CCATClinical Analysis Tool
‹ Knowledge base

Browse the corpus

Walk the evidence base by book and chapter — the raw source passages that ground Ask, Differential, and the rest.

34 passages

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

Rickettsia parkeri is an obligate intracellular bacterium belonging to the spotted fever group of rickettsiae; this organism has recently been found to be pathogenic to humans (1). Infection with R. parkeri can be considered an emerging infectious disease, referred to as R. parkeri rickettsiosis, American Boutonneuse fever, and Tidewater spotted fever. Two confirmed cases of R. parkeri infections, including the index case in 2002, occurred in southeastern Virginia (1–3). Since then, 20 R. parkeri infections have been reported, mainly from the southern United States (2). In the United States, Amblyomma maculatum (family Ixodidae) ticks, commonly referred to as Gulf Coast ticks, are the only known natural vector of R. parkeri. A. maculatum ticks have been reported from 12 states: Alabama, Arkansas, Florida, Georgia, Kansas, Kentucky, Mississippi, Oklahoma, South Carolina, Tennessee, Texas (1,4,5), and Virginia (6). Sonenshine et al. reported finding individual A. maculatum ticks in Virginia in 1965 but concluded that populations had not become established (7). We found large numbers of adult and some nymph A. maculatum ticks in Virginia. This population and the different life stages of the ticks indicate that they are now established in the state. Testing by real-time PCR and sequencing indicated that a high percentage of the ticks contained R. parkeri DNA.

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

Rickettsia parkeri is an obligate intracellular bacterium belonging to the spotted fever group of rickettsiae; this organism has recently been found to be pathogenic to humans (1). Infection with R. parkeri can be considered an emerging infectious disease, referred to as R. parkeri rickettsiosis, American Boutonneuse fever, and Tidewater spotted fever. Two confirmed cases of R. parkeri infections, including the index case in 2002, occurred in southeastern Virginia (1–3). Since then, 20 R. parkeri infections have been reported, mainly from the southern United States (2). In the United States, Amblyomma maculatum (family Ixodidae) ticks, commonly referred to as Gulf Coast ticks, are the only known natural vector of R. parkeri. A. maculatum ticks have been reported from 12 states: Alabama, Arkansas, Florida, Georgia, Kansas, Kentucky, Mississippi, Oklahoma, South Carolina, Tennessee, Texas (1,4,5), and Virginia (6). Sonenshine et al. reported finding individual A. maculatum ticks in Virginia in 1965 but concluded that populations had not become established (7). We found large numbers of adult and some nymph A. maculatum ticks in Virginia. This population and the different life stages of the ticks indicate that they are now established in the state. Testing by real-time PCR and sequencing indicated that a high percentage of the ticks contained R. parkeri DNA. The Study From May through September 2010, adult questing A. maculatum ticks were collected on flags at 3 locations in southeastern Virginia. Collection sites were selected to produce results that could be compared with those of previous surveys and to provide a comprehensive survey of southeastern Virginia (8). The first study site is 50 km inland and borders the Great Dismal Swamp in Chesapeake, Virginia. The second site, Back Bay National Wildlife Refuge, is <1 km from the Atlantic Ocean in Virginia Beach. The third site, in Portsmouth, borders the Elizabeth River.

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

rovide a comprehensive survey of southeastern Virginia (8). The first study site is 50 km inland and borders the Great Dismal Swamp in Chesapeake, Virginia. The second site, Back Bay National Wildlife Refuge, is <1 km from the Atlantic Ocean in Virginia Beach. The third site, in Portsmouth, borders the Elizabeth River. The ticks were identified morphologically, and identity was confirmed as needed by molecular methods. DNA was extracted by using the DNeasy Blood and Tissue Kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s protocol and stored at –20°C until processing. DNA samples were tested for R. parkeri DNA by real-time PCR with a MiniOpticon Real-Time PCR System (Bio-Rad, Hercules, CA, USA). Testing for R. parkeri DNA was by amplification and detection of a fragment of the ompB gene by using Rpa129F and Rpa224R primers and Rpa188 as the probe (Table 1). Samples negative for R. parkeri DNA were tested for Rickettsia spp. by amplifying a 111-bp fragment of the 17-kDa antigen gene (Table 1).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

rcules, CA, USA). Testing for R. parkeri DNA was by amplification and detection of a fragment of the ompB gene by using Rpa129F and Rpa224R primers and Rpa188 as the probe (Table 1). Samples negative for R. parkeri DNA were tested for Rickettsia spp. by amplifying a 111-bp fragment of the 17-kDa antigen gene (Table 1). Table 1 Sequences of primers and probes used to test for Rickettsia spp. DNA in Amblyomma maculatum ticks collected from southeastern Virginia, April–September 2010* Name Sequence, 5′ → 3′ Gene Fragment Reference Rpa129F CAAATGTTGCAGTTCCTCTAAATG ompB 96 J. Jiang et al., unpub. data Rpa224R AAAACAAACCGTTAAAACTACCG ompB 96 J. Jiang et al., unpub. data Rpa188Probe 6-FAM-CGCGAAATTAATACCCTTATGAGCAGCAGTCGCG-BHQ-1 ompB 96 J. Jiang et al., unpub. data R17K128F2 GGGCGGTATGAAYAAACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data R17K238R CCTACACCTACTCCVACAAG 17-kDa antigen gene 111 J. Jiang et al., unpub. data R17K202TaqP FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA 17-kDa antigen gene 111 J. Jiang et al., unpub. data 190-FN1 AAGCAATACAACAAGGTC ompA 540 (1) 190-RN1 TGACAGTTATTATACCTC ompA 540 (1) RompB11F ACCATAGTAGCMAGTTTTGCAG ompB 1895 (9) RompB1902R CCGTCATTTCCAATAACTAACTC ompB 1895 (9) *omp, outer membrane protein gene.

