CCATClinical Analysis Tool
‹ Knowledge base

Browse the corpus

Walk the evidence base by book and chapter — the raw source passages that ground Ask, Differential, and the rest.

20 passages

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

Tularemia, caused by the bacterium Francisella tularensis, is a potentially severe disease that often causes unspecific symptoms; because of its low infectious dose and ease of dissemination, F. tularensis is considered a category A biothreat agent (1). Three subspecies of F. tularensis have been identified; F. tularensis subsp. tularensis (type A) has been identified only in North America. Numerous subtyping schemes have subdivided type A into 2 groups, A.I and A.II (2–8). Group A.II is found primarily in the western United States (3,4), whereas group A.I is found throughout the central and eastern regions of the country and sporadically in some western states (3,4,9).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

n identified only in North America. Numerous subtyping schemes have subdivided type A into 2 groups, A.I and A.II (2–8). Group A.II is found primarily in the western United States (3,4), whereas group A.I is found throughout the central and eastern regions of the country and sporadically in some western states (3,4,9). Groups A.I and A.II differ in virulence, as do subgroups within A.I, although clinical signs and symptoms can be similar. Human infections involving A.I strains are associated with a higher fatality rate than that for infections involving A.II strains (4,10); this finding was experimentally confirmed in mice (11). Kugeler et al. (10) used pulsed-field gel electrophoresis (PFGE) to identify 2 subgroups within A.I, A1a and A1b; this study found A1b strains were associated with higher death rates and were more often isolated from human tissue types that were associated with severe disease. This difference was also experimentally confirmed in mice (11,12). However, virulence testing is not often used in clinical settings because it is slow, complicated, and expensive. Thus, molecular approaches that can rapidly assign an unknown strain to one of the recognized groups with known differences in virulence may provide valuable information to clinicians.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

rmed in mice (11,12). However, virulence testing is not often used in clinical settings because it is slow, complicated, and expensive. Thus, molecular approaches that can rapidly assign an unknown strain to one of the recognized groups with known differences in virulence may provide valuable information to clinicians. Because PFGE lacks the phylogenetic resolution of some other testing methods (6), we independently identified genetic subgroups within A.I by conducting whole-genome sequencing (WGS) of 13 A.I strains (Figure 1; Table 1, Appendix). The 13 strains were selected on the basis of assignment to PFGE subgroups A1a or A1b (10) and to maximize geographic diversity; the previously sequenced A.I strain Schu S4 (13) was also included. WGS data were generated, assembled, and analyzed as described in the Technical Appendix (wwwnc.cdc.gov/EID/article/20/5/13-1559-Techapp1.pdf). Figure 1 Neighbor-joining tree of 14 Francisella tularensis subsp. tularensis group A.I strains constructed on the basis of single-nucleotide polymorphisms (SNPs) discovered from whole-genome sequencing. Lines represent major groups within A.I: red, A.I.12; purple, A.I.8; blue, A.I.3. Branch nomenclature for each group is indicated by green text. Bootstrap values for each group and subpopulation are indicated in black font. Pulsed-field gel electrophoresis classifications (A1a and A1b) are indicated for each sequenced strain. A.I strain SchuS4 (GenBank accession no. NC_006570) was included as a reference strain. Scale bar indicates no. SNPs. Table 1 Strains of Francisella tularensis subsp.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

