Browse the corpus

Foot-and-mouth disease virus (FMDV, family Picornaviridae, genus Aphthovirus) causes an acute vesicular disease of pigs and wild and domesticated ruminants such as cattle, water buffalo, sheep, goats, and deer (1). It can cause high death rates in young animals and production losses in adults and is considered to be the single most important constraint to world trade in live animals and animal products. Spread of FMDV is predominantly associated with the legal and illegal movement of infected animals or their products. The Food and Agriculture Organization World Reference Laboratory for Foot-and-Mouth Disease (WRLFMD) is established within the high-security laboratory at the Institute for Animal Health, Pirbright, United Kingdom (2). From 2000 to 2004, WRLFMD received an annual average of 536 samples to diagnose FMD from regions of the world where the disease is endemic, predominantly Africa and Asia. Seven serotypes of FMDV exist: SAT 1, SAT 2, and SAT 3 are usually restricted to Africa; Asia 1 is restricted to Asia; and O, A, and C are present in Africa, Asia, and South America and occasionally Europe. In each of the last 5 years, serotype O has been isolated from >60% of the positive FMD samples received.

d Asia. Seven serotypes of FMDV exist: SAT 1, SAT 2, and SAT 3 are usually restricted to Africa; Asia 1 is restricted to Asia; and O, A, and C are present in Africa, Asia, and South America and occasionally Europe. In each of the last 5 years, serotype O has been isolated from >60% of the positive FMD samples received. The economic consequences of FMD incursion into disease-free regions may be severe. For instance, in the first 3 months of the 1997 outbreak in Taiwan, >6,000 farms were affected, 4 million pigs were destroyed or died from the disease, and >21 million doses of vaccine were used (3). The cost of controlling the disease was estimated at US $378.6 million. An additional $1.6 billion was lost in export trade, and >65,000 jobs in pig farming and associated industries were lost (3). To control the FMD outbreak without using vaccination, animals were slaughtered on >10,000 farms in the United Kingdom in 2001; only one fifth of these animals were actually infected. Four million animals were slaughtered for control measures and 2.5 million more for animal health reasons (4). The direct and indirect losses were estimated at ≈£8 billion (5).

g vaccination, animals were slaughtered on >10,000 farms in the United Kingdom in 2001; only one fifth of these animals were actually infected. Four million animals were slaughtered for control measures and 2.5 million more for animal health reasons (4). The direct and indirect losses were estimated at ≈£8 billion (5). FMDV has a genome consisting of a single strand of positive-sense RNA. Consequently, the virus has a high mutation rate and may change, on a random basis, 1–8 nucleotides (nt) per replication cycle (6). Nucleotide sequencing of part or all of the genome region coding for the outer capsid polypeptide VP1 was first used to study the epidemiology of FMD by Beck and Strohmaier (7), who investigated the origin of outbreaks of types O and A in Europe over a 20-year period. Since then, genetic variability has been used to individually characterize strains of FMDV and track their movement across international borders (8), and a large number of epidemiologic studies have been published (9). Previously, on the basis of comparisons of partial VP1 sequences (≈170 nt at the 3´ end of the gene) of FMD type O viruses, differences between 2 isolates within 4% have been suggested to indicate a recent common origin, whereas differences of >15% signify geographic isolation over many years (10), similar to the distinctions made between human polioviruses (11). Isolates with >85% nt sequence identity have been placed within groups or topotypes, which tend to be restricted in their geographic distribution (10,12). The 10 topotypes have been named Europe-South America (Euro-SA), Middle East–South Asia (ME-SA), Southeast Asia (SEA), Cathay (CHY), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), East Africa 3 (EA-3), Indonesia-1 (ISA-1), and Indonesia-2 (ISA-2). The Indonesian topotypes, which have not been identified since 1983, are considered extinct.

rope-South America (Euro-SA), Middle East–South Asia (ME-SA), Southeast Asia (SEA), Cathay (CHY), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), East Africa 3 (EA-3), Indonesia-1 (ISA-1), and Indonesia-2 (ISA-2). The Indonesian topotypes, which have not been identified since 1983, are considered extinct. Knowles et al. (13) described the emergence and spread of the PanAsia strain from 1990 to 2000 on the basis of comparisons of partial (and some complete) VP1 sequences from 60 virus isolates. This article extends the molecular epidemiology of this virus strain by comparing 188 complete VP1 sequences for FMD type O viruses mostly isolated from 2000 to 2005 with published sequences of selected viruses from the previous decade and some reference virus strains (N = 151). Materials and Methods Viruses and Primers The designation and origin of FMDV isolates studied are listed in Table A1. Three alternative primer combinations were used for reverse transcription–polymerase chain reaction (RT-PCR): O-1C244F/NK61, O-1C272F/NK61, and O-1C283F/NK61, which have amplicon sizes of 1,181, 1,153, and 1,142 bp, respectively (Table). Forward and reverse primer amounts were 20 and 40 pmol, respectively. We used 4–6 internal sequencing primers to ensure coverage of the VP1 region on both DNA strands (Table).

action (RT-PCR): O-1C244F/NK61, O-1C272F/NK61, and O-1C283F/NK61, which have amplicon sizes of 1,181, 1,153, and 1,142 bp, respectively (Table). Forward and reverse primer amounts were 20 and 40 pmol, respectively. We used 4–6 internal sequencing primers to ensure coverage of the VP1 region on both DNA strands (Table). Table Oligonucleotide primers used for RT-PCR and cycle sequencing of FMDV strains* Primer Primer sequence (5´ → 3´) Sense Location on FMDV genome Use Gene Position† ARS4 ACCAACCTCCTTGATGTGGCT + 1C 2349–2369 RT-PCR O-1C244F GCAGCAAAACACATGTCAAACACCTT + 1C 2469–2494 RT-PCR O-1C272F TBGCRGGNCTYGCCCAGTACTAC + 1C 2497–2519 RT-PCR O-1C283F GCCCAGTACTACACACAGTACAG + 1C 2508–2530 RT-PCR NK61 GACATGTCCTCCTGCATCTG – 2B 3630–3649 RT-PCR NK72 GAAGGGCCCAGGGTTGGACTC – 2A/2B 3558–3578 Sequencing O-1C499F TACGCGTACACCGCGTC + 1C 2724–2740 Sequencing O-1C583F GACGGYGAYGCICTGGTCGT + 1C 2808–2827 Sequencing A-1C612F TAGCGCCGGCAAAGACTTTGA + 1C 2834–2854 Sequencing O-1D296F ACAACACCACCAACCCAAC + 1D 3181–3199 Sequencing O-1D628R GTTGGGTTGGTGGTGTTGT – 1D 3181–3199 Sequencing *RT-PCR, reverse transcription–polymerase chain reaction; FMDV, food-and-mouth disease virus. †Position on the genome of O1/Kaufbeuren/FRG/66 (EMBL/GenBank accession no. X00871).

Table Oligonucleotide primers used for RT-PCR and cycle sequencing of FMDV strains* Primer Primer sequence (5´ → 3´) Sense Location on FMDV genome Use Gene Position† ARS4 ACCAACCTCCTTGATGTGGCT + 1C 2349–2369 RT-PCR O-1C244F GCAGCAAAACACATGTCAAACACCTT + 1C 2469–2494 RT-PCR O-1C272F TBGCRGGNCTYGCCCAGTACTAC + 1C 2497–2519 RT-PCR O-1C283F GCCCAGTACTACACACAGTACAG + 1C 2508–2530 RT-PCR NK61 GACATGTCCTCCTGCATCTG – 2B 3630–3649 RT-PCR NK72 GAAGGGCCCAGGGTTGGACTC – 2A/2B 3558–3578 Sequencing O-1C499F TACGCGTACACCGCGTC + 1C 2724–2740 Sequencing O-1C583F GACGGYGAYGCICTGGTCGT + 1C 2808–2827 Sequencing A-1C612F TAGCGCCGGCAAAGACTTTGA + 1C 2834–2854 Sequencing O-1D296F ACAACACCACCAACCCAAC + 1D 3181–3199 Sequencing O-1D628R GTTGGGTTGGTGGTGTTGT – 1D 3181–3199 Sequencing *RT-PCR, reverse transcription–polymerase chain reaction; FMDV, food-and-mouth disease virus. †Position on the genome of O1/Kaufbeuren/FRG/66 (EMBL/GenBank accession no. X00871). RT-PCR of vRNA Total RNA was extracted from 460 μL of a 10% epithelial suspension or cell culture supernatant by using RNeasy kits (Qiagen Ltd., Crawley, West Sussex, UK), according to the manufacturer's instructions, and resuspended in 50 μL nuclease-free water. This RNA (5 μL) was used as the template in a 1-step RT-PCR (Ready-To-Go RT-PCR Beads; Amersham Pharmacia Biosciences, Chalfont St. Giles, Bucks, UK). The following thermal profile was used: 42°C for 30 min; 94°C for 5 min; 35 cycles of 94°C for 60 s; 60°C for 60 s; and 72°C for 90 s; followed by a final extension of 72°C for 5 min. PCR products were analyzed by electrophoresis on a 1.5% agarose-Tris-borate-EDTA gel containing 0.5 μg/mL ethidium bromide. DNA weight markers (GeneRuler 100 bp DNA Ladder Plus, Ready-To-Use; Fermentas, Inc., Hanover, MD, USA) were run alongside the samples to facilitate product identification and quantification. Post-PCR removal of deoxynucleoside triphosphates and primers was achieved enzymatically by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA), according to the manufacturer's instructions.

Use; Fermentas, Inc., Hanover, MD, USA) were run alongside the samples to facilitate product identification and quantification. Post-PCR removal of deoxynucleoside triphosphates and primers was achieved enzymatically by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA), according to the manufacturer's instructions. Sequence Determination PCR amplicons were sequenced by using the DTS Quick Start Kit (Beckman Coulter Inc., Fullerton, CA, USA) according to the manufacturer's instructions and with the sequencing primers listed in the Table. The sequencing reactions were run on a CEQ8000Automated Sequencer (Beckman Coulter) according to the manufacturer's instructions. The sequences determined in this study have been submitted to the EMBL/GenBank/DDBJ databases; accession numbers are shown in Table A1. Phylogenetic Analysis An unrooted neighbor-joining tree was constructed by using MEGA version 3 (14). The robustness of the tree topology was assessed with 1,000 bootstrap replicates as implemented in the program.