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

unpub. data R17K202TaqP FAM-CCGAATTGAGAACCAAGTAATGC-TAMRA 17-kDa antigen gene 111 J. Jiang et al., unpub. data 190-FN1 AAGCAATACAACAAGGTC ompA 540 (1) 190-RN1 TGACAGTTATTATACCTC ompA 540 (1) RompB11F ACCATAGTAGCMAGTTTTGCAG ompB 1895 (9) RompB1902R CCGTCATTTCCAATAACTAACTC ompB 1895 (9) *omp, outer membrane protein gene. Three representative A. maculatum samples positive for R. parkeri by real-time PCR were confirmed by sequencing of a 540-bp fragment of the ompA gene. The fragments were amplified on an iCycler (Bio-Rad) by using primers 190-FN1 and 190-RN1 (Table 1). Samples positive for Rickettsia spp. but negative for R. parkeri had their ompB gene amplified and sequenced by using primers RompB11F and RompB1902R (Table 1). All PCR products for sequencing were purified by using Wizard PCR Preps DNA Purification System (Promega, Madison, WI, USA), and sequencing reactions were performed by using the BigDye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described by the manufacturer and using appropriate primers (Table 1). Sequence similarities were identified by a BLAST search (http://blast.ncbi.nlm.nih.gov).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

dison, WI, USA), and sequencing reactions were performed by using the BigDye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) as described by the manufacturer and using appropriate primers (Table 1). Sequence similarities were identified by a BLAST search (http://blast.ncbi.nlm.nih.gov). A total of 65 adult and 6 nymph A. maculatum ticks were collected (adults in May–September, nymphs in April). A total of 54 adults were collected from the Chesapeake site, 8 from the Virginia Beach site, and 3 from the Portsmouth site. Of the 6 nymphs collected, 5 were found feeding on a cotton rat at the Chesapeake site in April, and 1 was collected on a flag at the Virginia Beach site in September. Of the 65 total adult ticks tested, 29 (44.6%) were found by real-time PCR to contain Rickettsia spp. DNA, and 28 (43.1%) of the total adults collected contained R. parkeri DNA. Of the 6 nymphs collected, 4 were infected with R. parkeri; all were from the rat at the Chesapeake site. Of the R. parkeri–positive samples sequenced, maximum identity was seen with R. parkeri sequences (GenBank accession no. FJ986616.1). The rate of R. parkeri–infected ticks started out high in May (83% infected) and then decreased to no infected ticks in August (Table 2).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

i; all were from the rat at the Chesapeake site. Of the R. parkeri–positive samples sequenced, maximum identity was seen with R. parkeri sequences (GenBank accession no. FJ986616.1). The rate of R. parkeri–infected ticks started out high in May (83% infected) and then decreased to no infected ticks in August (Table 2). Table 2 Real-time PCR results for adult Amblyomma maculatum ticks collected from southeastern Virginia, USA, 2010 Month and collection site Total no. ticks No. (%) positive for Rickettsia parkeri May Chesapeake 12 10 (83) Virginia Beach 0 0 Portsmouth 0 0 Total 12 10 (83) June Chesapeake 37 15 (40.5) Virginia Beach 4 0 Portsmouth 0 0 Total 41 15 (36.5) July Chesapeake 3 2 (66.7) Virginia Beach 1 0 Portsmouth 3 1 (33.3) Total 7 3 (42.9) August Chesapeake 1 0 Virginia Beach 2 0 Portsmouth 0 0 Total 3 0 September Chesapeake 1 0 Virginia Beach 1 0 Portsmouth 0 0 Total 2 0 Total 65 28 (43.1) Of the 3 A. maculatum ticks collected from the Portsmouth site, 1 was found by real-time PCR to be positive for Rickettsia spp. but negative for R. parkeri. Sequencing of a fragment of the ompB gene revealed this isolate to contain DNA with a 100% match to Candidatus Rickettsia andeanae isolate T163 (GenBank accession no. GU395297.1), a rickettsiae initially found in Peru (9).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

ite, 1 was found by real-time PCR to be positive for Rickettsia spp. but negative for R. parkeri. Sequencing of a fragment of the ompB gene revealed this isolate to contain DNA with a 100% match to Candidatus Rickettsia andeanae isolate T163 (GenBank accession no. GU395297.1), a rickettsiae initially found in Peru (9). Conclusions The discovery of such numbers and life stages of A. maculatum ticks in widely dispersed locations indicates that they are now established in southeastern Virginia. Finding adult A. maculatum ticks at the Portsmouth site was unexpected because this is the northernmost site at which we found these ticks and is a peninsula devoid of white-tailed deer, a major host for adult ticks (10,11).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