Figure 1 Neighbor-joining tree of 14 Francisella tularensis subsp. tularensis group A.I strains constructed on the basis of single-nucleotide polymorphisms (SNPs) discovered from whole-genome sequencing. Lines represent major groups within A.I: red, A.I.12; purple, A.I.8; blue, A.I.3. Branch nomenclature for each group is indicated by green text. Bootstrap values for each group and subpopulation are indicated in black font. Pulsed-field gel electrophoresis classifications (A1a and A1b) are indicated for each sequenced strain. A.I strain SchuS4 (GenBank accession no. NC_006570) was included as a reference strain. Scale bar indicates no. SNPs. Table 1 Strains of Francisella tularensis subsp. tularensis used in study of geographic distribution of group A.I strains, United States* Strain ID† Original strain ID‡ Original laboratory State/province of exposure Region§ Year CDC PFGE type¶ Subclade# Major group Subgroup AR01-0903 AR01-0903 CDC AR C 2001 A1 A.I.1/2 A.I.12 A.I.12/2 AR01-1117 AR01-1117 CDC AR C 2001 A1b A.I.1/2 A.I.8 A.I.9 AR03-1002 AR03-1002 CDC AR C 2003 A1a A.I.SchuS4 A.I.12 A.I.16 AR97-0782 AR97-0782 CDC AR C 1997 A1a A.I.SchuS4 A.I.12 A.I.16 AR98-2146 AR98-2146 CDC AR C 1998 A1a A.I.SchuS4 A.I.12 A.I.16 AR99-3840 AR99-3840 CDC AR C 1999 A1b A.I.1/2 A.I.8 A.I.9 CA04-2148 CA04-2148 CDC CA W 1983 A1b A.I.1/2 A.I.8 A.I.9 CA04-2149 CA04-2149 CDC CA W 2004 A1a A.I.SchuS4 A.I.12 A.I.14 CA04-2258 CA04-2258 CDC CA W 2004 A1b A.I.1/2 A.I.8 A.I.9 CA95-1135 CA95-1135 CDC CA W 1995 A1 A.I.1/2 A.I.8 A.I.9 DE03-1544 DE03-1544 CDC DE E 2003 A1b A.I.1/2 A.I.3 A.I.4 F0003 FSC 043 FOI OH E 1941 NA A.I.SchuS4 A.I.12 A.I.13 F0005 FSC 041 FOI BC W 1935 NA A.I.1/2 A.I.8 A.I.9 F0008 FSC 046 FOI OH E 1940 NA A.I.SchuS4 A.I.12 A.I.13 F0061 KS00-0948 CDC KS C 2000 A1a A.I.SchuS4 A.I.12 A.I.16 F0069 OK00-2731 CDC OK C 2000 A1b A.I.SchuS4 A.I.12 A.I.14 F0071 OK00-2733 CDC OK C 2000 A1a A.I.SchuS4 A.I.12 A.I.13 F0076 OK-ADA OKDH OK C 2000 NA A.I.SchuS4 A.I.12 A.I.13 F0077 OK-CAN OKDH OK C 1993 NA A.I.SchuS4 A.I.12 A.I.13 F0078 OK-CHK OKDH OK C 2000 NA A.I.SchuS4 A.I.12 A.I.14 F0079 OK-HUG OKDH OK C 1993 NA A.I.SchuS4 A.I.12 A.I.13 F0080 OK-OKL-1 OKDH OK C 1994 NA A.I.SchuS4 A.I.12 A.I.2/13/14/15 F0084 OK-TUL-2 OKDH OK C 1996 NA A.I.SchuS4 A.I.12 A.I.14 F0085 OK-TUL-3 OKDH OK C 1993 NA A.I.1/2 A.I.8 A.I.11 F0244 83A-5698 CADH CA W 1983 NA A.I.1/2 A.I.8 A.I.9 F0246 93A-5254 CADH CA W 1993 NA A.I.1/2 A.I.8 A.I.9 F0272 92A-4575 CADH CA W 1992 NA A.I.1/2 A.I.8 A.I.9 F0276 94A-3325 CADH CA W 1994 NA A.I.1/2 A.I.8 A.I.9 F0281 MO01-2148 CDC MO C 2001 A1a A.I.SchuS4 A.I.12 A.I.13 F0282 KS00-1817 CDC KS C 2000 A1a A.I.1/2 A.I.12 A.I.12/2 F0287 AR99-3448 CDC AR C 1999 A1b A.I.SchuS4 A.I.12 A.I.14 F0297 FSC 047 FOI AK W UNK NA A.I.1/2 A.I.8 A.I.9 F0298 FSC 052 FOI AK W UNK NA A.I.1/2 A.I.8 A.I.9 F0307 ND00-0952 CDC ND C 2000 A1a A.I.1/2 A.I.12 A.I.12/2 F0308 MA01-2505 CDC MA E 1

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

huS4 A.I.12 A.I.13 F0282 KS00-1817 CDC KS C 2000 A1a A.I.1/2 A.I.12 A.I.12/2 F0287 AR99-3448 CDC AR C 1999 A1b A.I.SchuS4 A.I.12 A.I.14 F0297 FSC 047 FOI AK W UNK NA A.I.1/2 A.I.8 A.I.9 F0298 FSC 052 FOI AK W UNK NA A.I.1/2 A.I.8 A.I.9 F0307 ND00-0952 CDC ND C 2000 A1a A.I.1/2 A.I.12 A.I.12/2 F0308 MA01-2505 CDC MA E 1 978 NA A.I.4 A.I.3 A.I.4 F0312 CO99-1817 CDC CO W 1999 A1 A.I.1/2 A.I.12 A.I.12/2 F0314 MO01-4055 CDC MO C 2001 A1b A.I.1/2 A.I.8 A.I.9 F0315 MO01-1907 CDC MO C 2001 A1a A.I.SchuS4 A.I.12 A.I.16 F0332 NY98-1732 CDC NY E 1998 A1b A.I.4 A.I.3 A.I.4 F0347 GA02-5426 CDC MA E 1981 A1b A.I.SchuS4 A.I.12 A.I.14 F0348 AR03-1800 CDC AR C 2003 A1b A.I.1/2 A.I.8 A.I.9 F0357 SD97-2107 CDC SD C 1997 A1b A.I.SchuS4 A.I.12 A.I.14 F0359 NC01-5379 CDC NC E 2001 A1b A.I.4 A.I.3 A.I.4 F0368 KS03-2487 CDC KS C 2003 A1b A.I.1/2 A.I.8 A.I.9 F0375 MO02-1911 CDC MO C 2002 A1a A.I.SchuS4 A.I.12 A.I.13 F0379 PA03-3835 CDC PA E 2003 A1a A.I.SchuS4 A.I.12 A.I.13 F0383 OSU-1 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0384 OSU-2 OSU OK C UNK NA A.I.1/2 A.I.12 A.I.12/2 F0385 OSU-3 OSU OK C UNK NA A.I.1/2 A.I.8 A.I.11 F0386 OSU-4 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0387 OSU-5 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0388 OSU-6 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.16 F0389 OSU-7 OSU OK C UNK NA A.I.1/2 A.I.8 A.I.11 F0390 OSU-8 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0391 OSU-9 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0392 OSU-10 OSU OK C UNK NA A.I.1/2 A.I.8 A.I.9 F0393 OSU-11 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0394 OSU-12 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.16 F0395 OSU-13 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0396 OSU-14 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0397 OSU-15 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0398 OSU-16 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0399 OSU-17 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0401 OSU-19 OSU OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0402 OSU-20 OSU OK C UNK NA A.I.1/2 A.I.8 A.I.9 F0403 OSU-21 OSU OK C UNK NA A.I.1/2 A.I.12 A.I.12/2 F0404 OKH-1 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0405 OKH-2 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.2/13/14/15 F0406 OKH-3 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0407 OKH-4 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0408 OKH-5 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0409 OKH-6 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0410 OKH-7 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0411 OKH-8 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0412 OKH-9 OSU/OKDH OK C UNK NA A