Sequence Determination PCR amplicons were sequenced by using the DTS Quick Start Kit (Beckman Coulter Inc., Fullerton, CA, USA) according to the manufacturer's instructions and with the sequencing primers listed in the Table. The sequencing reactions were run on a CEQ8000Automated Sequencer (Beckman Coulter) according to the manufacturer's instructions. The sequences determined in this study have been submitted to the EMBL/GenBank/DDBJ databases; accession numbers are shown in Table A1. Phylogenetic Analysis An unrooted neighbor-joining tree was constructed by using MEGA version 3 (14). The robustness of the tree topology was assessed with 1,000 bootstrap replicates as implemented in the program. Results and Discussion Virus RNA was extracted from 188 FMD type O viruses, and each VP1-coding region was successfully amplified by RT-PCR by using at least 1 of the 3 described primer sets. The complete VP1 sequences were determined by directly sequencing the amplicons. For all these isolates, the VP1 gene consisted of 633 nt coding for 211 amino acids (previously VP1 was considered to be 2 amino acids longer at its carboxyl-terminus; however, the VP1-2A cleavage site is actually between a conserved glutamine [VP1211 in most type Os] and a variable residue [2A1, often a leucine in serotype O]) (15).

solates, the VP1 gene consisted of 633 nt coding for 211 amino acids (previously VP1 was considered to be 2 amino acids longer at its carboxyl-terminus; however, the VP1-2A cleavage site is actually between a conserved glutamine [VP1211 in most type Os] and a variable residue [2A1, often a leucine in serotype O]) (15). The 188 VP1 sequences we report were compared to 151 VP1 sequences previously published or awaiting publication (database accession numbers are listed in Table A1). A bootstrapped neighbor-joining tree containing all 339 sequences was constructed by using MEGA 3 (Figure 1). Figures 2–4 show various parts of the tree depicted in Figure 1 in greater detail. The bootstrap support for the 10 FMDV O topotypes was generally high (96%–100%; Figure 2). The topotype distributions of the 299Asian FMD type O viruses (including those reported elsewhere) were as follows: ME-SA (253), SEA (18), and Cathay (49) (Table A1). Additionally, 26 European viruses (from the United Kingdom, Ireland, and France) belonged to the ME-SA topotype. The PanAsia strain accounted for 168 (66%) of the 253 ME-SA isolates. Figure 1 Midpoint–rooted neighbor-joining tree showing the relationships between the 339 VP1 sequences studied. Only the tree structure is shown; details of the boxes labeled A to C are shown in Figures 2–4. Figure 2 Midpoint-rooted neighbor-joining tree showing the Cathay, Europe-South America (Euro-SA), Indonesia-1 (ISA-1), Indonesia-2 (ISA-2), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), and East Africa 3 (EA-3) topotypes. Only bootstrap values >70% are shown.

Figure 1 Midpoint–rooted neighbor-joining tree showing the relationships between the 339 VP1 sequences studied. Only the tree structure is shown; details of the boxes labeled A to C are shown in Figures 2–4. Figure 2 Midpoint-rooted neighbor-joining tree showing the Cathay, Europe-South America (Euro-SA), Indonesia-1 (ISA-1), Indonesia-2 (ISA-2), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), and East Africa 3 (EA-3) topotypes. Only bootstrap values >70% are shown. Figure 4 Midpoint-rooted neighbor-joining tree showing the PanAsia strain. Only bootstrap values >70% are shown.

Figure 2 Midpoint-rooted neighbor-joining tree showing the Cathay, Europe-South America (Euro-SA), Indonesia-1 (ISA-1), Indonesia-2 (ISA-2), West Africa (WA), East Africa 1 (EA-1), East Africa 2 (EA-2), and East Africa 3 (EA-3) topotypes. Only bootstrap values >70% are shown. Figure 4 Midpoint-rooted neighbor-joining tree showing the PanAsia strain. Only bootstrap values >70% are shown. Some FMDV O topotypes had a more limited spread than the ME-SA topotype. Virus isolates from Hong Kong and the Philippines all fell within the Cathay topotype; all the recently isolated (2000–2004) Philippines isolates form a distinct lineage. This topotype was first introduced into the Philippines in 1994, probably from mainland China or Hong Kong (the only known places where it existed at that time). Earlier isolates from the Philippines (e.g., O/PHI/5/95) were closely related to Hong Kong viruses (Figure 2). This topotype was first seen in Vietnam in 1997 and continued to occur there until 2004 (Figure 2) but has not, as far as we know, spread to neighboring Southeast Asian countries. A Cathay topotype virus also spread to Taiwan in 1997, where it caused an extensive epidemic that lasted until at least 1999 (3) (Figure 2). Viruses belonging to the SEA topotype continue to be isolated throughout Southeast Asia (Figure 2; Table A2), despite the recent introduction and widespread dissemination of the PanAsia strain. No examples of either of the Indonesian topotypes have been detected in the field since 1983.

il at least 1999 (3) (Figure 2). Viruses belonging to the SEA topotype continue to be isolated throughout Southeast Asia (Figure 2; Table A2), despite the recent introduction and widespread dissemination of the PanAsia strain. No examples of either of the Indonesian topotypes have been detected in the field since 1983. Viruses belonging to the ME-SA topotype occur in many genetic sublineages (Figure 3). These were often initially found in India and subsequently spread to other geographic regions. The reference/vaccine strains (O5/IND/1/62, O1/Manisa/TUR/69, O1/Sharquia/EGY/72, and O/IND/R2/75) all occur in a single lineage distinct from later isolates. The O5/IND/1/62 sequenced by Hemadri et al. (16) is different (9.6%) from the same strain that we and others sequenced (17,18) (all 3 sequences are identical, and the virus stocks probably all originated from WRLFMD), and the origin of these isolates requires further investigation. Two other reference/vaccine strains (O/Geshur/ISR/85 and O/Dalton/ISR/2/88) fall on another lineage but are not closely related to each other. Within the ME-SA topotype, several sublineages have been defined as strains, such as PanAsia, Ind2001, and Iran2001, on the basis of phylogenetic relationships and a nucleotide difference of <5% (9,16). However, these are artificial groupings, the edges of which become blurred as viruses evolve in different directions. For example, the nucleotide sequences of 2 viruses that are on the PanAsia lineage, O/VIT/1/2004 and O/BHU/27/2004, differ from O/TAW/2/99 by 5.4% and 5.0%, respectively, but differ from each other by 7.9%. Thus trying to define "strains," particularly using percentage nucleotide relationships, may not be relevant, except in special circumstances, such as a pandemic caused by a cluster of closely related viruses.

and O/BHU/27/2004, differ from O/TAW/2/99 by 5.4% and 5.0%, respectively, but differ from each other by 7.9%. Thus trying to define "strains," particularly using percentage nucleotide relationships, may not be relevant, except in special circumstances, such as a pandemic caused by a cluster of closely related viruses. Figure 3 Midpoint-rooted neighbor-joining tree showing the Middle East–South Asia (ME-SA) topotype (except the PanAsia strain). Only bootstrap values >70% are shown. Viruses that we consider part of the PanAsia strain (within the ME-SA topotype) are shown in Figure 4. Within the PanAsia strain, different sublineages can be distinguished despite some low bootstrap values. Some of them correspond to well-defined geographic areas in which these isolates have been collected through the years and show evolutionary relationships. Others are mixtures of FMDV isolates from different regions. In such cases, the phylogeny gives clues to the probable source of some isolates. The PanAsia strain shows a limited degree of variability of the VP1 gene during the outbreak in 2001 in the United Kingdom. Indeed, the degree of genetic variability of the VP1 gene of 24 isolates collected between the beginning and the end of the outbreak was <1.29%, and very few amino acid changes were observed (a maximum of 3 in any 1 sequence).

ited degree of variability of the VP1 gene during the outbreak in 2001 in the United Kingdom. Indeed, the degree of genetic variability of the VP1 gene of 24 isolates collected between the beginning and the end of the outbreak was <1.29%, and very few amino acid changes were observed (a maximum of 3 in any 1 sequence). According to our current analysis, the PanAsia strain is an emergent sublineage of FMDV that, after several years in India, spread through southern Asia, the Middle East, and Europe. This strain apparently was confined to India for longer—and then spread much faster—than previously believed. In 1994, Samuel et al. (19) first noted the arrival of a new FMDV type O lineage in Saudi Arabia. Previously, we had considered this lineage to be part of the PanAsia strain (13). However, analysis of complete VP1 sequences with the neighbor-joining algorithm, rather than unweighted pair-group method analysis on partial VP1 sequences, indicated that these viruses, along with others isolated between 1994 and 1997 in Asia (except India), actually belong to 1 of 2 distinct lineages that we have termed Ind2001 and Iran2001 (Figure 3). Therefore, viruses that we would now classify as PanAsia first appeared in Bahrain, Iran, Lebanon, Kuwait, Saudi Arabia, and Yemen much later (i.e., in 1998); in Israel, Turkey, and the United Arab Emirates in 1999; and in Malaysia in 2000 (Figures 3 and 4; data not shown). In Nepal in 1990, viruses were found that were closely related to the earliest PanAsia isolates from India in the same year. However, from 1991 to 1996, only viruses belonging to non-PanAsia lineages of ME-SA were found in Nepal. During the years 1997–1999, PanAsia viruses were once again found. This virus lineage may have persisted in Nepal in the intervening years (since only a few virus isolates have been examined) or may have been reintroduced in 1997. This extension and reanalysis of the sequence data indicate that the spread of the PanAsia strain from the Indian subcontinent was probably more explosive than once thought and principally occurred from 1998 to 2001.

ening years (since only a few virus isolates have been examined) or may have been reintroduced in 1997. This extension and reanalysis of the sequence data indicate that the spread of the PanAsia strain from the Indian subcontinent was probably more explosive than once thought and principally occurred from 1998 to 2001. Retrospective examination of viruses from India indicated that the PanAsia strain was present in the north of that country as early as 1990 and may even have been present as far back as 1982 (16). From 1991 to 1997, the new lineage appeared to spread to other parts of India (16).

