypodensities in the white matter suggested of demyelination. Pediatric neurologist’s opinion was taken. In view of clinical picture and CT brain findings, diagnosis of ADEM was made. She was started on pulse dose intravenous methylprednisolone 30 mg/kg once a day for 3 d. She showed dramatic improvement and was completely normal neurologically after 2nd pulse dose of methylprednisolone. After 3 pulse doses of methylprednisolone, oral prednisolone was started in the dose of 2 mg/kg/day and given for a total of 14 d in a tapering dose. She was discharged after 15 d of hospitalization and was neurologically normal at discharge.
completely normal neurologically after 2nd pulse dose of methylprednisolone. After 3 pulse doses of methylprednisolone, oral prednisolone was started in the dose of 2 mg/kg/day and given for a total of 14 d in a tapering dose. She was discharged after 15 d of hospitalization and was neurologically normal at discharge. Discussion Abdominal compartment syndrome (ACS) is being increasingly recognized following a variety of medical conditions like sepsis, dengue shock syndrome, acute pancreatitis etc [7]. In dengue shock syndrome, ACS occurs due to leakage of fluid from the intravascular compartment particularly after massive fluid resuscitation, leading to fluid accumulation in serous cavities. ACS can have deleterious effect on various organ systems. It can cause decreased cardiac contractility, increased afterload, increased ventilator requirement, decreased GI perfusion, renal dysfunction and oliguria and increased ICT [7]. Relieving high intraabdominal pressure leads to dramatic improvement in clinical condition [7].
deleterious effect on various organ systems. It can cause decreased cardiac contractility, increased afterload, increased ventilator requirement, decreased GI perfusion, renal dysfunction and oliguria and increased ICT [7]. Relieving high intraabdominal pressure leads to dramatic improvement in clinical condition [7]. Though the authors did not measure abdominal pressure, very firm and rigid feel of the abdomen and associated symptoms like severe shock, oliguria and increased ventilatory requirements and also, dramatic improvement after large volume abdominal paracentesis draining 2.7 l of fluid suggested the diagnosis of ACS. The present patient had severe vasoconstriction which could be explained by increased abdominal pressure with ACS causing decreased cardiac output, decreased cardiac contractility, pressure on the aorta and increased afterload. Severe vasoconstriction and cold shock responded to abdominal paracentesis and milrinone infusion. Kamath and Ranjit [2] have reported in their study of 109 dengue patients admitted in PICU that 3 patients had abdominal compartment syndrome and it contributed to refractory shock. They reported improvement in cardiorespiratory function in 2 children following controlled release of the intra-abdominal pressure by peritoneal dialysis while the third patient failed to improve and died.
tients admitted in PICU that 3 patients had abdominal compartment syndrome and it contributed to refractory shock. They reported improvement in cardiorespiratory function in 2 children following controlled release of the intra-abdominal pressure by peritoneal dialysis while the third patient failed to improve and died. Various neurological complications have been reported in dengue fever. Pancharoen and Thisyakorn [8] published a study of 1483 patients with dengue fever, out of which eighty patients had neurological manifestation with an incidence of 5.4%. They were categorised into encephalopathy group (42), seizure group (35) and miscellaneous group (3). Kamath and Ranjit [2] have reported in their study of 109 dengue patients admitted in PICU, that out of 24 patients with neurological manifestations, 2 had ADEM. They had profound altered mental status and no localizing signs despite normalization of their cardiopulmonary and metabolic parameters and subsidence of stigmata of DHF, similar to the case 2 in present study. Both patients were treated with pulse dose of steroid. One patient progressed to severe cerebral edema and brain stem death while the second patient survived with significant neurological residua.
f their cardiopulmonary and metabolic parameters and subsidence of stigmata of DHF, similar to the case 2 in present study. Both patients were treated with pulse dose of steroid. One patient progressed to severe cerebral edema and brain stem death while the second patient survived with significant neurological residua. Yamamoto et al. [9] reported a case of ADEM in dengue fever in a 58-y-old male in the year 2001. In 2007, Brito et al. [3] reported a case of 37-y-old woman with ADEM due to dengue virus serotype 3. Miranda de Sausa et al. [4] reported in 2006 a case of Brazilian child with neuromyelitis optica, a rare form of ADEM following dengue infection. They reported benign evolution following steroid therapy. Recently, few case reports of ADEM in dengue infection have been reported [5, 6]. Gera and George [6] reported a case of dengue fever with ADEM in an adult male. He showed good clinical response to a course of high dose corticosteroid with complete neurological recovery. Conflict of Interest None. Role of Funding Source None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 10829965 BF02823867 10.1007/BF02823867 Symposium: Pulmonology Part I Management of respiratory failure Singh Meenu Kumar Lata grid.415131.30000000417672903Department of Pediatrics, Postgraduate Institute of Medical Education and Research, Chandigarh, 1996 63 1 53 60 © Dr. K C Chaudhuri Foundation 1996This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Keywords Respiratory FailureContinuous Positive Airway PressureAcute Respiratory FailureBronchiolitisAdult Respiratory Distress Syndromeissue-copyright-statement© Dr. K C Chaudhuri Foundation 1996
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 8262588 BF02751428 10.1007/BF02751428 Symposium: Hematology/Oncology—II Bone marrow transplantation for thalassemia Lucarelli G. Angelucci E. Giardini C. Baronciani D. Galimberti M. Polchi P. Erer B. Divisione Ematologica e Centro Trapianto Midollo, Osseo di Muraglia, Ospedale di Pesaro, Pesaro, Italia 1993 60 4 517 523 © Dr. K C Chaudhuri Foundation 1993This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Early trials of allogeneic bone marrow transplantation (BMT) for homozygous beta-thalassemia and the analyses of results of transplantation in patients less then 16 years old have allowed us to identify three classes of risk using the criteria of degree of hepatomegaly, the degree of portal fibrosis and the quality of the chelation treatment given before the transplant. Patients for whom all three criteria were adverse constituted class 3, patients with none of the adverse criteria constituted class one and patients with one or various association of the adverse criteria formed Class 2. Most patients older than 16 years have disease characteristics that place them in class 3 with very few in class 2. For all the patients with an HLA identical donor we are actually using two Protocols for BMT to whom the patients are assigned on the base of the class they belong to at the time of BMT and independently on the age of the patient. For class 1, class 2 and for class 3 the probabilities of survival and of event-free-survival are respectively of 98% and 94%, 87% and 84%, 100% and 67%. For those patients that were older than 16 years at the time of the transplant, the probabilities of survival are 82% and the probabilities of event-free survival are 79%.