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

7 OKH-4 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0408 OKH-5 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0409 OKH-6 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0410 OKH-7 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.13 F0411 OKH-8 OSU/OKDH OK C UNK NA A.I.SchuS4 A.I.12 A.I.14 F0412 OKH-9 OSU/OKDH OK C UNK NA A .I.SchuS4 A.I.12 A.I.14 F0413 OKH-10 OSU/OKDH OK C UNK NA A.I.1/2 A.I.8 A.I.11 F0414 NC-1 OSU NC E 1998 NA A.I.4 A.I.3 A.I.4 F0415 NC-2 OSU NC E 1998 NA A.I.4 A.I.3 A.I.4 F0685 80700069 LLNL UT W 2007 NA A.I.1/2 A.I.12 A.I.12/2 F0690 1100558 IAB AK W 2003 NA A.I.1/2 A.I.8 A.I.9 F0691 1133496 IAB AK W 2004 NA A.I.1/2 A.I.8 A.I.9 F0693 1211988 IAB AK W 2006 NA A.I.1/2 A.I.8 A.I.8/9/10 F0694 1211990 IAB AK W 2006 NA A.I.1/2 A.I.8 A.I.8/9/10 F0695 1213860 IAB AK W 2006 NA A.I.1/2 A.I.8 A.I.9 F0696 1213861 IAB AK W 2006 NA A.I.1/2 A.I.8 A.I.9 F0697 0916900084 IAB AK W 2009 NA A.I.1/2 A.I.8 A.I.9 F0717**†† OK01-2528 CDC OK C 2001 A1a A.I.SchuS4 A.I.12 A.I.14 F0718**†† MO02-4195 CDC MO C 2002 A1a A.I.SchuS4 A.I.12 A.I.13 F0723**‡‡ MD00-2970 CDC DE E 2000 A1b A.I.4 A.I.3 A.I.4 F0724**‡‡ MA00-2987 CDC MA E 2000 A1b A.I.4 A.I.3 A.I.4 GA00-3376 GA00-3376 CDC GA E 2000 A1a A.I.SchuS4 A.I.12 A.I.2/13/14/15 GA02-5347 GA02-5347 CDC MS C 1980 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5351 GA02-5351 CDC LA C 1981 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5353 GA02-5353 CDC TN E 1992 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5360 GA02-5360 CDC KY E 1973 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5373 GA02-5373 CDC NY E 1977 A1b A.I.1/2 A.I.3 A.I.4 GA02-5381 GA02-5381 CDC AR C 1979 A1b A.I.1/2 A.I.8 A.I.10/11 GA02-5386 GA02-5386 CDC OR W 1978 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5388 GA02-5388 CDC SD C 1985 A1b A.I.1/2 A.I.8 A.I.9 GA02-5389 GA02-5389 CDC IA C 1979 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5390 GA02-5390 CDC MS C 1981 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5392 GA02-5392 CDC LA C 1983 A1a A.I.SchuS4 A.I.12 A.I.15/16 GA02-5393 GA02-5393 CDC TN E 1980 A1a A.I.1/2 A.I.12 A.I.12/2 GA02-5395 GA02-5395 CDC NE C 1982 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5403 GA02-5403 CDC OR W 1984 A1b A.I.1/2 A.I.8 A.I.11 GA02-5404 GA02-5404 CDC GA E 1986 A1b A.I.SchuS4 A.I.3 A.I.5/6 GA02-5406 GA02-5406 CDC DE E 1987 A1a A.I.SchuS4 A.I.12 A.I.2/13/14/15 GA02-5407 GA02-5407 CDC AR C 1980 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5408 GA02-5408 CDC SD C 1983 A1b A.I.SchuS4 A.I.12 A.I.12/2 GA02-5409 GA02-5409 CDC KS C 1980 A1b A.I.1/2 A.I.3 A.I.5/6 GA02-5410 GA02-5410 CDC SD C 1984 A1a A.I.SchuS4 A.I.12 A.I.14 GA02-5412 GA02-5412 CDC TX C 1980 A1a A