ening years (since only a few virus isolates have been examined) or may have been reintroduced in 1997. This extension and reanalysis of the sequence data indicate that the spread of the PanAsia strain from the Indian subcontinent was probably more explosive than once thought and principally occurred from 1998 to 2001. Retrospective examination of viruses from India indicated that the PanAsia strain was present in the north of that country as early as 1990 and may even have been present as far back as 1982 (16). From 1991 to 1997, the new lineage appeared to spread to other parts of India (16). The presumed initial spread from India in 1998 was to Bhutan, Bahrain, Iran, Jordan, Kuwait, Lebanon, Syria, Saudi Arabia, and the Yemen Arab Republic. In May 1999, the People's Republic of China reported FMD outbreaks in Tibet, Hainan, and Fujian Provinces (20). Sequencing viruses from the outbreaks in Tibet (O/CHA/1/99, O/CHA/2/99, and O/CHA/3/99) and Hainan (O/CHA/4/99) showed that they belonged to the new lineage (13) (Figure 4). In June 1999, FMDV was isolated from subclinically infected or carrier cattle in Kinmen Prefecture of Taiwan Province of China (POC) during routine surveillance. Sequence analysis of this isolate (O/TAW/2/99) showed it also belonged to the new lineage (Figure 4). Later that month, FMDV was detected in Tainan Prefecture on the main island of Taiwan, again in cattle showing no signs of disease. In January 2000, the first clinical cases in cattle were found in Taiwan (Yunlin and Chiayii Prefectures) and in February 2000, ≈71 young goats in Kaoshiung and Changhwa Prefectures died suddenly from FMD, although no disease was seen in adult goats that had been vaccinated. The distribution of this sublineage throughout Asia justified its name of the PanAsia strain.

le were found in Taiwan (Yunlin and Chiayii Prefectures) and in February 2000, ≈71 young goats in Kaoshiung and Changhwa Prefectures died suddenly from FMD, although no disease was seen in adult goats that had been vaccinated. The distribution of this sublineage throughout Asia justified its name of the PanAsia strain. Towards the end of 1999, the PanAsia virus was clearly moving into Southeast Asia (Myanmar, Thailand, Vietnam, Lao People's Democratic Republic) (Table A2), where the FMDV type O SEA topotype had existed exclusively (at least until the Cathay topotype was introduced into Vietnam in 1997) (10). By April 2000, all mainland Southeast Asian countries had experienced outbreaks due to the new strain.

Asia (Myanmar, Thailand, Vietnam, Lao People's Democratic Republic) (Table A2), where the FMDV type O SEA topotype had existed exclusively (at least until the Cathay topotype was introduced into Vietnam in 1997) (10). By April 2000, all mainland Southeast Asian countries had experienced outbreaks due to the new strain. In March 2000, FMD type O appeared in South Korea and Japan, and sequence analysis indicated that the PanAsia strain was responsible (13) (Figure 4). In April 2000, a severe outbreak of FMD type O in occurred in pigs in the Ussuriysk District of eastern Russia. Of 625 pigs affected, nearly 37% died from the disease. Sequencing the VP1 gene showed that the PanAsia strain was responsible (13). At the end of April 2000, an outbreak of FMD type O was reported in Ulaanbadrakh Soum County, Dornogovi Province, Mongolia. In this outbreak sheep, goats, and cattle were affected. Again, sequence analysis of the VP1 gene showed the virus to be of the PanAsia lineage (13). In September 2000, the PanAsia strain spread to KwaZulu-Natal Province in South Africa (13,17) (Figure 4); the origin was traced to feeding pigs with uncooked swill from a ship in the port of Durban (21). This FMD outbreak is the first since 1957 in this region of South Africa and the first recorded outbreak in that country due to serotype O. In February 2001, FMD was diagnosed in the United Kingdom; by the end of July, >1,900 farms were affected. The PanAsia strain was responsible for these outbreaks (13,22,23). In late February 2001, the disease spread from the British mainland to Northern Ireland, and in March and April outbreaks of FMD type O were also reported in the Republic of Ireland (n = 1), France (n = 2), and the Netherlands (n = 26). In 2003, the PanAsia strain was detected for the first time in Afghanistan, Nepal, and Pakistan; however, because of lack of samples or sequencing data, the strain may have been present earlier. Since 2003, the PanAsia strain has not been detected in any new countries.

1), France (n = 2), and the Netherlands (n = 26). In 2003, the PanAsia strain was detected for the first time in Afghanistan, Nepal, and Pakistan; however, because of lack of samples or sequencing data, the strain may have been present earlier. Since 2003, the PanAsia strain has not been detected in any new countries. The PanAsia strain has not yet been detected in Africa (except South Africa in 2000) or South America, despite extensive unpublished sequence studies by ourselves; the Onderstepoort Veterinary Institute, South Africa (W. Vosloo, pers. comm.); and the Pan-American FMD Center, Brazil (I.E. Bergmann, pers. comm.). However, the PanAsia strain is present in many countries in which FMD is endemic and occurs in countries in which the incidence of FMD is sporadic. The extent of this spread is unique for a single strain of FMDV, and its presence in most recent samples from the Middle East indicates that it has dominated and outcompeted the other strains of FMDV previously observed (19). While we acknowledge that the sampling of virus isolates is not random (i.e., the samples examined are those submitted to WRLFMD by some of the countries experiencing outbreaks), the same sampling technique has shown a marked increase in the number of isolations of the PanAsia lineage over the preceding years.

ed (19). While we acknowledge that the sampling of virus isolates is not random (i.e., the samples examined are those submitted to WRLFMD by some of the countries experiencing outbreaks), the same sampling technique has shown a marked increase in the number of isolations of the PanAsia lineage over the preceding years. The appearance of the PanAsia virus in countries that have been FMD-free for many years shows that this strain is capable of spreading to countries where strict control measures are normally effective at preventing importation of animal pathogens. Whether this fitness to survive is related to particular features of the transmissibility of the virus strain or its ability to spread subclinically in certain breeds of animal, as found in Taiwan in 1999 or in Japan in 2000 (24), is not clear. The PanAsia virus strain has been isolated from a wide variety of host species, including cattle, water buffalo, pigs, sheep, goats, and gazelle (Qatar in 1999), and its ability to infect a wide range of species could be a contributing factor in its success. Within the PanAsia strain, differences in behavior of the virus, such as host species or virulence, remain unexplained on a genetic basis, according to comparison of the full genome sequences from viruses from this group (25). However, these characteristics can also be biased by practices such as vaccination, the animal population targeted for vaccination, or the animal species that are farmed in a particular area.

, remain unexplained on a genetic basis, according to comparison of the full genome sequences from viruses from this group (25). However, these characteristics can also be biased by practices such as vaccination, the animal population targeted for vaccination, or the animal species that are farmed in a particular area. We have no evidence of increased or altered trade in the region that could explain the sudden spread of the PanAsia virus. Additionally, the lack of efficacy of existing FMDV vaccines does not seem to be responsible for the spread of this strain in countries in which vaccination is practiced. Indeed, antigenic matching analysis has shown good cross-reactivity between field isolates of the PanAsia strain and current vaccine strains such as O1 Manisa (WRLFMD, data not shown), and this finding has been confirmed for O/UKG/2001 virus by cross-protection studies (26,27).

ntries in which vaccination is practiced. Indeed, antigenic matching analysis has shown good cross-reactivity between field isolates of the PanAsia strain and current vaccine strains such as O1 Manisa (WRLFMD, data not shown), and this finding has been confirmed for O/UKG/2001 virus by cross-protection studies (26,27). The spread of the PanAsia strain across most of Asia and into Europe and South Africa demonstrates how a newly evolved virus may become established, in spite of control measures at international borders. FMD in a previously disease-free country can seriously interfere with the local and export trade in susceptible animals and their products. A large outbreak of FMD in northern Europe or the United States could result in losses of several billion US dollars. The emergence of this strain of FMDV, and its spread within the territory bounded by Ireland in the west and Japan in the east, provides an example of the economic damage that can result. It also demonstrates the difficulty of containing such a transmissible virus within a defined region. The emergence of such strains highlights the necessity to constantly monitor and characterize field isolates responsible for outbreaks in FMD-endemic countries and the need for countries to be rapidly alerted so that appropriate control measures can be instituted. For this purpose, an international early warning system must be established to share information on the characteristics of the latest FMDV isolates in real time.

es responsible for outbreaks in FMD-endemic countries and the need for countries to be rapidly alerted so that appropriate control measures can be instituted. For this purpose, an international early warning system must be established to share information on the characteristics of the latest FMDV isolates in real time. Suggested citation for this article: Knowles NJ, Samuel AR, Davies PR, Midgley RJ, Valarcher JF. Pandemic strain of foot-and-mouth disease virus serotype O. Emerg Infect Dis [serial on the Internet]. 2005 Dec [date cited]. http://dx.doi.org/10.3201/eid1112.050908 Acknowledgments We acknowledge the work of Nigel Ferris and colleagues in receiving and serotyping the viruses submitted to WRLFMD. This work was supported by the Department for Environment, Food and Rural Affairs, United Kingdom (Reference Laboratory contract and research grant no. SE 2921). The submission and serotyping of samples were supported by DEFRA and a grant from the European Commission for the Control of FMD.