in widely dispersed locations indicates that they are now established in southeastern Virginia. Finding adult A. maculatum ticks at the Portsmouth site was unexpected because this is the northernmost site at which we found these ticks and is a peninsula devoid of white-tailed deer, a major host for adult ticks (10,11). That 43.1% of adult A. maculatum ticks collected from southeastern Virginia contained R. parkeri differs from reported rates of R. parkeri in A. maculatum ticks elsewhere in the United States. For A. maculatum ticks from Florida and Mississippi, R. parkeri infectivity rate is 28% (2); for ticks from Florida, Kentucky, Mississippi, and South Carolina, the average rate is 11.5% (12). For A. maculatum ticks collected from Georgia, an infectivity rate of 5%–11.5% has been reported (13). In Arkansas, only 3 of 207 A. maculatum ticks contained R. parkeri (14). Despite the high percentage of R. parkeri in the southeastern Virginia ticks, 27 of 28 positive samples came from 1 collection site. One explanation could be that R. parkeri is transovarially transmitted. Currently, there is no evidence that R. parkeri is transmitted transovarially by A. maculatum ticks, although transovarial transmission of R. parkeri has been shown in A. americanum ticks in the laboratory (15). We also found an A. maculatum tick infected with Candidatus Rickettsia andeanae, which has rarely been reported in the United States (2). Whether Candidatus Rickettisa andeanae is pathogenic to humans is unknown, although it has been suspected to cause infections in persons in Peru (9).

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

That 43.1% of adult A. maculatum ticks collected from southeastern Virginia contained R. parkeri differs from reported rates of R. parkeri in A. maculatum ticks elsewhere in the United States. For A. maculatum ticks from Florida and Mississippi, R. parkeri infectivity rate is 28% (2); for ticks from Florida, Kentucky, Mississippi, and South Carolina, the average rate is 11.5% (12). For A. maculatum ticks collected from Georgia, an infectivity rate of 5%–11.5% has been reported (13). In Arkansas, only 3 of 207 A. maculatum ticks contained R. parkeri (14). Despite the high percentage of R. parkeri in the southeastern Virginia ticks, 27 of 28 positive samples came from 1 collection site. One explanation could be that R. parkeri is transovarially transmitted. Currently, there is no evidence that R. parkeri is transmitted transovarially by A. maculatum ticks, although transovarial transmission of R. parkeri has been shown in A. americanum ticks in the laboratory (15). We also found an A. maculatum tick infected with Candidatus Rickettsia andeanae, which has rarely been reported in the United States (2). Whether Candidatus Rickettisa andeanae is pathogenic to humans is unknown, although it has been suspected to cause infections in persons in Peru (9). Further research is needed to identify the vertebrate host(s) of R. parkeri. This information could be useful for controlling the transmission of R. parkeri to and from the vector, as well as predicting where R. parkeri may be present. Studies relating to transovarial transmission of R. parkeri in A. maculatum ticks would also be useful for predicting the spread of infections. Because R. parkeri is known to cause infection in humans, the presence of this pathogen in southeastern Virginia should be a health concern to persons in this region.

fulltextpubmed· Body· item Emerg_Infect_Dis_2011_May_17(5)_896-898.

present. Studies relating to transovarial transmission of R. parkeri in A. maculatum ticks would also be useful for predicting the spread of infections. Because R. parkeri is known to cause infection in humans, the presence of this pathogen in southeastern Virginia should be a health concern to persons in this region. Suggested citation for this article: Wright CL, Nadolny RM, Jiang J, Richards AL, Sonenshine DE, Gaff HD, et al. Rickettsia parkeri in Gulf Coast ticks, southeastern Virginia, USA. Emerg Infect Dis [serial on the Internet]. 2011 May [date cited]. http://dx.doi.org/10.3201/eid1705.101836 Acknowledgments We thank Brandon Rowan and Ryan Wright for their help with collecting ticks. We also acknowledge the Nature Conservancy, the Back Bay Wildlife Refuge, and Elizabeth River Project for permission to use their land. The project described was supported by grant no. K25AI067791 (to H.D.G.) from the National Institute of Allergy and Infectious Diseases. This work was supported by the US Department of Defense Global Emerging Infections Surveillance and Response System program (work unit no. 0000188M.0931.001.A0074). Ms Wright is a PhD student in the Biological Sciences Department at Old Dominion University. Her research interests lie in microbiology, tick-borne pathogens, and infectious diseases.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

The Gulf Coast tick (Amblyomma maculatum) has become well-established in states outside its historically described coastal range, most recently in North Carolina and Virginia (1,2). This tick has been sporadically reported in other states, including Tennessee and Kentucky (3,4). A. maculatum ticks are the recognized vector of Rickettsia parkeri, a spotted fever group (SFG) bacterium that is pathogenic to humans and has caused illness in ≥32 patients (5–7; C. Paddock, unpub. data). R. parkeri–infected A. maculatum ticks from Kentucky were among specimens submitted to the human tick–testing program of the US Army during 2000–2009 (4), which increased concern of a potential health threat to military personnel using field training areas. To assess the threat of human exposure to R. parkeri and other potential rickettsial pathogens, we conducted a tick survey at 3 high-use military training sites in west-central Kentucky and northern Tennessee, USA. The Study Questing ticks were collected during July 16–20, 2012, by using cloth drags, flags, and CO2-baited traps, and by removing ticks from collectors (Table 1). Sites of collection were Fort Campbell (Christian County, Kentucky, and Montgomery County, Tennessee), Fort Knox (Bullitt, Hardin, and Meade Counties, Kentucky), and Wendell H. Ford Regional Training Center (WHFRTC; Muhlenberg County, Kentucky).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