lass 1, class 2 and for class 3 the probabilities of survival and of event-free-survival are respectively of 98% and 94%, 87% and 84%, 100% and 67%. For those patients that were older than 16 years at the time of the transplant, the probabilities of survival are 82% and the probabilities of event-free survival are 79%. Bone marrow transplantation is a new form of radical treatment of thalassemia in those patients with an HLA identical donor. Key words Bone marrow transplantation (BMT)HepatomegalyPortal Fibrosisissue-copyright-statement© Dr. K C Chaudhuri Foundation 1993
The authors describe a case of severe pandemic influenza A(H1N1) 2009 pneumonia in a boy, who recovered dramatically after the use of Airway Pressure Release Ventilation (APRV). His cytokines levels in pulmonary secretions were extremely high, on the other hand, serum cytokines were within normal range.
The authors describe a case of severe pandemic influenza A(H1N1) 2009 pneumonia in a boy, who recovered dramatically after the use of Airway Pressure Release Ventilation (APRV). His cytokines levels in pulmonary secretions were extremely high, on the other hand, serum cytokines were within normal range. Case Report An eight-yr-old boy with normal development was admitted because of dyspnea. On Oct 25, 2009, he complained of a sore throat and cough with mild fever appearing the next day, and 2 days later he had a fever of 38.3°C, and developed dyspnea and respiratory distress rapidly (SpO2 79% in room air). At that time influenza rapid antigen test was negative. On admission, he was in a state of stupor. Breath sounds revealed wheezing and breathing was decreased with marked retractive breathing. His chest radiograph showed mild infiltration. Combined treatment with beta-stimulant, methylprednisolone, aminophylline and antibiotics was started, and his condition improved slightly. However, later on his distress became progressive and his saturation fell to less than 90%. He was intubated and controlled under mechanical ventilation. Under the condition of SIMV (PIP/PEEP 37/16 RR 35 FiO2 0.80), his SpO2 showed values from 80 to 96% (Atrial showed pH 7.305, pCO2 46, pO2 70) and oxygenic disturbance and metabolic acidosis appeared. P/F ratio was 87 which was compatible for diagnosis of ARDS. Oseltamivir (double quantity) through NG tube was started since flu rapid test revealed A positive, which was confirmed to be pandemic influenza A(H1N1) 2009 by PCR later. He needed frequent recruitment and mediastinal and cutaneous emphysema appeared. On the next day, the authors introduced APRV into an open lung purpose. After APRV introduction (P high 25 cmH2O, T high 6 s, P low 0 cmH2O, T low 0.6 s), oxygenation improved dramatically (P/F ratio;200–400, Oxygen Index;10 (before 19) under FiO2 0.5) and retractive breathing disappeared with spontaneous breath. On 29th October 2009, P/F ratio and Oxygen Index were 421 and 5, respectively with FiO2 0.35 and P high 21 cmH2O. On the following day, the authors changed the mode from APRV to SIMV, and extubation was done (Fig. 1). His general condition recovered day by day and all medications were tapered gradually. On 5th November 2009, his chest radiograph and respiratory function test were normal. RAST revealed positive against mite, dog, cat and cedar.
ing day, the authors changed the mode from APRV to SIMV, and extubation was done (Fig. 1). His general condition recovered day by day and all medications were tapered gradually. On 5th November 2009, his chest radiograph and respiratory function test were normal. RAST revealed positive against mite, dog, cat and cedar. The authors assayed 17 cytokines in serum, nasopharyngeal aspirates (NPS) and pulmonary secretions (Fig. 2). The levels of IL-8, MIP-1beta and MCP-1b were extremely high in the pulmonary secretions and NPS. IL-6, G-CSF, IFN-γ and TNF-α were high with low amounts in pulmonary secretions. However, all 17 cytokines in serum were almost normal. Fig. 1 The fluctuation of respiratory markers Fig. 2 Cytokine profiles from serum, nasopharyngeal aspirates (NPS) and pulmonary secretions
The authors assayed 17 cytokines in serum, nasopharyngeal aspirates (NPS) and pulmonary secretions (Fig. 2). The levels of IL-8, MIP-1beta and MCP-1b were extremely high in the pulmonary secretions and NPS. IL-6, G-CSF, IFN-γ and TNF-α were high with low amounts in pulmonary secretions. However, all 17 cytokines in serum were almost normal. Fig. 1 The fluctuation of respiratory markers Fig. 2 Cytokine profiles from serum, nasopharyngeal aspirates (NPS) and pulmonary secretions Discussion Novel pandemic influenza A(H1N1) 2009 caused an epidemic of critical illness and some patients developed severe ARDS rapidly. A study group in Australia recommended extracorporeal membrane oxygenation (ECMO). They treated 68 patients with ECMO in intensive care units, and reported that 14 patients (21%) had died and 6 remained in the ICU, 2 of whom were still receiving ECMO [1]. Martin E Lum et al., also reported that the observed rate of hospital admissions for pandemic (H1N1) was broadly consistent with 0.3% of infected patients. Transfers to ICUs occurred at a rate of 20% of hospital admissions and mechanical ventilation was required by 72% of patients admitted to ICUs, and ECMO was used in 7% [2]. They suggested that ECMO emerged as an important treatment modality [1–3]. In this report the child recovered by using APRV mode without any invasive procedure.