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

.SchuS4 A.I.12 A.I.2/13/14/15 GA02-5407 GA02-5407 CDC AR C 1980 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5408 GA02-5408 CDC SD C 1983 A1b A.I.SchuS4 A.I.12 A.I.12/2 GA02-5409 GA02-5409 CDC KS C 1980 A1b A.I.1/2 A.I.3 A.I.5/6 GA02-5410 GA02-5410 CDC SD C 1984 A1a A.I.SchuS4 A.I.12 A.I.14 GA02-5412 GA02-5412 CDC TX C 1980 A1a A .I.SchuS4 A.I.12 A.I.16 GA02-5422 GA02-5422 CDC TX C 1983 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5425 GA02-5425 CDC GA E 1986 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5427 GA02-5427 CDC OH E 1986 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5428 GA02-5428 CDC MO C 1980 A1b A.I.1/2 A.I.8 A.I.11 GA02-5435 GA02-5435 CDC LA C 1984 A1b A.I.1/2 A.I.8 A.I.10/11 GA02-5441 GA02-5441 CDC LA C 1983 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5444 GA02-5444 CDC TX C 1980 A1a A.I.SchuS4 A.I.12 A.I.14 GA02-5445 GA02-5445 CDC TN E 1992 A1a A.I.SchuS4 A.I.12 A.I.2/13/14/15 GA02-5446 GA02-5446 CDC NC E 1992 A1b A.I.1/2 A.I.3 A.I.5/6 GA02-5449 GA02-5449 CDC TN E 1989 A1a A.I.1/2 A.I.12 A.I.16 GA02-5454 GA02-5454 CDC MO C 1987 A1b A.I.1/2 A.I.8 A.I.10/11 GA02-5462 GA02-5462 CDC OK C 1984 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5465 GA02-5465 CDC IL C 1985 A1a A.I.SchuS4 A.I.12 A.I.14 GA02-5469 GA02-5469 CDC OK C 1981 A1b A.I.1/2 A.I.8 A.I.11 GA02-5470 GA02-5470 CDC MO C 1981 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5476 GA02-5476 CDC KS C 1982 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5482 GA02-5482 CDC IN E 1981 A1a A.I.SchuS4 A.I.12 A.I.16 GA02-5497 GA02-5497 CDC VA E 1982 A1a A.I.1/2 A.I.12 A.I.12/2 GA02-5499 GA02-5499 CDC MD E 1982 A1b A.I.SchuS4 A.I.3 A.I.4 GA02-5500 GA02-5500 CDC MO C 1982 A1a A.I.SchuS4 A.I.12 A.I.13 GA02-5501 GA02-5501 CDC LA C 1982 A1b A.I.SchuS4 A.I.12 A.I.14 GA02-5512 GA02-5512 CDC MA E 1981 A1a A.I.SchuS4 A.I.12 A.I.16 GA99-2584 GA99-2584 CDC GA E 1999 A1b A.I.1/2 A.I.3 A.I.5/6 F0719** AR00-0028 CDC AR C 2000 A1a A.I.SchuS4 A.I.12 A.I.13 F0720** NE03-1457 CDC NE C 2003 A1a A.I.SchuS4 A.I.12 A.I.13 F0721** IL00-4351 CDC IL C 2000 A1a A.I.SchuS4 A.I.12 A.I.16 F0722** GA02-5383 CDC GA E 2002 A1a A.I.SchuS4 A.I.12 A.I.16 F0725** MI01-2654 CDC MI E 2001 A1b A.I.1/2 A.I.8 A.I.9 F0726** AK96-2888 CDC AK W 1996 A1b A.I.1/2 A.I.8 A.I.9 F0727** OK00-2732 CDC OK C 2000 A1b A.I.1/2 A.I.8 A.I.11 F0728** CO00-3111 CDC CO W 2000 A1b A.I.SchuS4 A.I.12 A.I.14 F0729** NC98-3428 CDC NC E 1998 A1b A.I.1/2 A.I.3 A.I.6 IA00-3490 IA00-3490 CDC IA C 2000 A1a A.I.SchuS4 A.I.12 A.I.13 ID04-2686 ID04-2686 CDC ID W 2004 A1b A.I.1/2 Basal A.I.1/3/7 IL01-3022 IL01-3022 CDC IL C 2001 A1a A.I.SchuS4 A.I.12 A.I.16 KS01-4799 KS01-4799 CDC