gs, and CO2-baited traps, and by removing ticks from collectors (Table 1). Sites of collection were Fort Campbell (Christian County, Kentucky, and Montgomery County, Tennessee), Fort Knox (Bullitt, Hardin, and Meade Counties, Kentucky), and Wendell H. Ford Regional Training Center (WHFRTC; Muhlenberg County, Kentucky). Table 1 Quantitative PCR results for rickettsia in Amblyomma maculatum and Dermacentor variabilis ticks, Kentucky and Tennessee, USA, 2012 Location, tick species No. No. (%) positive for Rickettsia parkeri No. (%) positive for R. montanenesis Fort Knox, Kentucky A. maculatum 3 0 0 D. variabilis 44 0 2 (5) Fort Campbell, Kentucky and Tennessee A. maculatum 66 10 (15) 0 D. variabilis 148 0 6 (4) Wendell Ford Regional Training Center, Kentucky A. maculatum 36 5 (14) 0 D. variabilis 107 0 2 (2) Total A. maculatum 105 15 (14) 0 D. variablilis 299 0 10 (3) Multiple 2-person teams collected ticks during 15-minute periods; an average of 19 person-hours was spent sampling at each site. Target tick species were A. maculatum and Dermacentor variabilis, although A. americanum ticks were also collected. Human encounter rates (calculated by using all collection methods except CO2-baited traps) for adult A. maculatum and D. variabilis ticks were ≈2 ticks/hour and 5 ticks/hour, respectively. No immature stages of these species were encountered. Field sites sampled were dominated by sericea (Lespedeza cuneata) and fescue (Festuca pratensis). Some adjacent areas had switchgrass (Panicum virgatum) and Indiangrass (Sorghastrum nutans). A. maculatum ticks appeared tolerant of exposed, unshaded sites and were often collected in the middle of these fields.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

ountered. Field sites sampled were dominated by sericea (Lespedeza cuneata) and fescue (Festuca pratensis). Some adjacent areas had switchgrass (Panicum virgatum) and Indiangrass (Sorghastrum nutans). A. maculatum ticks appeared tolerant of exposed, unshaded sites and were often collected in the middle of these fields. Ticks were identified by using the key of Keirans and Litwak (8). Specimens were individually placed in microcentrifuge tubes containing 500 μL of tissue lysis buffer (QIAGEN, Valencia, CA, USA) and 20 μL of proteinase K (QIAGEN), bisected with a sterile blade, and incubated at 56°C for ≥1 h. Nucleic acid was extracted by using the DNeasy Blood and Tissue Kit (QIAGEN). Initial quantitative real-time PCRs (qPCRs) were performed by using the Rickettsia-specific Rick17b assay specific for the 17-kD antigen gene (4) and the LightCycler TaqMan Master (Roche Applied Sciences, Indianapolis, IN, USA) ready-to-use hot start reaction mixture in the LightCycler 2.0 instrument (Roche Applied Sciences). Final reactions contained 5 μL of template and 15 μL of master mixture. Master mixture contained 0.5 µmol/L primers, 0.4 μmol/L probe, LightCycler TaqMan Reaction Mixture (Roche Applied Sciences), and water. All qPCRs were performed at 95°C for 10 min and for 45 cycles at 95°C for 15 s and 60°C for 30 s.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

ied Sciences). Final reactions contained 5 μL of template and 15 μL of master mixture. Master mixture contained 0.5 µmol/L primers, 0.4 μmol/L probe, LightCycler TaqMan Reaction Mixture (Roche Applied Sciences), and water. All qPCRs were performed at 95°C for 10 min and for 45 cycles at 95°C for 15 s and 60°C for 30 s. Positive samples were further evaluated by using the SFG Rickettsia-specific conventional PCR with primer pair Rr190.70p and Rr190.602n, which is specific for the outer membrane protein A (ompA) gene of Rickettsia spp. and speciated by using PstI restriction fragment length polymorphism analysis (9). Identities of 9 positive samples were confirmed by sequencing a fragment of ompA (1,651 bp) or ompB (1,540 bp) genes (Table 2) (10). All A. maculatum tick samples positive for Rickettsia spp. were also tested for Candidatus Rickettsia andeanae by using the Rande qPCR (4). Table 2 Primers used for PCR, nested PCR, and sequencing for Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA, 2012* Gene, primer Sequence (5′→3′) Fragment, bp ompB 120-M59 CCGCAGGGTTGGTAACTGC ompB1570R TCGCCGGTAATTRTAGCACT PCR: 1,540 120–607F AATATCGCTGACGGTCAAGGT 120–807R CCTTTTAGATTACCGCCTAA ompA 190–3588F AACAGTGAATGTAGGAGCAG RompA3182R TTGCTGAGCGAAAYACTTACTYC PCR: 3,202 190–5238R ACTATTAAAGGCTAGGCTATT Nested PCR: 1,651 RhoA4336F AGTTCAGGAAACGACCGTA RompA4433R TTTCCTGCAGTTACAGAATTTAAT *omp, outer membrane protein.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