ICUs occurred at a rate of 20% of hospital admissions and mechanical ventilation was required by 72% of patients admitted to ICUs, and ECMO was used in 7% [2]. They suggested that ECMO emerged as an important treatment modality [1–3]. In this report the child recovered by using APRV mode without any invasive procedure. APRV is a relatively new mode of mechanical ventilation (MV), which is a time-triggered, time-cycled, pressure-limited mode where a high level of CPAP is maintained with brief regular releases, and spontaneous breathing is allowed throughout the cycle. The use of this mode in pediatrics has been very limited. In seven cases aged 1 to 16 years with sepsis and deteriorating pulmonary status, their oxygenation improved except for one [4]. Schultz TR. et al., also reported the efficacy of APRV especially at significantly lower inspiratory peak and plateau pressures [5]. It is consistent with a lung protective approach while having some hypothetical advantages over APRV. It uses a release of airway pressure from an elevated baseline to stimulate expiration. The elevated baseline facilitates oxygenation, and the timed releases aid in carbon dioxide removal. Advantages of APRV include, lower minute ventilation, minimal adverse effects on cardio-circulatory function, ability to spontaneously breathe throughout the ventilatory cycle, decreased sedation use, and near elimination of neuromuscular blockade [6].
oxygenation, and the timed releases aid in carbon dioxide removal. Advantages of APRV include, lower minute ventilation, minimal adverse effects on cardio-circulatory function, ability to spontaneously breathe throughout the ventilatory cycle, decreased sedation use, and near elimination of neuromuscular blockade [6]. Shunting due to an alveolar collapse and reduction in functional residual capacity mainly causes hypoxemia associated with acute lung injury. In order to promote the recruitment of alveoli and the prevention of derecruitment, sustained plateau pressure by APRV mode is variable. The advantage of APRV is that it decreases the controlled mean airway pressure and uses spontaneous breath. Spontaneous breathing has physiologic advantages over assisted positive pressure breaths during mechanical ventilation, concerning V/Q matching in distribution of the entire lung.
essure by APRV mode is variable. The advantage of APRV is that it decreases the controlled mean airway pressure and uses spontaneous breath. Spontaneous breathing has physiologic advantages over assisted positive pressure breaths during mechanical ventilation, concerning V/Q matching in distribution of the entire lung. Mauad T et al., investigated the autopsy of 21 Brazilian patients who died with acute respiratory failure. Diffuse alveolar damage was present in 20 individuals including necrotizing bronchiolitis in six patients. There was marked expression of TLR-3 and IFN-γ and a large number of CD8+ T cells within the lung tissue [7]. The present data of cytokines in pulmonary secretions revealed extremely high levels of Il-8, MCP-1 and MIP-1b. On the other hand, other cytokines were normal or slightly increased. The authors suspected that chemokines play a role mostly in lung injury associated pandemic influenza A(H1N1) 2009 infection. High levels of chemokines and following epitherial change will increase the permeability in alveoli and fibrin leak out in interstitial tissue. APRV might work to prevent the reduction of the intrapulmonary shunt. Anti-virus drugs, steroids and selective neutrophil elastase inhibitor might be effective theologically through diminishing high cytokines. This work is not supported by any grand. There is no conflict with any employment. The case family in this manuscript agreed to this publication and we obtained their informed consent. Conflict of Interest None. Role of Funding Source None.
Introduction Dengue fever is the most rapidly spreading mosquito borne viral disease worldwide with an estimated 30-fold increase in incidence over last five decades [1]. With rising disease burden, atypical manifestations are also on rise, but are underreported and often missed due to the lack of awareness among health care personnels. These include neurological, hepatic, renal, cardiovascular and other isolated organ involvement and termed as Expanded dengue syndrome/unusual or atypical manifestations of dengue fever as per the revised 2011 guidelines of dengue fever and are often life threatening with very high case fatality rate [1]. Atypical manifestations could be explained as complications of severe profound shock, associated underlying host conditions, diseases and co-infections [2, 3]. They might resemble co-infections like enteric fever and malaria thereby making the clinical decision more difficult and mislead the physician’s initial impression. There is limited literature describing atypical manifestations of dengue fever in children. In this communication, the authors describe the atypical manifestations in pediatric in-patients with serologically confirmed dengue virus infection.
inical decision more difficult and mislead the physician’s initial impression. There is limited literature describing atypical manifestations of dengue fever in children. In this communication, the authors describe the atypical manifestations in pediatric in-patients with serologically confirmed dengue virus infection. Material and Methods After approval by the Institute Ethics committee, case records of all children (0–12 y of age) diagnosed and confirmed as dengue fever at a tertiary care hospital at Puducherry between the 1st August 2012 and January 31st 2015 were reviewed retrospectively from the hospital case records. Data was entered in a structured proforma. The case definition, diagnosis and management used for dengue fever, severe dengue and atypical manifestations were as per the revised World Health Organization (WHO) guidelines 2011. The diagnosis was confirmed by NS1antigen-based ELISA test (J. Mitra kit, India) or dengue serology for IgM and IgG antibodies (Kit from National Vector Born Disease Control Programme, Pondicherry and National Institute of Virology, Pune, India). All other relevant and other additional investigations were done as per the clinical course of illness.