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

CO00-3111 CDC CO W 2000 A1b A.I.SchuS4 A.I.12 A.I.14 F0729** NC98-3428 CDC NC E 1998 A1b A.I.1/2 A.I.3 A.I.6 IA00-3490 IA00-3490 CDC IA C 2000 A1a A.I.SchuS4 A.I.12 A.I.13 ID04-2686 ID04-2686 CDC ID W 2004 A1b A.I.1/2 Basal A.I.1/3/7 IL01-3022 IL01-3022 CDC IL C 2001 A1a A.I.SchuS4 A.I.12 A.I.16 KS01-4799 KS01-4799 CDC KS C 2001 A1b A.I.1/2 A.I.8 A.I.9 KS03-2455 KS03-2455 CDC KS C 2003 A1a A.I.SchuS4 A.I.12 A.I.13 KS82-0004 KS82-0004 CDC KS C 1982 A1a A.I.SchuS4 A.I.12 A.I.14 KS89-0548 KS89-0548 CDC KS C 1989 A1b A.I.SchuS4 A.I.12 A.I.14 KY00-2794 KY00-2794 CDC KY E 2000 A1a A.I.SchuS4 A.I.12 A.I.13 LA95-0751 LA95-0751 CDC LA C 1995 A1 A.I.SchuS4 A.I.12 A.I.14 MA04-2790 MA04-2790 CDC MA E 2004 A1b A.I.1/2 A.I.3 A.I.4 MD01-1249 MD01-1249 CDC MD E 2001 A1b A.I.1/2 A.I.3 A.I.5/6 MD04-2528 MD04-2528 CDC MD E 2004 A1b A.I.1/2 A.I.3 A.I.4 NC05-1521 NC05-1521 CDC NC E 2005 A1b A.I.1/2 A.I.3 A.I.5/6 NC98-3687 NC98-3687 CDC NC E 1998 A1 A.I.1/2 A.I.3 A.I.4 ND00-1213 ND00-1213 CDC ND C 2000 A1a A.I.SchuS4 A.I.12 A.I.16 ND01-1900 ND01-1900 CDC ND C 2001 A1a A.I.1/2 Basal A.I.1/3/7 NE82-0001 NB82-0001 CDC NE C 1982 A1b A.I.1/2 A.I.3 A.I.5/6 NE88-5553 NB88-5553 CDC NE C 1988 A1b A.I.1/2 A.I.8 A.I.10/11 NE95-1835 NE95-1835 CDC NE C 1995 A1a A.I.1/2 A.I.12 A.I.12/2 NE97-2086 NE97-2086 CDC NE C 1997 A1a A.I.SchuS4 A.I.12 A.I.14 NJ04-3009 NJ04-3009 CDC NJ E 2004 A1b A.I.1/2 A.I.3 A.I.4 NY04-2564 NY04-2564 CDC NY E 2004 A1b A.I.1/2 A.I.3 A.I.4 NY96-3369 NY96-3369 CDC NY E 1996 A1b A.I.1/2 A.I.3 A.I.4 OK82-0005 OK82-0005 CDC OK C 1982 A1a A.I.SchuS4 A.I.12 A.I.13 PA84-0001 PA84-0001 CDC PA E 1984 A1a A.I.SchuS4 A.I.12 A.I.13 SD00-3147 SD00-3147 CDC SD C 2000 A1a A.I.SchuS4 A.I.12 A.I.14 SD04-0857 SD04-0857 CDC SD C 2003 A1a A.I.SchuS4 A.I.12 A.I.14 TX05-5417 TX05-5417 CDC TX C 2005 A1b A.I.1/2 Basal A.I.1/3/7 UT07-4262 UT07-4262 CDC UT W 2007 A1a A.I.1/2 A.I.12 A.I.12/2 UT07-4263 UT07-4263 CDC UT W 2007 A1a A.I.1/2 A.I.12 A.I.12/2 UT98-3134 UT98-3134 CDC UT W 1998 A1a A.I.SchuS4 A.I.12 A.I.14 VA00-1000 VA00-1000 CDC VA E 2000 A1b A.I.1/2 A.I.3 A.I.5/6 VA00-2108 VA00-2108 CDC VA E 2000 A1 A.I.1/2 A.I.3 A.I.4 VA98-5912 VA98-5912 CDC VA E 1998 A1b A.I.1/2 A.I.3 A.I.3/4/5 VA99-2600 VA99-2600 CDC VA E 1999 A1b A.I.1/2 A.I.3 A.I.4 *ID, identification; CDC, Centers for Disease Control and Prevention (Fort Collins, CO, USA); PFGE, pulsed-field gel electrophoresis; C, central; W, western; E, eastern; FOI, Swedish Defence Research Agency (Umeå, Sweden); NA, not applicable; BC, British Columbia, Canada; O

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

99-2600 CDC VA E 1999 A1b A.I.1/2 A.I.3 A.I.4 *ID, identification; CDC, Centers for Disease Control and Prevention (Fort Collins, CO, USA); PFGE, pulsed-field gel electrophoresis; C, central; W, western; E, eastern; FOI, Swedish Defence Research Agency (Umeå, Sweden); NA, not applicable; BC, British Columbia, Canada; O KDH, Oklahoma State Department of Health (Oklahoma City, OK, USA); CADH, California Department of Health Services (Richmond, CA, USA); OSU, Oklahoma State University (Stillwater, OK, USA); LLNL, Lawrence Livermore National Laboratory (Livermore, CA, USA); IAB, Institute of Arctic Biology University of Alaska (Fairbanks, AK, USA). †Strain ID from the Northern Arizona University (Flagstaff, AZ, USA) or CDC collections. ‡Strain ID from the originating laboratory. §Region classification of state/province for genetic diversity calculation. ¶See (10). #Canonical single nucleotide polymorphism subgroup as originally defined in (7,8). Names used here have been modified to conform to the nomenclature standard established in (14). **Whole genome sequenced in this study. ††Mouse study; lower-virulence A.I strain (11). ‡‡Mouse study; higher-virulence A.I strain (11).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