TCGCCGGTAATTRTAGCACT PCR: 1,540 120–607F AATATCGCTGACGGTCAAGGT 120–807R CCTTTTAGATTACCGCCTAA ompA 190–3588F AACAGTGAATGTAGGAGCAG RompA3182R TTGCTGAGCGAAAYACTTACTYC PCR: 3,202 190–5238R ACTATTAAAGGCTAGGCTATT Nested PCR: 1,651 RhoA4336F AGTTCAGGAAACGACCGTA RompA4433R TTTCCTGCAGTTACAGAATTTAAT *omp, outer membrane protein. A total of 404 adult ticks (105 A. maculatum and 299 D. variabilis) were collected and tested. Of these ticks, 3 A. maculatum and 44 D. variabilis ticks were collected from Fort Knox, 66 A. maculatum and 148 D. variabilis ticks were collected from Fort Campbell, and 36 A. maculatum and 107 D. variabilis ticks were collected from WHFRTC. Twenty-five (6.2%) of 404 ticks were infected with an SFG Rickettsia species. R. parkeri was detected in 15 (14.3%) of the A. maculatum ticks.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

lected from Fort Knox, 66 A. maculatum and 148 D. variabilis ticks were collected from Fort Campbell, and 36 A. maculatum and 107 D. variabilis ticks were collected from WHFRTC. Twenty-five (6.2%) of 404 ticks were infected with an SFG Rickettsia species. R. parkeri was detected in 15 (14.3%) of the A. maculatum ticks. The ompA sequences (GenBank accession no. KJ741849) of A. maculatum ticks collected from Fort Campbell (n = 2) and WHFRTC (n = 2) were identical to those of R. parkeri strain Portsmouth (GenBank accession no. CP003341) and R. parkeri Maculatum 20 (GenBank accession no. U83449). R. montanensis was detected in 10 (3.3%) of the D. variabilis ticks; isolates from 5 tick samples were sequenced. The ompA sequences (GenBank accession no. KJ741850) of D. variabilis ticks from Fort Knox (n = 1) and WHFRTC (n = 2) were 99.9% identical with R. montanensis str. OSU 85–930 (GenBank accession no. CP003340). The ompB sequences (GenBank accession no. KJ741851) of 2 D. variabilis ticks collected at Fort Campbell were 99.9% identical with those of R. montanensis str. OSU 85–930 (GenBank accession no. CP003340). No other Rickettsia spp., including R. rickettsii, were detected in any of the 404 ticks tested. The greatest percentage (15%) of R. parkeri–positive A. maculatum ticks were from Fort Campbell. R. parkeri was not detected in any of the A. maculatum ticks from Fort Knox.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

str. OSU 85–930 (GenBank accession no. CP003340). No other Rickettsia spp., including R. rickettsii, were detected in any of the 404 ticks tested. The greatest percentage (15%) of R. parkeri–positive A. maculatum ticks were from Fort Campbell. R. parkeri was not detected in any of the A. maculatum ticks from Fort Knox. Conclusions Given that A. maculatum ticks were collected at multiple sites during multiple years, and that these ticks have recently been collected in large numbers, this species is probably established in west-central Kentucky and northern Tennessee. To further elucidate its distribution, efforts should be made to collect immature stages of A. maculatum ticks from hosts, particularly birds, throughout both states. The etiologic agent of Rocky Mountain spotted fever (RMSF), R. rickettsii, was not found in any of the ticks analyzed during this study, a finding that is consistent with findings of Fritzen et al. (11). However, during 2008–2012, a total of 15 human RMSF cases (5-year average rate of 0.1 cases/100,000 population) were reported to the Kentucky Department of Public Health (12). Likewise, for the same period, 1,695 cases of RMSF were reported to the Tennessee Department of Health (5-year average of 393 cases/100,000 population) (13). In addition, an R. parkeri human infection in Kentucky has been confirmed by PCR analysis of a tissue biopsy specimen from a patient (5). Thus, persons in west-central Kentucky and northern Tennessee may be more likely to become infected with a rickettsial agent other than R. rickettsii.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

cases/100,000 population) (13). In addition, an R. parkeri human infection in Kentucky has been confirmed by PCR analysis of a tissue biopsy specimen from a patient (5). Thus, persons in west-central Kentucky and northern Tennessee may be more likely to become infected with a rickettsial agent other than R. rickettsii. The tick encounter rates during this study suggest that persons entering appropriate habitats, especially for an extended period, are likely to encounter D. variabilis and A. maculatum ticks in west-central Kentucky and northern Tennessee during mid-summer. This study further suggests that although a person is ≈2.5 times more likely to encounter D. variabilis ticks than A. maculatum ticks, persons are ≈4.5 times more likely to encounter an R. parkeri–positive A. maculatum tick than a rickettsia-positive D. variabilis tick. These results are consistent with those of Stromdahl et al. (14).

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

er suggests that although a person is ≈2.5 times more likely to encounter D. variabilis ticks than A. maculatum ticks, persons are ≈4.5 times more likely to encounter an R. parkeri–positive A. maculatum tick than a rickettsia-positive D. variabilis tick. These results are consistent with those of Stromdahl et al. (14). Further evidence is needed to confirm if R. montanensis in D. variabilis ticks is of medical concern, but there has been 1 report of tick-borne R. montanensis infection associated with a nonfebrile episode in a person with a rash (15). Because of the lack of awareness regarding R. montanensis infection, it is plausible that a rash could be misdiagnosed and assumed to be a sign of a different illness. Even if an illness was recognized as a vectorborne disease, rickettsial serologic assays are not able to distinguish 1 species of SFG rickettsia from another (14). This finding indicates that serologic reactivity caused by exposure to R. montanensis could be attributed to the wrong SFG rickettsiae. Other epidemiologic studies are needed to elucidate how these findings may relate to regional rickettsial illness, but they still confirm that A. maculatum ticks infected with R. parkeri and D. variabilis ticks infected with R. montanensis warrant increased public health awareness in this region. Suggested citation for this article: Pagac BB, Miller MK, Mazzei MC, Nielsen DH, Jiang J, Richards AL. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerg Infect Dis [Internet]. 2014 Oct [date cited]. http://dx.doi.org/10.3201/eid2010.140175