NS1antigen-based ELISA test (J. Mitra kit, India) or dengue serology for IgM and IgG antibodies (Kit from National Vector Born Disease Control Programme, Pondicherry and National Institute of Virology, Pune, India). All other relevant and other additional investigations were done as per the clinical course of illness. The SPSS 16.0 statistical software was used for data analysis. Categorical variables were expressed as frequencies and percentages, and then analyzed by the χ2 test or fishers exact test, where appropriate. Continuous data, expressed as mean ± SD, or median (range), were analyzed using students t-test, analysis of variance (ANOVA-1 way) or Mann-Whitney U test. Odds ratio (OR) with 95 % confidence interval (CI) was calculated to measure the degree of association of warning signs with severe dengue infection. Significance was taken at P value <0.05. Results Out of 254 children admitted with dengue fever, non-severe dengue and severe dengue were seen in 62.6 % and 37.4 % respectively. Atypical manifestations were seen in 106 cases (41.7 %) and among them severe complications with multiorgan involvement were seen in 16 cases (6.3 %). The most common affected age group was 6–12 y (58.2 %) and the mean age of presentation was 6.9(3.3) y. Male to female ratio was 1.2:1. Most cases were from Pondicherry and its neighboring states.
e seen in 106 cases (41.7 %) and among them severe complications with multiorgan involvement were seen in 16 cases (6.3 %). The most common affected age group was 6–12 y (58.2 %) and the mean age of presentation was 6.9(3.3) y. Male to female ratio was 1.2:1. Most cases were from Pondicherry and its neighboring states. Fever duration of <7d was present in 185 cases (72.8 %), > 7 d in 23 cases (9 %) and biphasic fever in 46 cases (18.1 %). The most common clinical warning signs at admission were persistent vomiting (77.1 %), liver enlargement (62.9 %), cold and calmy extremities (42.5 %), pain abdomen (31.8 %), hypotension (31.4 %), restlessness (27.1 %), giddiness (23.6 %), bleeding (20.1 %), oliguria (12.9 %), lethargy (6.3 %), pleural effusion (5.1 %), and impaired consciousness with Glasgow coma scale (GCS) < 8(1.9 %). The most common manifestations of severe dengue infection were shock (37.4 %), bleeding (20.1 %) and multiorgan failure (2.3 %). Ninety five children with severe dengue (78.8 %) had compensated shock and only 32.3 % of them had bleeding. Atypical manifestations were seen in 106 (41.7 %) children (Table 1).Table 1 Atypical manifestation of dengue fever
severe dengue infection were shock (37.4 %), bleeding (20.1 %) and multiorgan failure (2.3 %). Ninety five children with severe dengue (78.8 %) had compensated shock and only 32.3 % of them had bleeding. Atypical manifestations were seen in 106 (41.7 %) children (Table 1).Table 1 Atypical manifestation of dengue fever Atypical manifestations Number (%) Seizures 17 (6.7) Encephalopathy 7 (2.7) Intracranial hemorrhage 2 (0.8) Hepatitis 29 (11.4) Fulminant hepatic failure 2 (0.8) Acalculous cholecystitis 2 (0.8) Acute pancreatitis 1 (0.4) Acute parotitis 2 (0.8) Acute kidney injury 6 (2.4) Myocarditis 5 (1.9) Pericardial effusion 3 (1.2) Paroxysmal supraventricular tachycardia 3 (1.2) Sinus bradycardia 2 (0.8) Lymphadenopathy 106 (41.7) Appendicitis 2 (0.8) Pulmonary hemorrhage 4 (1.6) Acute respiratory distress syndrome 4 (1.6) Pleural effusion 13 (5.1) Ascites 18 (7.0) Pneumonia 31 (12.2) Hemophagocytic syndrome 2 (0.8) Splenomegaly 54 (21.2) Refractory shock 6 (2.4) Biphasic fever 46 (18.1) Febrile diarrhea 16 (6.3) Myositis 3 (1.2) Disseminated intravascular coagulopathy 4 (1.6) Co-infection 19 (7.5) Data as Number (%) Neurological manifestations were seen in 28 children (11 %) and among them impaired consciousness at admission (GCS < 8) was seen in 7 cases, seizures in 17 children, two children had intracranial hemorrhage, aseptic meningitis in 2 cases and one child had pyogenic meningitis.
Atypical manifestations Number (%) Seizures 17 (6.7) Encephalopathy 7 (2.7) Intracranial hemorrhage 2 (0.8) Hepatitis 29 (11.4) Fulminant hepatic failure 2 (0.8) Acalculous cholecystitis 2 (0.8) Acute pancreatitis 1 (0.4) Acute parotitis 2 (0.8) Acute kidney injury 6 (2.4) Myocarditis 5 (1.9) Pericardial effusion 3 (1.2) Paroxysmal supraventricular tachycardia 3 (1.2) Sinus bradycardia 2 (0.8) Lymphadenopathy 106 (41.7) Appendicitis 2 (0.8) Pulmonary hemorrhage 4 (1.6) Acute respiratory distress syndrome 4 (1.6) Pleural effusion 13 (5.1) Ascites 18 (7.0) Pneumonia 31 (12.2) Hemophagocytic syndrome 2 (0.8) Splenomegaly 54 (21.2) Refractory shock 6 (2.4) Biphasic fever 46 (18.1) Febrile diarrhea 16 (6.3) Myositis 3 (1.2) Disseminated intravascular coagulopathy 4 (1.6) Co-infection 19 (7.5) Data as Number (%) Neurological manifestations were seen in 28 children (11 %) and among them impaired consciousness at admission (GCS < 8) was seen in 7 cases, seizures in 17 children, two children had intracranial hemorrhage, aseptic meningitis in 2 cases and one child had pyogenic meningitis. Hepatic dysfunction was seen in 29 children (11.4 %) and among them 16 children had features of shock. Fulminant hepatic failure was present in two cases. Two children had acalculous cholecystitis, two children had appendicitis, one child presented as acute pancreatitis and two children had portal hypertension.