Acknowledgments We acknowledge the work of Nigel Ferris and colleagues in receiving and serotyping the viruses submitted to WRLFMD. This work was supported by the Department for Environment, Food and Rural Affairs, United Kingdom (Reference Laboratory contract and research grant no. SE 2921). The submission and serotyping of samples were supported by DEFRA and a grant from the European Commission for the Control of FMD. Table A1 Designation and origin of food-and-mouth disease type O viruses studied. Download PDF (64 KB, 13 pages) Topotype Strain Virus designation Geographic origin Date Species Database ME-SA PanAsia O/AFG/16/2003 Tashqurghan, Balkh, Afghanistan Apr 10, 2003 Bovine DQ165035 ME-SA PanAsia O/AFG/50/2003 Center, Takhar, Afghanistan Apr 14, 2003 Bovine DQ165036 ME-SA Ind2001 O/BAR/2/97 Bahrain 1997 Not known AJ318824† ME-SA PanAsia O/BAR/8/98 Bahrain 1998 Bovine AJ318825† ME-SA PanAsia O/BAR/6/99 Bahrain 1999 Bovine DQ164862† ME-SA Ind2001 O/BAR/1/2001 Bahrain May 2001 Bovine DQ164863† ME-SA PanAsia O/BHU/1/98 Serbithang, Bhutan Feb 8, 1998 Porcine AJ318826† ME-SA PanAsia O/BHU/2/2002 Bhutan 2002 Not known DQ165037 ME-SA Ind2001 O/BHU/7/2002 Bhutan 2002 Not known DQ164864† ME-SA PanAsia O/BHU/38/2002 Bumthang, Bhutan Jul 29, 2002 Bovine DQ165038 ME-SA PanAsia O/BHU/15/2003 Eastern Region, Bhutan Aug 6, 2003 Bovine DQ164865† ME-SA PanAsia O/BHU/22/2003 Eastern Region, Bhutan Aug 16, 2003 Bovine DQ165039 ME-SA PanAsia O/BHU/24/2003 Southern Region, Bhutan Aug 16, 2003 Bovine DQ165040 ME-SA PanAsia O/BHU/25/2003 Southern Region, Bhutan Aug 16, 2003 Bovine DQ164866† ME-SA PanAsia O/BHU/41/2003 West Central Region, Bhutan Oct 20, 2003 Bovine DQ165041 ME-SA PanAsia O/BHU/47/2003 Southern Region, Bhutan Dec 10, 2003 Bovine DQ165042 ME-SA PanAsia O/BHU/49/2003 Western Region, Bhutan Dec 31, 2003 Bovine DQ164867† ME-SA PanAsia O/BHU/26/2004 Western Region, Bhutan Mar 2004 Bovine DQ165043 ME-SA PanAsia O/BHU/27/2004 Western Region, Bhutan Mar 2004 Bovine DQ164868† ME-SA PanAsia O/BHU/28/2004 Western Region, Bhutan Mar 2004 Bovine DQ165044 ME-SA PanAsia O/BHU/30/2004 Bhutan Feb 16, 2004 Bovine DQ165045 ME-SA PanAsia O/BHU/31/2004 Bhutan Feb 16, 2004 Bovine DQ164869† ME-SA PanAsia O/BHU/33/2004 Bhutan Feb 27, 2004 Bovine DQ165046 ME-SA PanAsia O/BHU/39/2004 Bhutan Apr 7, 2004 Bovine DQ164870† ME-SA PanAsia O/BHU/40/2004 Bhutan Apr 7, 2004 Bovine DQ165047 SEA - O/CAM/3/98 Kg.

30/2004 Bhutan Feb 16, 2004 Bovine DQ165045 ME-SA PanAsia O/BHU/31/2004 Bhutan Feb 16, 2004 Bovine DQ164869† ME-SA PanAsia O/BHU/33/2004 Bhutan Feb 27, 2004 Bovine DQ165046 ME-SA PanAsia O/BHU/39/2004 Bhutan Apr 7, 2004 Bovine DQ164870† ME-SA PanAsia O/BHU/40/2004 Bhutan Apr 7, 2004 Bovine DQ165047 SEA - O/CAM/3/98 Kg. Speu, Cambodia May 1, 1998 Bovine AJ294910 ME-SA PanAsia O/CAM/2/2000 Angkor Chum, Siem Reap, Cambodia Jan 27, 2000 Bovine AJ318828† ME-SA PanAsia O/CAM/4/2000 Angkor Chum, Siem Reap, Cambodia Jan 29, 2000 Bovine AJ318829† ME-SA PanAsia O/Tibet/CHA/99 Tibet, P.R. China 1999 Bovine AJ539138 WA - O/CIV/8/99 Côte d’Ivoire 1999 Bovine AJ303485 ME-SA - O1/Sharquia/EGY/72 Sharquia Governate, Egypt 1972 Bovine DQ164871† Euro-SA - O1/Kaufbeuren/FRG/66 Kaufbeuren, Germany 1966 Bovine X00871 ME-SA PanAsia O/FRA/1/2001 Mayenne, Pays de la Loire, France Mar 2001 Not known DQ164872† ME-SA PanAsia O/FRA/1/2001 Mayenne, Pays de la Loire, France Mar 2001 Not known AJ633821 WA - O/GHA/5/93 Kintampo, Ghana Jan 6, 1993 Bovine AJ303488 WA - O/GNA/4/99 Kawkan/Madina, Guinea May 8, 1999 Bovine DQ165071 ME-SA Branch A O/GRE/23/94 Xanthi, Greece Aug 4, 1994 Bovine DQ164873† ME-SA Iran2001 O/GRE/18/96 Issakion, Didymotiho, Evros, Greece Jul 31, 1996 ovine DQ164874† Cathay - O/HKN/21/70 Hang Tau, Sheung Shiu, N.

Kintampo, Ghana Jan 6, 1993 Bovine AJ303488 WA - O/GNA/4/99 Kawkan/Madina, Guinea May 8, 1999 Bovine DQ165071 ME-SA Branch A O/GRE/23/94 Xanthi, Greece Aug 4, 1994 Bovine DQ164873† ME-SA Iran2001 O/GRE/18/96 Issakion, Didymotiho, Evros, Greece Jul 31, 1996 ovine DQ164874† Cathay - O/HKN/21/70 Hang Tau, Sheung Shiu, N. T., Kowloon, Hong Kong Mar 13, 1970 Porcine AJ294911 Cathay - O/HKN/6/83 Pokfulam, Hong Kong Island Dec 18, 1982 Bovine AJ294919 Cathay - O/HKN/12/91 Sek Kwu Chau, N.T., Kowloon, Hong Kong Nov 26, 1991 Porcine AJ294921 Cathay - O/HKN/16/96 Takwuling, N.T., Kowloon, Hong Kong Mar 29, 1996 Porcine AJ294923 Cathay - O/HKN/20/96 Hong Kong Apr 17, 1996 Bovine AJ294924 Cathay - O/HKN/1/99 Mong Tseng Tsuen, Yuen Long, Hong Kong Jan 5, 1998 Porcine AJ294925 Cathay - O/HKN/4/2001 Hong Kong 2001 Not known DQ164875† Cathay - O/HKN/19/2001 Sheun Shui, NT, Hong Kong Sep 28, 2001 Porcine DQ164876† Cathay - O/HKN/1/2002 Yuen Long, New Territories, Hong Kong Jan 22, 2002 Porcine DQ164877† Cathay - O/HKN/3/2002 Yuen Long, New Territories, Hong Kong Jan 31, 2002 Porcine DQ164878† Cathay - O/HKN/2/2003 Hong Kong 2003 Porcine DQ164879† Cathay - O/HKN/3/2003 Hong Kong 2003 Porcine DQ164880† Cathay - O/HKN/3/2004 Hong Kong Jan 28, 2004 Porcine DQ164881† Cathay - O/HKN/4/2004 Hong Kong Feb 11, 2004 Porcine DQ164882† Cathay - O/HKN/6/2004 Hong Kong Mar 2, 2004 Porcine DQ164883† Cathay - O/HKN/7/2004 Hong Kong Mar 18, 2004 Porcine DQ164884† Cathay - O/HKN/8/2004 Hong Kong Aug 11, 2004 Porcine DQ164885† Cathay - O/HKN/9/2004 Hong Kong Aug 11, 2004 Porcine DQ164886† Cathay - O/HKN/10/2004 Hong Kong Aug 11, 2004 Porcine DQ164887† Cathay - O/HKN/11/2004 Hong Kong Aug 11, 2004 Porcine DQ164888† Cathay - O/HKN/12/2004 Hong Kong Aug 11, 2004 Porcine DQ164889† ME-SA - O5/IND/1/62 Thakurdwara, Moradabad, Uttar Pradesh, India 1962 Not known DQ164890† ME-SA Branch B O5/IND/62 Thakurdwara, Moradabad, Uttar Pradesh, India 1962  Not known AY593828 ME-SA Branch B O5/IND/1/62 Thakurdwara, Moradabad, Uttar Pradesh, India 1962  Not known Ref. 16 ME-SA Branch B O/IND/R2/75* Tamilnadu, India 1975 Bovine AF204276 ME-SA Branch A O/IND/53/79 Tamilnadu, India 1979 Bovine AF292107 ME-SA Branch A O/IND/136/87* Guwahati, Assam, India 1987 Bovine Ref. 16 ME-SA Branch A O/IND/4/88* Bareilly, Uttar Pradesh, India 1988 Bovine Ref. 16 ME-SA PanAsia O/IND/231/88* Kheda, Gujarat, India 1982 Bovine Ref. 16 ME-SA Branch A O/IND/8/89* Bangalore, Karnataka, India 1989 Bovine Ref.