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

Further evidence is needed to confirm if R. montanensis in D. variabilis ticks is of medical concern, but there has been 1 report of tick-borne R. montanensis infection associated with a nonfebrile episode in a person with a rash (15). Because of the lack of awareness regarding R. montanensis infection, it is plausible that a rash could be misdiagnosed and assumed to be a sign of a different illness. Even if an illness was recognized as a vectorborne disease, rickettsial serologic assays are not able to distinguish 1 species of SFG rickettsia from another (14). This finding indicates that serologic reactivity caused by exposure to R. montanensis could be attributed to the wrong SFG rickettsiae. Other epidemiologic studies are needed to elucidate how these findings may relate to regional rickettsial illness, but they still confirm that A. maculatum ticks infected with R. parkeri and D. variabilis ticks infected with R. montanensis warrant increased public health awareness in this region. Suggested citation for this article: Pagac BB, Miller MK, Mazzei MC, Nielsen DH, Jiang J, Richards AL. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerg Infect Dis [Internet]. 2014 Oct [date cited]. http://dx.doi.org/10.3201/eid2010.140175 Acknowledgments We thank Jesse Huff, Nita Hackwell, Rosanne Radavich, Michael Desena, Walter Roachell, and Michael Brandenburg for helping with tick collection, and Christopher Paddock for reviewing and providing critical input for this manuscript.

fulltextpubmed· Body· item Emerg_Infect_Dis_2014_Oct_20(10)_1750-17

Suggested citation for this article: Pagac BB, Miller MK, Mazzei MC, Nielsen DH, Jiang J, Richards AL. Rickettsia parkeri and Rickettsia montanensis, Kentucky and Tennessee, USA. Emerg Infect Dis [Internet]. 2014 Oct [date cited]. http://dx.doi.org/10.3201/eid2010.140175 Acknowledgments We thank Jesse Huff, Nita Hackwell, Rosanne Radavich, Michael Desena, Walter Roachell, and Michael Brandenburg for helping with tick collection, and Christopher Paddock for reviewing and providing critical input for this manuscript. This study was supported in part by the US Armed Forces Health Surveillance Center work unit #0000188M.0931.001.A0074. Mr Pagac is an entomologist at the US Army Public Health Command Region-North, Fort Meade, Maryland. His research interests focus on reducing the threat of vector-borne diseases to personnel at military installations in the northeastern United States.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

Rickettsioses are zoonoses that are increasingly being recognized as noteworthy infectious diseases (1). They are caused by bacteria of the genera Rickettsia and Orientia, which are small, gram-negative, obligate intracellular bacteria that are transmitted to humans through bites of infected arthropod vectors, such as fleas, mites, ticks, and lice. These bacteria are able to invade various host cells, including vascular endothelium, causing characteristic symptoms such as rash and petecchial hemorrhages. The genus Rickettsia is divided into 2 main biogroups: spotted fever group (SFG) and typhus group (TG). The scrub typhus group (STG) previously belonged to the genus Rickettsia but now belongs to the genus Orientia (2), which consists of 2 species: O. tsutsugamushi and O. chuto (3).

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

as rash and petecchial hemorrhages. The genus Rickettsia is divided into 2 main biogroups: spotted fever group (SFG) and typhus group (TG). The scrub typhus group (STG) previously belonged to the genus Rickettsia but now belongs to the genus Orientia (2), which consists of 2 species: O. tsutsugamushi and O. chuto (3). The past 5 years have seen concerted efforts to understand the etiology of undifferentiated febrile illnesses, a group of diseases that includes rickettsioses. These efforts have confirmed the occurrence of infections with R. felis, transmitted mainly by the cat flea (Ctenocephalides felis felis), as a common cause of fever in rural areas (4–6). Studies have also shown the preponderance of R. africae, the causative agent of African tick-bite fever, as well as R. conorii and R. aeschlimannii, in different ecoregions of Kenya (7). The study reported here is part of a broader study aimed at identifying pathogens or their surrogates, such as immunoglobulins, in patients with febrile illnesses. It is hoped that these types of reports will help local clinicians expand their list of differential diagnoses for undifferentiated fevers. The Study The study protocol was approved by the Ethical Review Committee of the Kenya Medical Research Institute (SSC #1282) and the Walter Reed Army Research Institute’s Human Subject Protection Board (WRAIR HSPB #1402). All patients provided informed consent.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