Neurological manifestations were seen in 28 children (11 %) and among them impaired consciousness at admission (GCS < 8) was seen in 7 cases, seizures in 17 children, two children had intracranial hemorrhage, aseptic meningitis in 2 cases and one child had pyogenic meningitis. Hepatic dysfunction was seen in 29 children (11.4 %) and among them 16 children had features of shock. Fulminant hepatic failure was present in two cases. Two children had acalculous cholecystitis, two children had appendicitis, one child presented as acute pancreatitis and two children had portal hypertension. The cardiovascular complication encountered was compensated shock and was present in 95 cases (37.4 %), decompensated shock was present in 16 cases (6.3 %) and fluid refractory shock in 6 children (2.4 %). Five children had myocarditis and among them global hypokinesia was seen in 3 children and diastolic dysfunction was seen in 2 children and received inotropic support. Three children had mild pericardial effusion without tamponade. Repeat echocardiographic evaluation at the time of discharge was normal in all the cases. Among conduction abnormality of the heart, sinus bradycardia was seen in two children and paroxysmal supraventricular tachycardia was seen in 3 children. One child had fluid refractory shock with unstable supraventricular tachycardia (SVT) which reverted with adenosine and the patient’s circulatory status normalized. Among sixteen children who had decompensated shock, six children developed fluid refractory shock not responding to crystalloid and colloids and received inotropic support. Apart from shock, third spacing were seen in the form of pleural effusion in 13 cases (50.4 %), ascites in 18(46.7 %) cases, and anasarca in 3 cases (1.2 %). The common respiratory complications like pneumonia was seen in 31 cases (12.2 %) and ARDS were seen in 4 cases (2.4 %). Acute kidney injury was seen 6 children with oligo-anuria and a mean creatinine value of 2.1 ± 0.6 mg/dl, and among them two children required peritoneal dialysis.
s, and anasarca in 3 cases (1.2 %). The common respiratory complications like pneumonia was seen in 31 cases (12.2 %) and ARDS were seen in 4 cases (2.4 %). Acute kidney injury was seen 6 children with oligo-anuria and a mean creatinine value of 2.1 ± 0.6 mg/dl, and among them two children required peritoneal dialysis. Spontaneous bleeding was present in 51 cases (20.1 %) and melena was the most common form of spontaneous bleeding. Tourniquet test was positive in 33 cases (12.9 %). Disseminated intravascular coagulopathy was seen in 4 children. The other atypical manifestations seen were febrile diarrhea, biphasic fever, splenomegaly, generalized lymphadenopathy, hemophagocytic syndrome, myositis, and parotitis (Table 1). Co-infections were present in 19 cases (10 children had enteric fever, four had malaria, 4 had urinary tract infection and one had bacterial meningitis).
ical manifestations seen were febrile diarrhea, biphasic fever, splenomegaly, generalized lymphadenopathy, hemophagocytic syndrome, myositis, and parotitis (Table 1). Co-infections were present in 19 cases (10 children had enteric fever, four had malaria, 4 had urinary tract infection and one had bacterial meningitis). The hematological parameters showed anemia (30.3 %), leukopenia (19.7 %) and thrombocytopenia in 204(80.3 %) cases (Table 2). Severe thrombocytopenia was seen in 43 cases (16.9 %), hemoconcentration in 47.6 % of cases and the mean haematocrit was 38.9(4.4). NS1 antigen was positive in 214 cases (84.2 %) and dengue IgG antibody was positive in 40 cases (15.7 %). Disordered coagulation (prolongation of the prothrombin and/or activated partial thromboplastin time) was seen in 13 children (5.1 %). Altered liver enzymes were seen in 11.4 % of cases. Ultrasonography of abdomen was done in 105 children with severe dengue, and it was abnormal in 30 cases (16 hypoechoic hepatic parenchyma, 18 with ascites, 13 with pleural effusion, 25 with peri-gallbladder edema with wall thickening, 2 having cholelithiasis in addition, and 2 showing portal cavernoma with portal vein thrombosis). The CSF was abnormal in three patients, 2 of whom had raised protein and lymphocytic pleocytosis and one child showed evidence of bacterial meningitis. CT scan showed intracranial bleed in 2 children.Table 2 Laboratory parameters in dengue fever
in addition, and 2 showing portal cavernoma with portal vein thrombosis). The CSF was abnormal in three patients, 2 of whom had raised protein and lymphocytic pleocytosis and one child showed evidence of bacterial meningitis. CT scan showed intracranial bleed in 2 children.Table 2 Laboratory parameters in dengue fever Laboratory parameters Number (%) Anemia (Hemoglobin <10 g/dl) 77 (30.3) Leukopenia (TLC < 4000/mm3) 50 (19.7) Thrombocytopenia (< 1,50,000/mm3) 204 (80.3) PLC < 50,000/mm3 43 (16.9) PLC < 20,000/mm3 12 (4.7) Hemoconcentration (HCT > 40) 121 (47.6) Prothrombin time (PT/INR > 1.0) 9 (3.5) APTT (> 1.5 times normal) 4 (1.6) Abnormal LFT (SGOT & SGPT >150 IU) 29 (11.4) Deranged RFT (Serum creatinine >3 mg/dl) 6 (2.4) Hypoalbuminemia (serum albumin <3 g/dl) 19 (7.5) Hypocalcemia (serum calcium <9 mg/dl) 22 (8.6) Hyponatremia (Sodium <130 Meq/L) 14 (5.5) Gall bladder wall edema on USG 25 (9.8) NS1 antigen positive 214 (84.2) NS1 antigen -ve and IgM positive 40 (15.7) Dengue IgM positive 140 (55.1) Dengue IgG antibody 40 (15.7) PLC Platelet count; APTT Activated partial thromboplastin time.