, India 1979 Bovine AF292107 ME-SA Branch A O/IND/136/87* Guwahati, Assam, India 1987 Bovine Ref. 16 ME-SA Branch A O/IND/4/88* Bareilly, Uttar Pradesh, India 1988 Bovine Ref. 16 ME-SA PanAsia O/IND/231/88* Kheda, Gujarat, India 1982 Bovine Ref. 16 ME-SA Branch A O/IND/8/89* Bangalore, Karnataka, India 1989 Bovine Ref. 16 ME-SA PanAsia O/IND/6/90* Jallandhar, Punjab, India 1990 Bovine Ref. 16 ME-SA Branch B O/IND/79/90* Jind, Haryana, India 1988 Bovine Ref. 16 ME-SA Branch A O/IND/100/90* Jallandhar, Punjab, India 1989 Porcine Ref. 16 ME-SA PanAsia O/IND/232/90* Cuttack, Orissa, India 1990 Bovine Ref. 16 ME-SA PanAsia O/IND/234/90* Cuttack, Orissa, India 1990 Bovine Ref. 16 ME-SA PanAsia O/IND/235/90* Cuttack, Orissa, India 1990 Bovine Ref. 16 ME-SA Branch A O/IND/7/94* Bangalore, Karnataka, India 1993 Bovine Ref. 16 ME-SA Iran2001 O/IND/27/95* Salem, Tamilnadu, India 1994 Bovine Ref. 16 ME-SA Iran2001 O/IND/52/95* Bhiwani, Haryana, India 1995 Bovine Ref. 16 ME-SA PanAsia O/IND/50/96* Thane, Maharastra, India 1990 Bovine Ref. 16 ME-SA Iran2001 O/IND/162/97* Jalgaon, Maharastra, India 1997 Bovine Ref. 16 ME-SA Branch C-I O/IND/279/97* Nagaon, Assam, India 1997 Bovine Ref. 16 ME-SA PanAsia O/IND/289/97* Howrah, West Bengal, India 1997 Bovine Ref. 16 ME-SA Ind2001 O/IND/313/97* Hisar, Haryana, India 1997 Bovine Ref. 16 ME-SA Branch A O/IND/489/97* Tamilnadu, India 1984 Not known Ref. 16 ME-SA PanAsia O/IND/31/98* Jalpaiguri, West Bengal, India 1997 Bovine Ref. 16 ME-SA PanAsia O/IND/146/98* Tumkur, Karnataka, India 1998 Porcine Ref. 16 ME-SA Branch C-I O/IND/413/98* Doddaballapura, Karnataka, India 1998 Bovine Ref. 16 ME-SA PanAsia O/IND/429/98* Anantpur, Andhra Pradesh, India 1998 Bovine Ref. 16 ME-SA Branch C-I O/IND/141/99* Thirunelveli, Tamilnadu, India 1999 Buffalo Ref. 16 ME-SA PanAsia O/IND/143/99* Agra, Uttar Pradesh, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/209/99* Ahmednagar, Maharashtra, India 1998 Bovine Ref. 16 ME-SA Ind2001 O/IND/246/99* Gujarat, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/5/00* Kurnool, Andhra Pradesh, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/30/00* Sirsa, Haryana, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/34/00* Hisar, Haryana, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/36/00* Sirsa, Haryana, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/43/00* Chitradurga, Karnataka, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/45/00* Doddaballapura, Karnataka, India 1999 Bovine Ref.

a, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/34/00* Hisar, Haryana, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/36/00* Sirsa, Haryana, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/43/00* Chitradurga, Karnataka, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/45/00* Doddaballapura, Karnataka, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/74/00* Hassan, Karnataka, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/75/00* Arakalgudu, Karnataka, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/77/00* Arakalgudu, Karnataka, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/90/00* Chitradurga, Karnataka, India 2000 Bovine Ref. 16 ME-SA PanAsia O/IND/91/00* Chitradurga, Karnataka, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/111/00* Howrah, West Bengal, India 1999 Bovine Ref. 16 ME-SA PanAsia O/IND/112/00* Nadia, West Bengal, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/151/00* Midnapore, West Bengal, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/156/00* Nadia, West Bengal, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/157/00* 24 Parganas, West Bengal, India 2000 Bovine Ref. 16 ME-SA Iran2001 O/IND/398/00* Surendra Nagar, Gujarat, India 2000 Not known Ref. 16 ME-SA Ind2001 O/IND/402/00* Jam Nagar, Gujarat, India 2000 Not known Ref. 16 ME-SA Iran2001 O/IND/40/01* Midnapore, West Bengal, India 2000 Bovine Ref. 16 ME-SA Ind2001 O/IND/58/01* Mahadevpur, Karnataka, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/64/01* Muzaffarnagar, Uttar Pradesh, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/78/01* Hoshiarpur, Punjab, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/79/01* Hoshiarpur, Punjab, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/83/01* Mandya, Karnataka, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/86/01* Kolar, Karnataka, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/93/01* Kolar, Karnataka, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/96/01* Ludhiana, Punjab, India 2001 Buffalo Ref. 16 ME-SA Ind2001 O/IND/97/01* Ambala, Haryana, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/102/01* Hatharas, Uttar Pradesh, India 2001 Buffalo Ref. 16 ME-SA Ind2001 O/IND/106/01* Hisar, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/111/01* Gurgaon, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/112/01* Gurgaon, Haryana, India 2001 buffalo Ref. 16 ME-SA PanAsia O/IND/115/01* Kuruksetra, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/116/01* Narnaul, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/118/01* Jaipur, Rajasthan, India 2001 buffalo Ref.

na, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/112/01* Gurgaon, Haryana, India 2001 buffalo Ref. 16 ME-SA PanAsia O/IND/115/01* Kuruksetra, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/116/01* Narnaul, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/118/01* Jaipur, Rajasthan, India 2001 buffalo Ref. 16 ME-SA Ind2001 O/IND/119/01* Karnal, Haryana, India 2001 Bovine Ref. 16 ME-SA Ind2001 O/IND/125/01* Faridabad, Haryana, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/136/01* Baruch, Gujarat, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/151/01* Kutch, Gujarat, India 2001 Bovine Ref. 16 ME-SA PanAsia O/IND/155/01* Baruch, Gujarat, India 2001 Bovine Ref. 16 ISA-1 - O/ISA/1/62 Bali, Indonesia Jul 1962 Bovine AJ303500 ISA-2 - O/JAV/5/72 Java, Indonesia 1972 Not known AJ303509 ISA-2 - O/ISA/1/74 Bali Quarantine Station, Indonesia 1974 Bovine AJ303501 ISA-1 - O/ISA/9/74 Bali, Indonesia Oct 30, 1974 Bovine AJ303502 ISA-1 - O/ISA/8/83 East Java, Indonesia 1983 Bovine AJ303503 ME-SA PanAsia O/IRL/134/2001 Louth, Republic of Ireland Mar 20, 2001 Bovine DQ164891† ME-SA PanAsia O/IRN/9/99 Iran 1999 Not known AJ318838† ME-SA PanAsia O/IRN/24/99 Iran 1999 Not known AJ318839† ME-SA PanAsia O/IRN/1/2000 Ghotil, West Azrarbijan, Mahabad, Iran May 6, 2000 Bovine DQ164892† ME-SA PanAsia O/IRN/16/2000 Sardasht, W. Azerbaijan, Iran Jun 28, 2000 Bovine AJ318840† ME-SA PanAsia O/IRN/16/2001 Shirin Abad, Markazy, Iran Jul 9, 2001 Bovine DQ164893† ME-SA PanAsia O/IRN/41/2001 Oshnaveye, West Azar, Iran Nov 14, 2001 Bovine DQ164894† ME-SA PanAsia O/IRN/58/2001 Dam Shahz, Qom, Iran Nov 29, 2001 Bovine DQ164895† ME-SA Iran2001 O/IRN/61/2001 Mynab, Hormozgan, Iran Dec 15, 2001 Bovine DQ164896† ME-SA PanAsia O/IRN/67/2001 Zahedan, Systan, Iran Dec 22, 2001 Bovine DQ164897† ME-SA PanAsia O/IRN/2/2003 Abaz Abad, West Azarbijan, Iran Jan 3, 2003 Bovine DQ165048 ME-SA Iran2001 O/IRN/4/2003 Kahak, Qom, Iran Jan 4, 2003 Bovine DQ165049 ME-SA Iran2001 O/IRN/6/2003 Hajiabad, Hormozgan, Iran Jan 9, 2003 Bovine DQ165050 ME-SA Iran2001 O/IRN/8/2003 Sanandoj, Kordestan, Iran Jan 15, 2003 Bovine DQ165051 ME-SA Iran2001 O/IRN/15/2003 Amol, Mazanderan, Iran Apr 13, 2003 Not known DQ164898† ME-SA PanAsia O/IRN/16/2003 Gorgah, Golestan, Iran Apr 14, 2003 Bovine DQ165052 ME-SA PanAsia O/IRN/6/2004 Oshnavieh, W. Azerbaijan, Iran Jul 11, 2004 Bovine DQ165053 ME-SA PanAsia O/IRN/8/2004 Urmiah, W.

n Jan 15, 2003 Bovine DQ165051 ME-SA Iran2001 O/IRN/15/2003 Amol, Mazanderan, Iran Apr 13, 2003 Not known DQ164898† ME-SA PanAsia O/IRN/16/2003 Gorgah, Golestan, Iran Apr 14, 2003 Bovine DQ165052 ME-SA PanAsia O/IRN/6/2004 Oshnavieh, W. Azerbaijan, Iran Jul 11, 2004 Bovine DQ165053 ME-SA PanAsia O/IRN/8/2004 Urmiah, W. Azarbaijan, Iran Aug 17, 2004 Bovine DQ165054 ME-SA Iran2001 O/IRN/15/2004 Ardebil, Ardebil, Iran Oct 3, 2004 Bovine DQ165055 ME-SA Iran2001 O/IRN/20/2004 Hosseinabad, Fars, Shiraz, Iran Oct 19, 2004 Bovine DQ165056 ME-SA PanAsia O/IRQ/26/2000 Erbil, Iraq Apr 9, 2000 Bovine AJ318841† ME-SA PanAsia O/IRQ/30/2000 Erbil, Iraq Apr 9, 2000 Bovine DQ165057 ME-SA - O/Geshur/ISR/85 Kibbutz Geshur, Galand, Israel May 1985 Bovine AF189157 ME-SA - O/ISR/2/88 Dalton, Zefat, Israel Jun 24, 1988 Bovine DQ164899† ME-SA PanAsia O/ISR/2/2004 Hadaron, Israel Jan 20, 2004 Bovine DQ164900† ME-SA PanAsia O/ISR/3/2004 Hadaron, Israel Jan 22, 2004 Bovine DQ164901† ME-SA PanAsia O/ISR/4/2004 Hazafon, Israel Jan 23, 2004 Bovine DQ164902† Euro-SA - O1/Lombardy/ITL/46 Lombardy, Italy 1946 Not known M58601 Euro-SA - O2/Brescia/ITL/47 Brescia, Italy 1947 Not known M55287 ME-SA PanAsia O/JPN/2000 Miyazaki, Japan Apr 7, 2000 Bovine AB079061 ME-SA Iran2001 O/JOR/2/95 Amman Governorate, Jordan Oct 30, 1995 Bovine DQ164903† EA-1 - O/K77/78* Manera Est., Naivasha, Kenya 1978 Not known DQ165072 EA-1 - O/K83/79* Mweiga, Nyeri Dist., Central Prov., Kenya 1979 Bovine AJ303511 EA-2 O/KEN/5/2002 Nakuru, Lanet Division, Kenya Oct 9, 2002 Bovine DQ165073 ME-SA Ind2001 O/KUW/3/97 Kuwait 1997 Bovine DQ164904† ME-SA PanAsia O/KUW/1/98 Warfra (Al Warfah), Kuwait May 2, 1998 Bovine DQ164905† SEA - O/LAO/4/98 Attapeu, Laos Sep 24, 1998 Buffalo DQ164906† ME-SA PanAsia O/LAO/2/2000 Kephathao, Sayabluly, Laos Jan 26, 2000 Not known AJ318844† SEA - O/LAO/4/2001 Xieng Khouang, Laos Aug 3, 2001 Bovine DQ164907† ME-SA PanAsia O/LAO/3/2003 Xaythany, VT Municipality, Laos Mar 21, 2003 Bovine DQ164908† ME-SA PanAsia O/LAO/11/2003 Xaysettha, VT Municipality, Laos May 12, 2003 Buffalo DQ164909† ME-SA PanAsia O/LAO/12/2003 Hatxaifong, VT Municipality, Laos May 15, 2003 Bovine DQ164910† ME-SA PanAsia O/LAO/13/2003 Xaysettha, VT Municipality, Laos May 16, 2003 Buffalo DQ164911† ME-SA PanAsia O/LAO/17/2003 Tonepheung, Borkeo, Laos May 25, 2003 Buffalo DQ164912† ME-SA PanAsia O/LAO/19/2003 Tonepheung, Borkeo, Laos May 27, 2003 Bovine DQ164913† ME-SA PanAsia O/LAO/21/2003 Chanthabuly, VT Municipality, Laos Jun 25, 2003 Porcine