10). #Canonical single nucleotide polymorphism subgroup as originally defined in (7,8). Names used here have been modified to conform to the nomenclature standard established in (14). **Whole genome sequenced in this study. ††Mouse study; lower-virulence A.I strain (11). ‡‡Mouse study; higher-virulence A.I strain (11). Our whole-genome phylogeny revealed 3 major subgroups within F. tularensis subsp. tularensis A.I: A.I.3, A.I.8, and A.I.12 (Figure 1). The names we assigned to these subgroups are consistent with previous phylogenetic nomenclature within F. tularensis (14). With the exception of 1 strain (ND01-1900) that was not assigned to any of the 3 subgroups, all strains previously assigned to PFGE subgroup A1a belonged to the newly designated A.I.12 subgroup (Figure 1; Table 1). In contrast, strains previously assigned to PFGE subgroup A1b were distributed among all 3 of the new subgroups (Figure 1; Table 1). We concluded that results of characterization of subgroups A1a and A1b by PFGE are not in agreement with findings of a robust whole-genome phylogeny and therefore focused the remainder of our analysis on subgroups identified by using WGS.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

bgroup A1b were distributed among all 3 of the new subgroups (Figure 1; Table 1). We concluded that results of characterization of subgroups A1a and A1b by PFGE are not in agreement with findings of a robust whole-genome phylogeny and therefore focused the remainder of our analysis on subgroups identified by using WGS. We observed several differences among the 3 subgroups in the whole-genome phylogeny (Figure 1). The first split separated the A.I.3 subgroup from the A.I.8 and A.I.12 subgroups; a second split separated the A.I.8 and A.I.12 subgroups. A long branch of 25 single nucleotide polymorphisms (SNPs) led to the A.I.3 subgroup, in which relatedness among the sequenced strains was moderate. A branch of 9 SNPs led to the A.I.8 subgroup, and again, relatedness among the sequenced strains was moderate. The branch leading to subgroup A.I.12 was, by comparison, much longer (37 SNPs), and the sequenced strains were separated only by 3 short branches (1–4 SNPs). This pattern of several short branches without hierarchical structuring is consistent with a recent radiation, an evolutionary process in response to adaptive change, new ecologic opportunities, or a combination of these factors.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

r (37 SNPs), and the sequenced strains were separated only by 3 short branches (1–4 SNPs). This pattern of several short branches without hierarchical structuring is consistent with a recent radiation, an evolutionary process in response to adaptive change, new ecologic opportunities, or a combination of these factors. To show more comprehensive phylogenetic patterns, we developed 16 canonical SNP (canSNP) assays as described (Technical Appendix) and used them to screen 179 F. tularensis subsp. tularensis A.I strains selected from the collections of the Centers for Disease Control and Prevention (Fort Collins, CO, USA). We selected strains that were representative of all states where A.I infections occur and of all PFGE classification types (Table 1). One limitation of our study is that we did not analyze an equal number of strains from all regions of the country. However, our sample reflects the distribution of human disease caused by F. tularensis subsp. tularensis A.I strains: prevalent in the central United States, less common in the eastern United States, and rare in the western United States (4). The canSNP assays were based on 12 SNP signatures (Table 2) from the whole-genome phylogeny (Figure 1) and 4 previously described SNP signatures (6–8). Using these assays, we assigned the 179 strains to 15 F. tularensis subsp. tularensis A.I subpopulations, including 8 intervening nodes (Figure 2, panel A). We found 6 subpopulations in the A.I.12 subgroup, 4 in A.I.8, and 4 in A.I.3 (Table 1). To identify broad phylogeographic patterns, we created maps indicating specific states where strains from the 15 subpopulations were isolated (Figure 2, panel B). Within these maps, we created boundaries corresponding to 3 regions within the United States: western, central, and eastern.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

A.I.8, and 4 in A.I.3 (Table 1). To identify broad phylogeographic patterns, we created maps indicating specific states where strains from the 15 subpopulations were isolated (Figure 2, panel B). Within these maps, we created boundaries corresponding to 3 regions within the United States: western, central, and eastern. Table 2 Melt-MAMA primers targeting canSNPs for new phylogenetic branches in Francisella tularensis subsp.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