The past 5 years have seen concerted efforts to understand the etiology of undifferentiated febrile illnesses, a group of diseases that includes rickettsioses. These efforts have confirmed the occurrence of infections with R. felis, transmitted mainly by the cat flea (Ctenocephalides felis felis), as a common cause of fever in rural areas (4–6). Studies have also shown the preponderance of R. africae, the causative agent of African tick-bite fever, as well as R. conorii and R. aeschlimannii, in different ecoregions of Kenya (7). The study reported here is part of a broader study aimed at identifying pathogens or their surrogates, such as immunoglobulins, in patients with febrile illnesses. It is hoped that these types of reports will help local clinicians expand their list of differential diagnoses for undifferentiated fevers. The Study The study protocol was approved by the Ethical Review Committee of the Kenya Medical Research Institute (SSC #1282) and the Walter Reed Army Research Institute’s Human Subject Protection Board (WRAIR HSPB #1402). All patients provided informed consent. Serum samples were collected from patients with fever (>38°C) at 8 hospitals in 6 ecoregions of Kenya (Technical Appendix Figure 1). The samples were screened for IgG against whole-cell antigens of R. conorii for SFG, R. typhi for TG, and Karp and Gilliam strains of O. tsutsugumishi for STG as previously described (8,9). Serum samples that were reactive at 1:100 dilutions were further titrated by using 4-fold dilutions to 1:6,400.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

ppendix Figure 1). The samples were screened for IgG against whole-cell antigens of R. conorii for SFG, R. typhi for TG, and Karp and Gilliam strains of O. tsutsugumishi for STG as previously described (8,9). Serum samples that were reactive at 1:100 dilutions were further titrated by using 4-fold dilutions to 1:6,400. Figure 1 Distribution of titers to spotted fever (SFG) and scrub typhus (STG) groups in patients recruited in various surveillance hospitals. A) For SFG, Garissa District Hospital (GSA), in semiarid northeastern Kenya, had more patients with higher titers compared with Alupe District Hospital (ALH), on the Kenya-Uganda border; Marigat District Hospital (MGT), on the floor of the Rift Valley; Malindi District Hospital (MDH), on the Indian Ocean coast; Kisii District Hospital (KSI), in the Kisii highlands; and Kisumu District Hospital and Obama Children Hospital (KSM), on the Lake Victoria basin. B) For STG, MGT had the most patients with titers of 1:400 and 1:1,600 compared with ALH, MDH, KSI, and KSM.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

ley; Malindi District Hospital (MDH), on the Indian Ocean coast; Kisii District Hospital (KSI), in the Kisii highlands; and Kisumu District Hospital and Obama Children Hospital (KSM), on the Lake Victoria basin. B) For STG, MGT had the most patients with titers of 1:400 and 1:1,600 compared with ALH, MDH, KSI, and KSM. Because scrub typhus has not been reported in Kenya, Western blot was performed to confirm specificity of the reactive serum samples, essentially as described before (5). For Western blot, 0.06 μg/well of the Otr47b antigen was applied to a 10% sodium dodecyl sulfate–polyacrylamide gel and separated by electrophoresis. The proteins were transferred to a nitrocellulose membrane (Invitrogen, Carlsbad, CA, USA). After blocking nonspecific binding at 4°C in 10% skim milk (Difco Becton, Dickinson, Franklin Lakes, NJ, USA), lanes of migrated Otr47b antigens were probed with serum samples that had titers >1:1,600. IgG against Otr47b antigen was detected by a horseradish peroxidase–conjugated anti-human IgG (Kirkegaard & Perry Laboratories, Gaithersburg, MD, USA) at a 1:25,000 dilution, signal visualized by chemiluminescence, and acquired on Kodak X-Ray Film (Carestream Health Inc., Toronto, Ontario, Canada).

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

had titers >1:1,600. IgG against Otr47b antigen was detected by a horseradish peroxidase–conjugated anti-human IgG (Kirkegaard & Perry Laboratories, Gaithersburg, MD, USA) at a 1:25,000 dilution, signal visualized by chemiluminescence, and acquired on Kodak X-Ray Film (Carestream Health Inc., Toronto, Ontario, Canada). A total of 2,225 patients 1–72 years of age (mean age 5 years) were enrolled in the study. There was no difference in the male:female ratio across age groups. Overall, 212 (10%) febrile patients were seropositive for SFG. A substantially higher prevalence rate was seen in Garissa (57/226, 25%) than in Alupe (27/176, 15%), Marigat (37/320, 12%), Malindi (9/102, 9%), Kisii (39/656, 6%), or Kisumu (43/745, 6%) (p<0.05) (Technical Appendix Figure 2). Figure 2 Western blot analysis using the Orientia spp.–specific antigen (Otr47b). Twenty scrub typhus reactive serum samples at a titer ≥1:6,000 were used. Negative controls were serum samples that were reactive to spotted fever and typhus group antigens. The scrub typhus reactive serum samples recognized the Otr47b antigen (lanes 2 and 3), but the spotted fever group and typhus group reactive serum samples did not (data not shown). Lane 1 was probed with a positive control serum sample from an earlier scrub typhus outbreak study (5). M, molecular mass standard, kDa.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