Laboratory parameters Number (%) Anemia (Hemoglobin <10 g/dl) 77 (30.3) Leukopenia (TLC < 4000/mm3) 50 (19.7) Thrombocytopenia (< 1,50,000/mm3) 204 (80.3) PLC < 50,000/mm3 43 (16.9) PLC < 20,000/mm3 12 (4.7) Hemoconcentration (HCT > 40) 121 (47.6) Prothrombin time (PT/INR > 1.0) 9 (3.5) APTT (> 1.5 times normal) 4 (1.6) Abnormal LFT (SGOT & SGPT >150 IU) 29 (11.4) Deranged RFT (Serum creatinine >3 mg/dl) 6 (2.4) Hypoalbuminemia (serum albumin <3 g/dl) 19 (7.5) Hypocalcemia (serum calcium <9 mg/dl) 22 (8.6) Hyponatremia (Sodium <130 Meq/L) 14 (5.5) Gall bladder wall edema on USG 25 (9.8) NS1 antigen positive 214 (84.2) NS1 antigen -ve and IgM positive 40 (15.7) Dengue IgM positive 140 (55.1) Dengue IgG antibody 40 (15.7) PLC Platelet count; APTT Activated partial thromboplastin time. Figure 1 shows relationship between thrombocytopenia, bleeding and platelet transfusion. 78.4 % of children with spontaneous bleeding had thrombocytopenia and among them 27.5 % had features of shock. Bleeding manifestation was observed in 75 % and 32.2 % children with platelet counts of <20,000 and 20,000–50,000/mm3 respectively. 23.9 % of cases with normal platelet count had bleeding and did not require platelet transfusion. Only 17 children (6.7 %) required platelet transfusions and out of them, 70.5 % had a platelet count <20,000/mm3 whereas 29.5 % had platelet count in the range of 20,000–50,000/mm3. Only those children with significant spontaneous bleed or shock or with severe thrombocytopenia necessitated platelet transfusion.Fig. 1 Relationship between thrombocytopenia, bleeding and platelet transfusion
, 70.5 % had a platelet count <20,000/mm3 whereas 29.5 % had platelet count in the range of 20,000–50,000/mm3. Only those children with significant spontaneous bleed or shock or with severe thrombocytopenia necessitated platelet transfusion.Fig. 1 Relationship between thrombocytopenia, bleeding and platelet transfusion Ninety six children (37.7 %) required intravenous fluids and blood component therapy was used in 12.9 % cases. Seventeen children (6.3 %) required platelet transfusion, 6 children (2.3 %) required fresh frozen plasma, 10 children (3.9 %) required packed cell transfusion, 3 cases required colloids (1.1 %) and the requirement was more in severe dengue infection. Though not indicated as per WHO guidelines, all patients with count less than 20,000 received platelet transfusion while 16.1 % of patients between 20,000–50,000/mm3 were transfused due to bleeding manifestations. However, platelets were not transfused with platelet counts >50,000/mm3 even in the presence of bleeding. Ten children required ionotropic support and mechanical ventilation. The warning signs which were commonly associated with expanded dengue syndrome were prolonged shock, bleeding, pain abdomen, lack of clinical improvement post defervescence, impaired consciousness, lethargy, restlessness and severe thrombocytopenia (Fig. 2).Fig. 2 Warning signs associated with expanded dengue syndrome
Ninety six children (37.7 %) required intravenous fluids and blood component therapy was used in 12.9 % cases. Seventeen children (6.3 %) required platelet transfusion, 6 children (2.3 %) required fresh frozen plasma, 10 children (3.9 %) required packed cell transfusion, 3 cases required colloids (1.1 %) and the requirement was more in severe dengue infection. Though not indicated as per WHO guidelines, all patients with count less than 20,000 received platelet transfusion while 16.1 % of patients between 20,000–50,000/mm3 were transfused due to bleeding manifestations. However, platelets were not transfused with platelet counts >50,000/mm3 even in the presence of bleeding. Ten children required ionotropic support and mechanical ventilation. The warning signs which were commonly associated with expanded dengue syndrome were prolonged shock, bleeding, pain abdomen, lack of clinical improvement post defervescence, impaired consciousness, lethargy, restlessness and severe thrombocytopenia (Fig. 2).Fig. 2 Warning signs associated with expanded dengue syndrome There were six deaths (2.4 %) and out of them four presented with impaired consciousness (66.6 %) at admission with GCS < 8. The common causes for poor outcome were multiorgan failure, encephalopathy and refractory shock. The mean duration of hospital stay was 8.1(2.3) d and the mean time to death was 2.7(2.3) d. The average period of recovery was longer in patients with severe dengue infection with atypical manifestations and required more supportive therapy.
or poor outcome were multiorgan failure, encephalopathy and refractory shock. The mean duration of hospital stay was 8.1(2.3) d and the mean time to death was 2.7(2.3) d. The average period of recovery was longer in patients with severe dengue infection with atypical manifestations and required more supportive therapy. Discussion The most common atypical gastrointestinal presentations of dengue fever in the index study were hepatitis, fulminant hepatic failure, portal hypertension, acalculous cholecystis, appendicitis, acute pancreatitis, acute parotitis and febrile diarrhea. Hepatitis was present in 11.4 % of cases and among them two children developed fulminant hepatic failure. The etiology of hepatic dysfunction in dengue fever is usually due to direct cytopathic injury, unregulated host immune response, active viral replication, and hypoxia and tissue ischemia due to prolonged shock, hemorrhage and metabolic acidosis [2, 4–6]. Acute pancreatitis is a rare complication of dengue fever due to possible direct cytopathic effect of virus or an autoimmune response by molecular mimicry causing pancreatic outflow obstruction by resulting edema and ultrasound abdomen is characterized by enlarged pancreas and elevated serum amylase and lipase levels [7]. A child presented to the authors' hospital with severe dengue with features of acute pancreatitis and responded to symptomatic treatment.
cular mimicry causing pancreatic outflow obstruction by resulting edema and ultrasound abdomen is characterized by enlarged pancreas and elevated serum amylase and lipase levels [7]. A child presented to the authors' hospital with severe dengue with features of acute pancreatitis and responded to symptomatic treatment. Acute acalculous cholecystitis is equally rare in dengue fever. The main pathophysiological changes in dengue fever could be due to increased vascular permeability causing plasma leakage and serous effusion with high protein content which causes thickening of gall bladder wall [8]. The course of the disease is usually self-limiting and gall bladder wall thickness usually returns to normal with supportive care in majority of cases, even though isolated cases of gangrene and perforated gall bladder with peritonitis has been reported and surgical intervention is reserved only for children who have evidence of gangrene, perforation and diffuse peritonitis [2]. Gall bladder wall edema on ultrasound was a common associated finding of severe dengue in the index study similar to the previous studies [9]. Acute acalculous cholecystitis was seen in two children who improved symptomatically and were discharged.