2003 Xaysettha, VT Municipality, Laos May 16, 2003 Buffalo DQ164911† ME-SA PanAsia O/LAO/17/2003 Tonepheung, Borkeo, Laos May 25, 2003 Buffalo DQ164912† ME-SA PanAsia O/LAO/19/2003 Tonepheung, Borkeo, Laos May 27, 2003 Bovine DQ164913† ME-SA PanAsia O/LAO/21/2003 Chanthabuly, VT Municipality, Laos Jun 25, 2003 Porcine DQ164914† ME-SA PanAsia O/LAO/23/2003 Chanthabuly, VT Municipality, Laos Jun 26, 2003 Porcine DQ164915† ME-SA PanAsia O/LAO/28/2003 Thaphabath, Borikhamxai, Laos Sep 16, 2003 Bovine DQ164916† ME-SA PanAsia O/LAO/30/2003 Thaphabath, Borikhamxai, Laos Oct 4, 2003 Porcine DQ164917† ME-SA PanAsia O/LAO/31/2003 Thaphabath, Borikhamxai, Laos Oct 4, 2003 Porcine DQ164918† ME-SA PanAsia O/LEB/1/2003 Lebanon Mar 26, 2003 Bovine DQ164919† EA-2 - O/MAL/1/98 Mwongulukulu dip tank, Karonga, Northern Malawi Nov 6, 1998 Not known DQ165074 ME-SA PanAsia O/MAY/2/2000 Kilang Papan, Batu Arang, Selangor, Malaysia Jan 2, 2000 Bovine AJ318846† SEA - O/MAY/3/2001 S.G Kelambu Kuala Langat, Selangor, Malaysia Jun 23, 2001 Bovine DQ164920† SEA - O/MAY/5/2001 Twluk Jering, Kelantan, Tumpat, Malaysia Jul 11, 2001 Bovine DQ164921† SEA - O/MAY/6/2001 Twluk Jering, Kelantan, Tumpat, Malaysia Jul 11, 2001 Bovine DQ164922† SEA - O/MAY/1/2002 Pengkala Huln, Perak, Malaysia Jan 10, 2002 Bovine DQ164923† ME-SA PanAsia O/MAY/6/2003 Rompin, Pahang, Malaysia Dec 28, 2003 Bovine DQ165058 SEA - O/MYA/13/89 Kyaik Latt, Myanmar Jul 20, 1989 Bovine DQ164924† SEA - O/MYA/7/98 U Uin Myint, Warr Ta Ya, Htan Ta Pin, Yangon, Myanmar Jul 14, 1998 Bovine DQ164925† SEA - O/MYA/5/99 U Khin Win, Tha Pyay Sein, Zigon, Bago, Myanmar Jun 8, 1999 Bovine DQ164926† SEA - O/MYA/2/2000 Kant Malar, Yangon, Kungyaw Kone, Myanmar May 23, 2000 Bovine DQ164927† SEA - O/MYA/7/2002 Hlayhlaninn, Hlegu, Yangon, Myanmar Oct 23, 2002 Porcine DQ164928† ME-SA PanAsia O/NEP/111/90 Kathmandu, Nepal May 17, 1990 Porcine DQ164929† ME-SA PanAsia O/NEP/121/90 Bhojpur, Nepal Sep 23, 1990 Bovine DQ164930† ME-SA O/NEP/6/91 Kathmandu, Nepal Jun 5, 1991 Bovine DQ164931† ME-SA O/NEP/4/92 Kathmandu, Nepal Oct 22, 1992 Bovine DQ164932† ME-SA PanAsia O/NEP/104/97 k.b.

cine DQ164928† ME-SA PanAsia O/NEP/111/90 Kathmandu, Nepal May 17, 1990 Porcine DQ164929† ME-SA PanAsia O/NEP/121/90 Bhojpur, Nepal Sep 23, 1990 Bovine DQ164930† ME-SA O/NEP/6/91 Kathmandu, Nepal Jun 5, 1991 Bovine DQ164931† ME-SA O/NEP/4/92 Kathmandu, Nepal Oct 22, 1992 Bovine DQ164932† ME-SA PanAsia O/NEP/104/97 k.b. Budhathoki, Kathmandu, Nepal Oct 16, 1997 Bovine DQ164933† ME-SA PanAsia O/NEP/109/97 Okhaldhunga, Nepal Nov 30, 1997 buffalo DQ164934† ME-SA PanAsia O/NEP/4/98 Kathmandu, Nepal Apr 30, 1998 Porcine DQ164935† ME-SA PanAsia O/NEP/9/98 Lalitpur, Nepal Oct 4, 1998 Bovine DQ164936† ME-SA PanAsia O/NEP/2/99 Pyuthan, Nepal Jan 4, 1999 Bovine DQ164937† ME-SA - O/NEP/12/2000 Kathmandu, Nepal Jun 14, 2000 Bovine DQ164938† ME-SA - O/NEP/13/2000 Kathmandu, Nepal Jun 14, 2000 Bovine DQ164939† ME-SA PanAsia O/NEP/4/2003 Lalitpur, Nepal May 9, 2003 Bovine DQ165059 ME-SA PanAsia O/NEP/5/2003 Gagalphed 1-7, Kathmandu, Nepal May 29, 2003 Bovine DQ165060 ME-SA PanAsia O/NEP/6/2003 Gagalphed 1-7, Kathmandu, Nepal Jun 9, 2003 Bovine DQ165061 ME-SA Ind2001 O/OMN/4/2001 Oman 2001 Caprine DQ164940† ME-SA Ind2001 O/OMN/7/2001 Oman 2001 Bovine DQ164941† ME-SA Iran2001 O/PAK/15/2002 Sheikh Pura, Punjab, Pakistan Mar 15, 2002 Buffalo DQ165062 ME-SA Iran2001 O/PAK/16/2002 Pakistan Mar 15, 2002 Bovine DQ165063 ME-SA Iran2001 O/PAK/18/2002 Karachi, Pakistan Jul 27, 2002 Bovine DQ165064 ME-SA Iran2001 O/PAK/1/2003 Karachi, Pakistan Jan 6, 2003 Bovine DQ165065 ME-SA Pak98 O/PAK/12/2003 Lahore, Punjab, Pakistan 2003 Not known DQ165066 ME-SA Pak98 O/PAK/14/2003 Lahore, Punjab, Pakistan 2003 Not known DQ165067 ME-SA Pak98 O/PAK/16/2003 Lahore, Punjab, Pakistan 2003 Not known DQ165068 ME-SA Pak98 O/PAK/17/2003 Lahore, Punjab, Pakistan 2003 Not known DQ165069 ME-SA PanAsia O/PAK/45/2003 Pakistan May 19, 2003 Bovine DQ164942† ME-SA Iran2001 O/PAK/53/2003 Pakistan May 27, 2003 Buffalo DQ164943† ME-SA Pak98 O/PAK/73/2003 Pakistan Oct 27, 2003 Not known DQ165070 ME-SA Ind2001 O/PAT/2/2002 Deir Dibwan, Ramallah, Palestinian Autonomous Territories 2002 Bovine DQ164944† ME-SA Ind2001 O/PAT/3/2002 Nr.