A.I.8, and 4 in A.I.3 (Table 1). To identify broad phylogeographic patterns, we created maps indicating specific states where strains from the 15 subpopulations were isolated (Figure 2, panel B). Within these maps, we created boundaries corresponding to 3 regions within the United States: western, central, and eastern. Table 2 Melt-MAMA primers targeting canSNPs for new phylogenetic branches in Francisella tularensis subsp. tularensis A.I in United States* SchuS4† position SNP state, der/anc‡ Primers, 5′ → 3′§ Con¶ Temp, °C# Subgroup Major Minor NA A.I.7 1005448** C/T A: TATTTCAATTTTTGCGATGGTAgGT 0.80 55 D: ggggcggggcggggcTATTTCAATTTTTGCGATGGTAcTC 0.20 C: AAGTATGTTGGCAAGTAAAGTGAGAAGA 0.20 A.I.12 NA 142781†† C/G A: GCTTATCGCCGACATTCATCtAC 0.20 60 D: ggggcggggcggggcgggCTTATCGCCGACATTCATCcAG 0.20 C: GGTATGGCAAAAAATACTTATGGTACG 0.20 A.I.12 A.I.13 1833651‡‡ T/C A: CTTTCAATCATGTAACCATCATTATTTAaGC 0.80 60 D: cggggcggggcggggcggggCTTTCAATCATGTAACCATCATTATTTAgGT 0.20 C: CTTAATGAACTTGGTGTAATGGGTAGATA 0.20 A.I.12 A.I.16 273622 T/C A: AAACTTAAAAAAGAGCAAGAACTTAATGATcTC 0.60 60 D: ggggcggggcggggcgAAACTTAAAAAAGAGCAAGAACTTAATGATaTT 0.15 C: CATCTTCATTAAAAGTCTTATTGTTTAAACGC 0.15 A.I.12 A.I.15 1210286 A/G A: TCTTAAAACATCGACACTCTCAACcTG 0.80 60 D: ggggcggggcggggcGATCTTAAAACATCGACACTCTCAACtTA 0.20 C: gtatcattcagatcataatgaagcaactatc 0.20 A.I.12 A.I.14 1296147 T/C A: ATCATACTGGTTATATTGGCGGTcTC 0.80 60 D: cggggcggggcggggcggggATCATACTGGTTATATTGGCGGTgTT 0.20 C: GATGAGTCGCTATTAGCTTCTCGAAAG 0.20 A.I.8 NA 1150298 G/A A: TAGTCAATCTTGGAACTCCAGAtAA 0.75 60 D: ggggcggggcggggcTAGTCAATCTTGGAACTCCAGAaAG 0.15 C: TCTATTACTCTAGGGTCAGATAGAAATTC 0.15 A.I.8 A.I.9 1453599 C/T A: GCTGCTGCTAGATTAGCTATgCT 0.15 60 D: ggggcggggcggggcGCTGCTGCTAGATTAGCTATcCC 0.15 C: TCAAGCAATCAACAATAATTTTACTAT 0.15 A.I.8 A.I.10 797599 T/G A: GATCAATTGGTGGTGTTcCG 0.80 60 D: ggggcggggcggggcGTGATCAATTGGTGGTGTTtCT 0.20 C: AACGTTTTATCCTCTTGAATATCAACTAT 0.20 A.I.8 A.I.11 1278606 G/A A: AAGGAACAAAAAACATCATCATTgCT 0.20 60 D: ggggcggggcggggcAAAAGGAACAAAAAACATCATCATTaCC 0.20 C: TCATACTAACAACGGCTATTCAGGGA 0.20 A.I.3 NA 1233898 T/G A: GCTTGACAATATTAGCTTATAAAACTATAgTG 0.15 60 D: ggggcggggcggggcGCTTGACAATATTAGCTTATAAAACTATAaTT 0.15 C: TTTTTTCCATATTTCTGTAAAAAATATACTATTATG 0.15 A.I.3 A.I.4 830715§§ T/C A: GTTAAGTCGGTAAGTATCGACAAaTC 0.60 60 D: ggggcggggcggggcGTTAAGTCGGTAAGTATCGACAAgTT 0.20 C: CAAATCTTCTAGTATCTCTTTATCTTCAG 0.20 A.I.3 A.I.5 113671 G/A A: cgggcgggcgggcgggGCTTGAGTTTATTTTTTGTTTAATGTgTA 0.20 60 D: GCTTGAGTTTATTTTTTGTTTAATGTaTG 0.20 C: GGACAAAACTGTGGACGTTAAGAA 0.20 A.I.3 A.I.6 580153 G/A A: cgggcgggcgggcgggTATAATGGTAACTCATGATCAAGAAcAA 0.20 60 D: TTATAATGG

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

ggcggggcGTTAAGTCGGTAAGTATCGACAAgTT 0.20 C: CAAATCTTCTAGTATCTCTTTATCTTCAG 0.20 A.I.3 A.I.5 113671 G/A A: cgggcgggcgggcgggGCTTGAGTTTATTTTTTGTTTAATGTgTA 0.20 60 D: GCTTGAGTTTATTTTTTGTTTAATGTaTG 0.20 C: GGACAAAACTGTGGACGTTAAGAA 0.20 A.I.3 A.I.6 580153 G/A A: cgggcgggcgggcgggTATAATGGTAACTCATGATCAAGAAcAA 0.20 60 D: TTATAATGG TAACTCATGATCAAGAAaAG 0.20 C: ATCTGTCATGATACCAATTCTTGTCG 0.20 *Melt-MAMA, melt–mismatch amplification mutation assay; SNP, single nucleotide polymporphism; canSNP, canonical SNP; con, concentration, μmol/L; temp, annealing temperature, °C; NA, not applicable; der, derived SNP state; anc, ancestral SNP state; D, derived allele primer; A, ancestral allele primer; C, common primer. †Genomic position in reference A.I SchuS4 strain (GenBank accession no. NC_006570). ‡SNP states are listed according to their orientation in the SCHU S4 reference genome (GenBank accession no. AJ749949.2). §Melt-MAMA primer sequences; primer tails and antepenultimate mismatch bases are in lower case. ¶Final concentration of each primer in Melt-MAMA genotyping assays. #Assay annealing temperature. **Assay designed on the reverse complement. ††SNP from (6). ‡‡Assay supplemented with 0.025 U of Platinum Taq DNA polymerase (Life Technologies, Invitrogen, Frederick, MD, USA). §§SNP from (7).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

tch bases are in lower case. ¶Final concentration of each primer in Melt-MAMA genotyping assays. #Assay annealing temperature. **Assay designed on the reverse complement. ††SNP from (6). ‡‡Assay supplemented with 0.025 U of Platinum Taq DNA polymerase (Life Technologies, Invitrogen, Frederick, MD, USA). §§SNP from (7). Figure 2 Geographic alignment of 179 geographically diverse Francisella tularensis subsp. tularensis A.I strains, by subgroup, United States. A) Canonical single-nucleotide polymorphism (canSNP) topology of 15 intervening and terminal subpopulations defined by screening of 16 canSNPs. Colors indicate major subgroups within A.I: red, A.I.12; purple, A.I.8; blue, A.I.3. Subpopulations are indicated by symbols; n values indicate number of strains assigned to each subpopulation. B) Geographic distribution of strains from the 15 subpopulations, shown by corresponding symbols as in panel A and aligned by subgroup (top, A.I.12; middle, A.I.8; bottom, A.I.3). Vertical lines indicate boundaries of the 3 regions: western, central, and eastern. Subgroups are mapped on the basis of geographic origin at the state level. Gradients correspond to number of strains associated with each symbol (i.e., darker symbols indicate a higher number of strains). The basal A.I.1/3/7 subgroup (inverted triangle) cannot be meaningfully assigned to 1 of the 3 main subgroups; thus, this subgroup is arbitrarily represented on the A.I.8 map. BC, British Columbia, Canada.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