who have evidence of gangrene, perforation and diffuse peritonitis [2]. Gall bladder wall edema on ultrasound was a common associated finding of severe dengue in the index study similar to the previous studies [9]. Acute acalculous cholecystitis was seen in two children who improved symptomatically and were discharged. In this study, febrile diarrhea was seen in 6.3 % cases with severe dengue which is unusual and very few cases have been reported [10]. Bilateral parotid enlargement was present in 2 children in the index study while only one case has been reported in the past [2]. Acute appendicitis was seen in two cases with severe dengue which created a dilemma for surgeons but responded to conservative management, with very few cases being reported in the past [11].
ilateral parotid enlargement was present in 2 children in the index study while only one case has been reported in the past [2]. Acute appendicitis was seen in two cases with severe dengue which created a dilemma for surgeons but responded to conservative management, with very few cases being reported in the past [11]. Neurological manifestations of severe dengue include seizures, encephalopathy, meningitis, Gullian Barre syndrome, acute disseminated encephalomyelitis and transverse myelitis. It may occur because of factors like direct tissue invasion of virus (neurotropicity), cytokine mediated damage to the blood brain barrier, cerebral edema, intracranial hemorrhage, and secondary to cerebral hypoperfusion due to prolonged shock, renal failure, hepatic dysfunction and metabolic derangements like hyponatremia and hypoglycemia [2, 12]. The neurological manifestations of dengue fever were first described in 1976 [13, 14]. Pancharoen and Thisyakorn, in their study, reported altered sensorium as the most common neurological finding followed by seizures and observed these findings in 75 % of patients with dengue shock syndrome [15]. Rigau-Perez et al. and similar previous studies have reported a high proportion of impaired consciousness at presentation and during disease progression with multi-organ involvement and high mortality [16]. Dengue encephalopathy has been reported to occur in 0.5–17 % patients with dengue [17–19]. In this study, impaired consciousness and seizures at admission were seen in six patients and among them there were four deaths (66 %); all had features of refractory shock and multiorgan failure, the most omnious sign for mortality with severe dengue.
as been reported to occur in 0.5–17 % patients with dengue [17–19]. In this study, impaired consciousness and seizures at admission were seen in six patients and among them there were four deaths (66 %); all had features of refractory shock and multiorgan failure, the most omnious sign for mortality with severe dengue. The cardiac manifestations of dengue fever in the index study were myocarditis, paroxysmal supraventricular tachycardia, sinus bradycardia, pericardial effusion and ectopic ventricular beats. Majority of the patients had a spontaneous resolution and received symptomatic supportive treatment. The association of cardiac rhythm disturbances in dengue fever have been reportedly attributed to viral myocarditis during episodes of dengue hemorrhagic fever [20–22]. Pericardial involvement has also been attributed to dengue infection along with myocarditis [23]. Acute respiratory distress syndrome (ARDS) is one of the unusual and fatal complications of severe dengue infection. It is usually secondary to increased alveolar-capillary membrane permeability leading to interstitial and alveolar edema which leads to pulmonary dysfunction and is associated with high mortality rate [24]. Pulmonary hemorrhage with disseminated intravascular coagulopathy (DIC) is another fatal and unusual complication in severe dengue infection [25]. In the index study four children developed acute respiratory distress syndrome and pulmonary hemorrhage and had poor outcome as described in the previous studies [26].
[24]. Pulmonary hemorrhage with disseminated intravascular coagulopathy (DIC) is another fatal and unusual complication in severe dengue infection [25]. In the index study four children developed acute respiratory distress syndrome and pulmonary hemorrhage and had poor outcome as described in the previous studies [26]. Acute kidney injury was present in six cases in the present study. It is an unusual manifestation of dengue fever and mainly presents as shock induced acute tubular necrosis apart from other rare causes like multi-organ dysfunction and rhabdomyolysis. The role of immune complex in development of renal failure in dengue infection is still unclear [2, 27]. Although hepatomegaly is among the WHO clinical criteria for dengue fever, splenomegaly and lymphadenopathy are not generally held to be a feature of dengue infection [1]. In the index study there was higher percentage of splenomegaly and lymphadenopathy compared to the previous studies [28]. Splenomegaly and lymphadenopathy signified the occurrence of dengue virus antigen in the lymphoreticular cells. Hemophagocytic syndrome is an unusual manifestation of dengue fever which was present in two cases with very few cases reported in the past [29].
aly and lymphadenopathy compared to the previous studies [28]. Splenomegaly and lymphadenopathy signified the occurrence of dengue virus antigen in the lymphoreticular cells. Hemophagocytic syndrome is an unusual manifestation of dengue fever which was present in two cases with very few cases reported in the past [29]. Although myalgia is a common manifestation of dengue fever, myositis is unusual. The probable mechanism for myositis is the release of myotoxic cytokines, particularly tumor necrosis factor (TNF-alfa) thereby injuring the affected muscle [30]. These patients need to be detected promptly as there is a risk of progressing to renal failure if not identified in time [31]. In children presenting with myositis, dengue fever should be considered as an important differential diagnosis. In the present study secondary infection was less than primary infection, but it was commonly associated with severe dengue. Wichmann et al. in their study showed that secondary infection was significantly associated with severe dengue in children. During secondary infection, T-cells become activated due to interactions with infected monocytes which induce plasma leakage by release of cascade of cytokines such as interferon-gamma, IL-2, and TNF-alfa [32]. Co-infections were seen in 17.4 % cases and it is important that they be promptly recognized. Co-infections can modify the clinical presentation of dengue and result in missed or delayed diagnosis and treatment of dengue shock. Co-existence of malaria and dengue have been reported to be in the range of 20 % to as high as 80 % [2, 3, 33].