45/2003 Pakistan May 19, 2003 Bovine DQ164942† ME-SA Iran2001 O/PAK/53/2003 Pakistan May 27, 2003 Buffalo DQ164943† ME-SA Pak98 O/PAK/73/2003 Pakistan Oct 27, 2003 Not known DQ165070 ME-SA Ind2001 O/PAT/2/2002 Deir Dibwan, Ramallah, Palestinian Autonomous Territories 2002 Bovine DQ164944† ME-SA Ind2001 O/PAT/3/2002 Nr. Ramallah, Palestinian Autonomous Territories Nov 12, 2002 Bovine DQ164945† Cathay - O/PHI/5/95 Bauang, La Union, Philippines Feb 9, 1995 Porcine DQ164946† Cathay - O/PHI/7/96 Mahabang Parang, Angono, Rizal, Philippines Nov 1, 1996 Porcine AJ294926 Cathay - O/PHI/5/2000 (Cabanatuan), 111, Nueva Ecija, Philippines Feb 8, 2000 Porcine DQ164947† Cathay - O/PHI/13/2000 Staana, 111, Pamapanga, Philippines Mar 2, 2000 Porcine DQ164948† Cathay - O/PHI/14/2000 Vicotria, 1V, Oriental Mindoro, Philippines Mar 11, 2000 Porcine DQ164949† Cathay - O/PHI/5/2003 Bangued, CAR, Abra, Philippines Feb 10, 2003 Porcine DQ164950† Cathay - O/PHI/10/2003 Muntinlupa City, NCR, Muntinlupa, Philippines Mar 4, 2003 Porcine DQ164951† Cathay - O/PHI/17/2003 Guagua, 111, Pampanga, Philippines Apr 8, 2003 Porcine DQ164952† Cathay - O/PHI/21/2003 Antipolo City, 1V, Rizal, Philippines May 13, 2003 Porcine DQ164953† Cathay - O/PHI/23/2003 Cainta, 1V, Rizal, Philippines May 15, 2003 Porcine DQ164954† Cathay - O/PHI/1/2004 Cabaroandaya, 1, Vigan Ilocos Sur, Philippines Jan 13, 2004 Porcine DQ164955† Cathay - O/PHI/2/2004 Guagua, II, Pampanga, Philippines Jan 16, 2004 Porcine DQ164956† Cathay - O/PHI/3/2004 Quezon City, NCR, Metro Manila, Philippines Jan 5, 2004 Porcine DQ164957† Cathay - O/PHI/4/2004 Tondo, NCR, Metro Manila, Philippines Mar 24, 2004 Porcine DQ164958† Cathay - O/PHI/5/2004 Pinagbuhatan, NCR, Pasig City, Philippines Jun 1, 2004 Porcine DQ164959† Cathay - O/PHI/6/2004 Caloocan City, NCR, Metro Manila, Philippines Jun 21, 2004 Porcine DQ164960† Cathay - O/PHI/7/2004 Gerona, III, Tarlac, Philippines Jun 29, 2004 Porcine DQ164961† Cathay - O/PHI/8/2004 Guiguinto, III, Bulacan, Philippines Jul 14, 2004 Porcine DQ164962† Cathay - O/PHI/9/2004 Mayamot, Antipolo, IV B, Rizal, Philippines Jul 21, 2004 Porcine DQ164963† Cathay - O/PHI/10/2004 NCR, Quezon City, Philippines Aug 4, 2004 Porcine DQ164964† Cathay - O/PHI/11/2004 Muntinlupa, NCR, Metro Manila, Philippines Sep 3, 2004 Porcine DQ164965† Cathay - O/PHI/12/2004 Binan, IV B, Laguna, Philippines Sep 29, 2004 Porcine DQ164966† ME-SA PanAsia O/QTR/3/99 Al-Wabra, Wildlife Preservation, Dohar, Qatar Feb 27, 1999 Dorcas gazelle DQ164967† ME-S

2004 Porcine DQ164964† Cathay - O/PHI/11/2004 Muntinlupa, NCR, Metro Manila, Philippines Sep 3, 2004 Porcine DQ164965† Cathay - O/PHI/12/2004 Binan, IV B, Laguna, Philippines Sep 29, 2004 Porcine DQ164966† ME-SA PanAsia O/QTR/3/99 Al-Wabra, Wildlife Preservation, Dohar, Qatar Feb 27, 1999 Dorcas gazelle DQ164967† ME-S A PanAsia O/SAR/1/2000 Camperdown, Kwazulu-Natal, South Africa Sep 2000 Porcine AJ318860† ME-SA - O/SAU/2/97 Riyadh, Saudi Arabia May 1997 Bovine AJ318851† ME-SA PanAsia O/SAU/38/98 Al‑Kharj, Saudi Arabia 1998 Bovine AJ318852† ME-SA PanAsia O/SAU/2/99 Saudi Arabia 1999 Not known DQ164968† ME-SA Ind2001 O/SAU/3/2001 Asier, Saudi Arabia Mar 2001 Bovine DQ164969† ME-SA Ind2001 O/SAU/11/2001 Al Karj, Saudi Arabia Jan 2001 Bovine DQ164970† ME-SA PanAsia O/SAU/13/2001 Almaria, Riyadh, Saudi Arabia Oct 12, 2001 Bovine DQ164971† ME-SA PanAsia O/SKR/1/2000 Papyung, P’aju City, Kyunggi, Republic of Korea Mar 26, 000 Bovine AJ318854† ME-SA PanAsia O/SKR/2000 ChungJu county, Kyunggi province, Republic of Korea May 2000 Bovine AJ539139 ME-SA PanAsia O/SKR/2000 Republic of Korea 2000 Not known  AF377945 ME-SA PanAsia O/SKR/2000 Republic of Korea 2000 Not known  AF428246 ME-SA PanAsia O/SKR/1/2002 Samjuk, Anseong, Kyonggi province, Republic of Korea May 2, 2002 Porcine DQ164972† ME-SA PanAsia O/SKR/AS/2002 Samjuk, Anseong, Kyonggi province, Republic of Korea 2002 Porcine AY114146 EA-3 - O/SUD/2/86 Omdurman, Khartoum, Sudan Nov 17, 1986 Bovine DQ165075 EA-3 - O/SUD/1/99 Sudan 1999 Not known DQ165076 ME-SA PanAsia O/SYR/1/2002 Syria Feb 2002 Not known DQ164973† ME-SA PanAsia O/SYR/2/2002 Syria Feb 2002 Not known DQ164974† ME-SA PanAsia O/SYR/3/2002 Syria Feb 2002 Not known DQ164975† SEA - O/TAI/4/99 Mae Hong Son, Thailand Mar 1999 Bovine DQ164976† SEA - O/TAI/8/99 Buriram, Thailand Jun 1999 Bovine DQ164977† ME-SA PanAsia O/TAI/9/99 Chieng Rai, Thailand Jun 1999 Bovine DQ164978† SEA - O/TAI/2/2000 Songkhla, Thailand Jan 18, 2000 Bovine DQ164979† ME-SA PanAsia O/TAI/2/2003 Nakhon Ratchasima, Thailand Mar 10, 2003 Bovine DQ164980† SEA - O/TAI/3/2003 Nakompathom, Thailand May 19, 2003 Porcine DQ164981† Cathay - O/TAW/81/97 I-lan, Taiwan POC 17/04/1997 Porcine AJ296321 ME-SA PanAsia O/TAW/2/99 Kinmen, Taiwan POC Jun 1999 Bovine AJ294927 Cathay - O/TAW/4/99 Penghu Island, Taiwan POC Feb 1999 Porcine AJ294928 ME-SA Branch B O1/Manisa/TUR/69 Manisa, Turkey Apr 1969 Bovine AJ251477 ME-SA Iran2001 O/TUR/2/2000 Merlez, Balikesir, Turkey 2000 Bovine DQ164982† ME-SA PanAsia O/TUR/5/2000 Nigd

ME-SA PanAsia O/TAW/2/99 Kinmen, Taiwan POC Jun 1999 Bovine AJ294927 Cathay - O/TAW/4/99 Penghu Island, Taiwan POC Feb 1999 Porcine AJ294928 ME-SA Branch B O1/Manisa/TUR/69 Manisa, Turkey Apr 1969 Bovine AJ251477 ME-SA Iran2001 O/TUR/2/2000 Merlez, Balikesir, Turkey 2000 Bovine DQ164982† ME-SA PanAsia O/TUR/5/2000 Nigd e, Turkey 2000 Bovine DQ164983† ME-SA PanAsia O/TUR/8/2000 Konya, Turkey 2000 Bovine DQ164984† ME-SA PanAsia O/TUR/2/2001 Kastamonu, Kastamonu, Turkey Jan 26, 2001 Bovine DQ164985† ME-SA PanAsia O/TUR/3/2002 Diyarbakir, Diyarbakir, Turkey 2002 Bovine DQ164986† ME-SA Iran2001 O/TUR/5/2002 Sivas, Sivas, Turkey 2002 Bovine DQ164987† ME-SA PanAsia O/TUR/12/2002 Dozansehir, Malatya, Turkey May 2002 Bovine DQ164988† ME-SA PanAsia O/TUR/1/2003 Aksaray, Turkey 2003 Bovine DQ164989† ME-SA PanAsia O/TUR/3/2003 Amasya, Turkey 2003 Bovine DQ164990† ME-SA PanAsia O/TUR/7/2003 Nigde, Turkey 2003 Bovine DQ164991† ME-SA Ind2001 O/UAE/7/97 Al Ain, United Arab Emirates May 1997 Bovine DQ164992† ME-SA PanAsia O/UAE/4/99 United Arab Emirates 1999 Antelope DQ164993† ME-SA PanAsia O/UAE/1/2000 Al Rawabi, Dubai, United Arab Emirates May 6, 2000 Bovine DQ164994† ME-SA PanAsia O/UAE/2/2000 Al Rawabi, Dubai, United Arab Emirates May 6, 2000 Bovine DQ164995† ME-SA PanAsia O/UAE/3/2000 Al Rawabi, Dubai, United Arab Emirates May 6, 2000 Bovine DQ164996† ME-SA Ind2001 O/UAE/6/2001 Al Ain, United Arab Emirates Mar 2001 Bovine DQ164997† EA-2 - O/UGA/3/2002 Nakasongola, Uganda 2002 Not known DQ165077 ME-SA PanAsia O/UKG/12/2001 Brentwood, Essex, UK.