spond to number of strains associated with each symbol (i.e., darker symbols indicate a higher number of strains). The basal A.I.1/3/7 subgroup (inverted triangle) cannot be meaningfully assigned to 1 of the 3 main subgroups; thus, this subgroup is arbitrarily represented on the A.I.8 map. BC, British Columbia, Canada. Each subgroup exhibited complex yet distinct phylogeographic patterns (Figure 2, panel B). Group A.I.12 strains, assigned to 6 subpopulations (Figure 2, panel A), were isolated throughout the United States: all 6 subpopulations were found in the central region, 3 in the western region, and 5 in the eastern region (Figure 2, panel B, top). Group A.I.8 strains, assigned to 4 subpopulations, were found in the central (3 subpopulations) and western (including Alaska and British Columbia; 3 subpopulations) regions, but only 1 strain was isolated in the eastern region (Figure 2, panel B, middle). For group A.I.3 strains, assigned to 4 subpopulations, distribution differed dramatically from the other subgroups; most strains and all 4 subpopulations occurred in the eastern region and just 1 subpopulation in the central region but none in the western region (Figure 2, panel B, bottom).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

(Figure 2, panel B, middle). For group A.I.3 strains, assigned to 4 subpopulations, distribution differed dramatically from the other subgroups; most strains and all 4 subpopulations occurred in the eastern region and just 1 subpopulation in the central region but none in the western region (Figure 2, panel B, bottom). Conclusions The occurrence of the A.I.3 subgroup in the eastern United States could be a recent or ancient event. The subgroup may have been introduced more recently from the central region to a naive niche in the eastern region through importation of rabbits (Sylvilagus floridanus) as recently as the 1920s (3); before 1937, tularemia was nearly nonexistent in the eastern region (15). If the introduction is recent, the current lack of A.I.3 strains in the central United States could be the result of a selective sweep that nearly eliminated this subgroup from its geographic origin. However, most strains and genetic diversity (i.e., subpopulations) within the A.I.3 subgroup are found in the eastern United States, which may reflect a more ancient history in this region involving early introduction and establishment of this subgroup east of the Appalachian Mountains, with only recent spread to the central region.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

strains and genetic diversity (i.e., subpopulations) within the A.I.3 subgroup are found in the eastern United States, which may reflect a more ancient history in this region involving early introduction and establishment of this subgroup east of the Appalachian Mountains, with only recent spread to the central region. If we assume that the greatest genetic diversity in a phylogenetic context implies ancient origins, our findings suggest that the central United States is the likely geographic origin of a common ancestor to F. tularensis subsp. tularensis subgroups A.I.12 and A.I.8 and, perhaps, the A.I group as a whole. The large geographic range of the A.I.12 subgroup and the phylogenetic pattern of a long branch leading to a polytomy with genetic homogeneity point to a possible adaptive advantage for this subgroup. This advantage may be related to difference in virulence among A.I strains, as suggested by previous testing in mice of 2 A.I.12 strains that exhibited lower virulence than that of 2 A.I.3 strains (11). Further research is needed to determine whether the genomic differences that define this subgroup are associated with known F. tularensis virulence determinants. Technical Appendix Francisella tularensis whole-genome sequencing data generation, assembly, and analysis. Suggested citation for this article: Birdsell DN, Johansson A, Öhrman C, Kaufman E, Molins C, Pearson T, et al. Francisella tularensis subsp. tularensis group A.I, United States. Emerg Infect Dis [Internet]. 2014 May [date cited]. http://dx.doi.org/10.3201/eid2005.131559

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_May_20(5)_861-865.

Technical Appendix Francisella tularensis whole-genome sequencing data generation, assembly, and analysis. Suggested citation for this article: Birdsell DN, Johansson A, Öhrman C, Kaufman E, Molins C, Pearson T, et al. Francisella tularensis subsp. tularensis group A.I, United States. Emerg Infect Dis [Internet]. 2014 May [date cited]. http://dx.doi.org/10.3201/eid2005.131559 Acknowledgments We thank Mia Champion for her assistance with initial analyses and Laurel Respicio-Kingry for her assistance with SNP genotyping. This work was supported in part by the US Department of Homeland Security Science and Technology Directorate through award HSHQDC-10-C-00139, the Swedish Civil Contingencies Agency through TA#014-2010-01, the Laboratory for Molecular Infection Medicine Sweden , and Västerbotten County Council. M.G. was supported by the Lendület program of the Hungarian Academy of Sciences. Dr Birdsell is a postdoctoral fellow at the Center for Microbial Genetics and Genomics, Northern Arizona University. Her primary research interest is the evolution of F. tularensis.