seen in 17.4 % cases and it is important that they be promptly recognized. Co-infections can modify the clinical presentation of dengue and result in missed or delayed diagnosis and treatment of dengue shock. Co-existence of malaria and dengue have been reported to be in the range of 20 % to as high as 80 % [2, 3, 33]. In the index study thrombocytopenia, bleeding and plasma leakage did not always correlate. Since majority of the cases were dengue fever with peripheral circulatory failure without bleeding, alternate case definitions used were Dengue fever associated with shock without bleeding (DSAS) and Dengue fever with bleeding without shock (DFB) and authors' experience suggests a need for revision of the existing case definitions [1]. Another unique observation was that majority of the cases of severe dengue presented with compensated shock without bleeding and responded to fluid therapy and only 6.3 % developed complications. The most probable reasons being early detection of cases, availability of quick early diagnostic test like NS1 antigen detection, and timely hospitalization and increased awareness among the public. The bleeding manifestations also did not correlate well with platelet counts, and occurred in children with even normal platelet counts and platelet transfusion was given in children with severe dengue with severe thrombocytopenia. Coagulation profile was deranged in 13 cases (5.1 %) signifying the fact that factors other than thrombocytopenia like platelet dysfunction, consumption coagulopathy and endothelial dysfunction are responsible for bleeding in dengue fever [34].
sion was given in children with severe dengue with severe thrombocytopenia. Coagulation profile was deranged in 13 cases (5.1 %) signifying the fact that factors other than thrombocytopenia like platelet dysfunction, consumption coagulopathy and endothelial dysfunction are responsible for bleeding in dengue fever [34]. The most common factors for atypical manifestations with complications were prolonged shock, bleeding, pain abdomen, lack of clinical improvement post defervescence, impaired consciousness, lethargy, restlessness and severe thrombocytopenia. Conclusions Atypical manifestations of dengue fever are more common than actually reported. However, the awareness is lacking among the health care personnels especially at primary health centers from where these cases are often referred. There is a need to update the health care personnels and community at various forums, about the various atypical manifestations of dengue for prompt recognition and management. Impaired consciousness at the time of admission should be considered as the most omnious atypical manifestation of severe dengue infection. The authors would like to thank Dr. Vijayalalakshmi Sivapurapu, intensivist for giving critical input to the manuscript.
Conclusions Atypical manifestations of dengue fever are more common than actually reported. However, the awareness is lacking among the health care personnels especially at primary health centers from where these cases are often referred. There is a need to update the health care personnels and community at various forums, about the various atypical manifestations of dengue for prompt recognition and management. Impaired consciousness at the time of admission should be considered as the most omnious atypical manifestation of severe dengue infection. The authors would like to thank Dr. Vijayalalakshmi Sivapurapu, intensivist for giving critical input to the manuscript. Contributions SP was involved in doing the study, data collection and analysis, literature search, analyzing and drafting the manuscript. MT was involved in data analysis, statistical analysis and drafting the manuscript. BK was involved in data collection, analysis, literature search and drafting of the manuscript. SP was involved in critical review and finalizing the manuscript and will act as the guarantor of the paper. Conflict of Interest None. Source of Funding None.
Indian J Pediatr Indian J Pediatr Indian Journal of Pediatrics 0019-5456 0973-7693 Springer India New Delhi 15280607 BF02724117 10.1007/BF02724117 Original Article Demographic profile and outcome analysis of a tertiary level pediatric intensive care unit Khilnani Praveen 26490911pkhilnani@vsnl.com 1 Sarma Devajit 1 Singh Reeta 1 Uttam Rajiv 1 Rajdev Shiv 1 Makkar Archana 1 Kaur Jyotinder 1 1 Apollo Center for Advanced Pediatrics, I P Apollo Hospital, New Delhi, India 2 B42, Panchsheel Enclave, 110017 New Delhi, 2004 71 7 587 591 © Department of Pediatrics All India Institute Of Medical Science 2004This article is made available via the PMC Open Access Subset for unrestricted research re-use and secondary analysis in any form or by any means with acknowledgement of the original source. These permissions are granted for the duration of the World Health Organization (WHO) declaration of COVID-19 as a global pandemic.Objective : To study the profile and outcome of children admitted to a tertiary level pediatric intensive care unit (PICU) in India.Methods : Prospective study of patient demographics, PRISM III scores, diagnoses, treatment, morbidity and mortality of all PICU admissions.Results : 948 children were admitted to the PICU. Mean age was 41.48 months. Male to female ratio was 2.95:1. Mean PRISM III score on admission was 18.50. Diagnoses included respiratory (19.7%), cardiac (9.7%), neurological (17.9%), infectious (12.5%), trauma (11.7%), other surgical (8.8%).196 children (20.68%) required mechanical ventilation. Average duration of ventilation was 6.39 days. 27 children (30.7 children /1000 admissions) had acute respiratory distress syndrome. Gross mortality was 6.7% (59 patients). PRISMIII adjusted mortality was directly proportional to PRISMIII scores. 49.5% of nonsurvivors had multiorgan failure. Average length of PICU stay was 4.52 +/−2.6 days. Complications commonly encountered Were atelectasis (6.37%), accidental extubation (2%), and pneumothorax (0.9%). Incidence of nosocomial infections was 16.86%.Conclusion : Our data appears to be similar with regards to PRISMIII scores and adjusted mortality, length of the PICU stay, and duration of ventilation, to previously published western data. Multiorgan failure remains a major cause of death.
(2%), and pneumothorax (0.9%). Incidence of nosocomial infections was 16.86%.Conclusion : Our data appears to be similar with regards to PRISMIII scores and adjusted mortality, length of the PICU stay, and duration of ventilation, to previously published western data. Multiorgan failure remains a major cause of death. As expected, Dengue and malaria were common. Incidence of nosocomial infections was somewhat high. Interestingly, more boys got admitted to the PICU as compared to girls. Clearly more studies are required to assess the overall outcomes of critically ill children in India Key words pediatricIntensive careOutcome analysisMortalityMorbidityNosocomial infectionCritical careissue-copyright-statement© Department of Pediatrics All India Institute Of Medical Science 2004