May 6, 2000 Bovine DQ164995† ME-SA PanAsia O/UAE/3/2000 Al Rawabi, Dubai, United Arab Emirates May 6, 2000 Bovine DQ164996† ME-SA Ind2001 O/UAE/6/2001 Al Ain, United Arab Emirates Mar 2001 Bovine DQ164997† EA-2 - O/UGA/3/2002 Nakasongola, Uganda 2002 Not known DQ165077 ME-SA PanAsia O/UKG/12/2001 Brentwood, Essex, UK. Feb 19, 2001 Porcine AJ311724 ME-SA PanAsia O/UKG/31/2001 Brentwood, Essex, UK. Feb 20, 2001 Bovine DQ164998† ME-SA PanAsia O/UKG/35/2001 Brentwood, Essex, UK. Feb 20, 2001 Porcine AJ539141 ME-SA PanAsia O/UKG/123/2001 Brentwood, Essex, UK. Feb 22, 2001 Bovine DQ164999† ME-SA PanAsia O/UKG/128/2001 Heddon-on-the-Wall, Northumberland, UK. Feb 22, 2001 Porcine DQ165000† ME-SA PanAsia O/UKG/130/2001 Canewdon, Essex, UK. Feb 22, 2001 Porcine DQ165001† ME-SA PanAsia O/UKG/150/2001 Ponteland, Northumberland, UK. Feb 23, 2001 Bovine DQ165002† ME-SA PanAsia O/UKG/152/2001 Ponteland, Northumberland, UK. Feb 23, 2001 Bovine DQ165003† ME-SA PanAsia O/UKG/174/2001 Beaworthy, Highamton, Devon, UK. Feb 24, 2001 Bovine DQ165004† ME-SA PanAsia O/UKG/195/2001 Bromham, Chippenham, Wiltshire, UK. Feb 2001 Bovine DQ165005† ME-SA PanAsia O/UKG/198/2001 Burdon, Hatherleigh, Okehampton, Devon, UK. Feb 25, 2001 Bovine DQ165006† ME-SA PanAsia O/UKG/240/2001 Llangarron, Ross-on-Wye, Herefordshire, UK. Feb 26, 2001 Bovine DQ165007† ME-SA PanAsia O/UKG/241/2001 Llangarron, Ross-on-Wye, Herefordshire, UK. Feb 26, 2001 Bovine DQ165008† ME-SA PanAsia O/UKG/438/2001 County Armagh, Northern Ireland, UK. Feb 28, 2001 Bovine DQ165009† ME-SA PanAsia O/UKG/478/2001 Dryfesdale, Lockerbie, Dumfries & Galloway, UK. Feb 28, 2001 Bovine DQ165010† ME-SA PanAsia O/UKG/3730/2001 Bogues, Ecclefechan, Lockerbie, Dumfries & Galloway, UK. Mar 30, 2001 Not known DQ165011† ME-SA PanAsia O/UKG/3802/2001 Milton Damerel, Holsworthy, Devon, UK. Mar 30, 2001 Bovine DQ165012† ME-SA PanAsia O/UKG/4021/2001 Cockermouth, Cumbria, UK. Apr 1, 2001 Bovine DQ165013† ME-SA PanAsia O/UKG/4027/2001 Hawes, North Yorkshire, UK. Mar 29, 2001 Bovine DQ165014† ME-SA PanAsia O/UKG/4553/2001 Jedburgh, Borders, UK. Apr 6, 2001 Bovine DQ165015† ME-SA PanAsia O/UKG/5060/2001 Coagh, County Tyrone, Northern Ireland, UK. Apr 11, 2001 Bovine DQ165016† ME-SA PanAsia O/UKG/5565/2001 Cushendall, County Antrim, Northern Ireland, UK. Apr 14, 2001 Bovine DQ165017† ME-SA PanAsia O/UKG/9359/2001 Crathorne, Yarm, North Yorkshire, UK.

rders, UK. Apr 6, 2001 Bovine DQ165015† ME-SA PanAsia O/UKG/5060/2001 Coagh, County Tyrone, Northern Ireland, UK. Apr 11, 2001 Bovine DQ165016† ME-SA PanAsia O/UKG/5565/2001 Cushendall, County Antrim, Northern Ireland, UK. Apr 14, 2001 Bovine DQ165017† ME-SA PanAsia O/UKG/9359/2001 Crathorne, Yarm, North Yorkshire, UK. May 16, 2001 Bovine DQ165018† ME-SA PanAsia O/UKG/13726/2001 Abram, Wigan, Lancashire, UK Jul 16, 2001 Bovine DQ165019† Euro-SA - O3/VEN/51 Venezuela 1951 Not known AJ004645 SEA - O/VIT/2/97 Vietnam 1997 Bovine AJ294929 Cathay - O/VIT/3/97 Vietnam 1997 Porcine AJ294930 SEA - O/VIT/7/97 Uar, Krong Pa, Gialai, Region no. 37, Vietnam Aug 31, 1997 Not known AJ296328 ME-SA PanAsia O/VIT/6/2002 Vietnam 2002 Not known DQ165020† ME-SA PanAsia O/VIT/8/2002 Vietnam 2002 Not known DQ165021† ME-SA PanAsia O/VIT/9/2002 Vietnam 2002 Not known DQ165022† ME-SA PanAsia O/VIT/10/2002 Vietnam 2002 Not known DQ165023† ME-SA PanAsia O/VIT/12/2002 Vietnam 2002 Not known DQ165024† Cathay - O/VIT/13/2002 Vietnam 2002 Not known DQ165025† ME-SA PanAsia O/VIT/14/2002 Kien Giang, Vietnam Feb 2002 Porcine DQ165026† ME-SA PanAsia O/VIT/16/2002 Kien Giang, Vietnam Mar 2002 Porcine DQ165027† ME-SA PanAsia O/VIT/19/2002 Kontum, Vietnam Jun 2002 Bovine DQ165028† ME-SA PanAsia O/VIT/20/2002 Binh Thuan, Vietnam Dec 2002 Bovine DQ165029† ME-SA PanAsia O/VIT/1/2003 Phu Yen, Vietnam 2003 Porcine DQ165030† ME-SA PanAsia O/VIT/2/2003 An Giang, Vietnam Aug 2003 Porcine DQ165031† ME-SA PanAsia O/VIT/1/2004 Kon Tum, Vietnam Feb 2004 Bovine DQ165032† Cathay - O/VIT/2/2004 Quang Nam, Vietnam Feb 2004 Porcine DQ165033† Cathay - O/VIT/3/2004 Quang Nam, Vietnam Mar 2004 Porcine DQ165034† *Not a reference number of the World Reference Laboratory for Foot-and-Mouth Disease. †Sequence determined in this study. Table A2 Occurrence of the PanAsia lineage of foot-and-mouth disease virus serotype O, 1990–2004*† Download PDF (45 KB, 3 pages) Country 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 India ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA + + + Nepal ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA + Bhutan + + ME-SA + + + + ME-SA Iran + + + ME-SA ME-SA ME-SA + ME-SA + ME-SA ME-SA Jordan + ME-SA ME-SA ME-SA ME-SA Syria + ME-SA + - ME-SA Saudi Arabia ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ? ME-SA - Yemen + + + + ME-SA + EA-3 EA-3 Lebanon + + ME-SA ME-SA ME-SA ? ?

Nepal ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA + Bhutan + + ME-SA + + + + ME-SA Iran + + + ME-SA ME-SA ME-SA + ME-SA + ME-SA ME-SA Jordan + ME-SA ME-SA ME-SA ME-SA Syria + ME-SA + - ME-SA Saudi Arabia ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ? ME-SA - Yemen + + + + ME-SA + EA-3 EA-3 Lebanon + + ME-SA ME-SA ME-SA ? ? ME-SA Kuwait + + - ME-SA ME-SA ME-SA ME-SA + Bahrain + ME-SA ME-SA ME-SA + ME-SA ME-SA ME-SA + + - Qatar - - + Iraq + UAE + ME-SA + - ME-SA ME-SA ME-SA - Turkey ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA ME-SA + ME-SA ME-SA ME-SA + Israel + ME-SA ME-SA + ME-SA ME-SA ME-SA ? ? - P.R. China + + Taiwan POC - - - - - - - CHY CHY CHY CHY Sri Lanka + ME-SA + + + ME-SA + ME-SA + + Myanmar + + + + + SEA SEA SEA SEA + SEA Thailand + SEA SEA + SEA SEA + + SEA SEA + SEA SEA + Vietnam - - - + SEA + SEA/CHY CHY CHY CHY Laos + + SEA - SEA SEA Malaysia - - SEA + SEA ME-SA SEA + - SEA SEA SEA SEA Cambodia + - SEA + SEA + + + SEA SEA Japan - - - - - - - - - - - - - - South Korea - - - - - - - - - - - - Russia - - - - - CHY - - - - - - - + Mongolia - - - - - - - - - - - + South Africa - - - - - - - - - - - - - UK - - - - - - - - - - - - - - Eire - - - - - - - - - - - - - - France - - - - - - - - - - - - - - Netherlands - - - - - - - - - - - - - - Afghanistan + + ME-SA + + Pakistan + + + ME-SA + ME-SA ME-SA ME-SA ME-SA - Bulgaria - ME-SA - ME-SA - - ME-SA - - - - - - Greece - - - - ME-SA - ME-SA - - - - - - - - Bangladesh + + + + + + ME-SA + + + - Armenia ME-SA + - - Azerbaijan + + - - Georgia + ME-SA + - Hong Kong CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY Indonesia - - - - - - - - - - - - - - - Kazakhstan - + + + Kyrgyzstan ME-SA - + - North Korea - - - - - - - - - - - - - - - Oman + ME-SA + + + + ME-SA - - Philippines - - - - CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY CHY Tajikistan ME-SA - - - - + - Turkmenistan - - + + + Uzbekistan ME-SA - - - - - - - - - *Compiled from the Food and Agriculture Organization/World Health Organization/Organization for Animal Health Yearbooks and the records of the World Reference Laboratory for FMD. †Abbreviations: solid boxes, PanAsia virus isolated; blank boxes, unknown disease situation; +, FMD type O present (genotype not known); -, no FMD type O reported; CHY, Cathay topotype; ME-SA, Middle East-South Asia topotype (other than PanAsia strain); SEA, Southeast Asia topotype.

World Reference Laboratory for FMD. †Abbreviations: solid boxes, PanAsia virus isolated; blank boxes, unknown disease situation; +, FMD type O present (genotype not known); -, no FMD type O reported; CHY, Cathay topotype; ME-SA, Middle East-South Asia topotype (other than PanAsia strain); SEA, Southeast Asia topotype. Mr Knowles is a molecular virologist at the Institute for Animal Health. His research interests focus on the molecular epidemiology and evolution of picornaviruses of animals, particularly FMDV.