s. The scrub typhus reactive serum samples recognized the Otr47b antigen (lanes 2 and 3), but the spotted fever group and typhus group reactive serum samples did not (data not shown). Lane 1 was probed with a positive control serum sample from an earlier scrub typhus outbreak study (5). M, molecular mass standard, kDa. In all regions, most SFG-seropositive patients had titers >1:1,600 (38%), with the highest numbers coming from Garissa (29%, n = 23), followed by Kisumu (18%, n = 16), and Malindi (5%, n = 4) (Figure 1, panel A). Only 4/1,611 (<1%) febrile patients were seropositive for TG: 3 patients in Malindi and 1 in Kisumu. Antibodies against STG rickettsiae were detected in 67/1401 (5%) febrile patients. The highest prevalence was seen in Marigat District Hospital (28/238, 12%), followed by Alupe Sub-District Hospital (4/68, 6%), Garissa (6/134, 5%), Kisumu (19/464, 4%), and Kisii (10/458, 2%) (p<0.05) (Technical Appendix Figure 3). Most STG patients had titers of 1:400 (62%), with the highest coming from Marigat (107/238, 45%) and Kisumu (142/458, 31%) (Figure 1, panel B). Western blot analysis confirmed reactivity of STG serum samples to O. tsutsugumishi antigen (Figure 2). Table shows the prevalence of SFG and STG antibodies by patient age, sex, and animal contact. Female patients were 1.88 times more likely to be exposed to STG than male patients (p = 0.0169), unlike with SFG. Seroprevalence for SFG and STG increased with patients’ age (p<0.05). Having camels and dogs was positively associated with SFG (p<0.05) and having goats with STG (p<0.05).

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

nt age, sex, and animal contact. Female patients were 1.88 times more likely to be exposed to STG than male patients (p = 0.0169), unlike with SFG. Seroprevalence for SFG and STG increased with patients’ age (p<0.05). Having camels and dogs was positively associated with SFG (p<0.05) and having goats with STG (p<0.05). Table Demographic characteristics of febrile patients tested for seropositivity for SFG and STG rickettsioses, Kenya* Characteristic   SFG, no. positive/no. tested (%)   OR (95% CI)   STG, no. positive/no. tested (%)   OR (95% CI) Sex F   96/1,094 (9)   1.0   43/694 (6)   1.0 M   116/1,131 (10)   1.2 (0.9–1.6)   24/707 (3)   0.5 (0.3–0.9†* Age, y <5   41/1,107 (4)   1.0   17/687 (3)   1.0 5–12   62/622 (10)   2.9 (1.9–4.4)†   29/423 (6)   2.9 (1.5–5.7) 13–26   63/290 (22)   7.2 (4.7–11.2)†   10/ 166 (6)   2.5 (1.0–6.0)† >26   46/206 (22)   7.5 (4.6–12.1)†   11/125 (9)   3.8 (1.6–8.8)† Animal contact Goats No contact   205/2,188 (9)   1.0   60/1,372 (4)   1.0 Contact   7/37 (19)   2.3 (0.8– 5.3)   7/29 (24)   7.0 (2.4–17.7)† Cows No contact   207/2,187 (10)   1.0   65/1,377 (5)   1.0 Contact   5/38 (13)   1.4 (0.4−3.8)   2/24 (8)   1.8 (0.2–7.7) Donkeys No contact   211/2,223 (10)   1.0   67/1,399 (5)   1.0 Contact   1/2 (50)   9.5 (0.1–748.8)   0/2 (0)   0 (0–38.7) Cats No contact   203/2,106 (10)   1.0   66/1,315 (5)   1.0 Contact   9/119 (8)   0.8 (0.3–1.5)   1/86 (1)   0.2 (0.05–1.3) Sheep No contact   212/2,218 (10)   1.0   67/1,387 (5)   1.0 Contact   0/7 (0)   0 (0–5.2)   0/14 (0)   0.0 (0–5.5) Dogs No contact   210/2,146 (10)   1.0   67/1,398 (5)   1.0 Contact   2/79 (3)   0.2 (0.03–0.9)   0/3 (0)   0.0 (0–11) Camels No contact   196/2,173 (9)   1.0   67/1,365 (5)   1.0 Contact   16/52 (31)   4.5 (2.3–8.5)†   0/36 (0)   0.0 (0.0–2.1) *SFG, spotted fever group; STG, scrub typhus group; OR, odds ratio. †Seroprevalence for both spotted fever and scrub typhus increased with age; there were significant differences (p<0.05) between those <5 years of age and those in older age groups for SFG and those >12 years of age for STG. Exposure to SFG and STG were more likely in patients who had contact with dogs and camels for SFG and goats for STG (p<0.05). OR, odds ratio.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

rub typhus increased with age; there were significant differences (p<0.05) between those <5 years of age and those in older age groups for SFG and those >12 years of age for STG. Exposure to SFG and STG were more likely in patients who had contact with dogs and camels for SFG and goats for STG (p<0.05). OR, odds ratio. Conclusions Seventy-eight percent of the study population was >12 years of age; >50% were <5 years of age. This age weighting may have led to underreporting of seroprevalence, because seroprevalence increased with age for SFG and STG (Table). The overall seroprevalence of SFG was 10% (212/2,225), similar to the percentage reported among febrile patients in northern Tanzania (8%) (10). Substantial differences in seroprevalence were observed among patients in the surveillance hospitals in different ecoregions of Kenya (Technical Appendix Figure 2). Patients’ land use influenced seroprevalence; the highest rates of seroprevalence were recorded among the pastoralists of Garissa and Marigat, who keep large herds of cattle, sheep, goats, and camels. In other locales with high seroprevalence rates (Alupe, Malindi, Kisii, and Kisumu), farmers practice small-scale animal husbandry. IgG titers in most seropositive patients were high (1,600–6,400), perhaps indicating patients’ repeated exposure to other homologous or heterologous SFG organisms (Figure 1, Panel A). In contrast to seroprevalence of SFG, seroprevalence of TG rickettsioses was low (4/1,611, <1%) and comparable to that reported among febrile patients in northern Tanzania (10).

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

were high (1,600–6,400), perhaps indicating patients’ repeated exposure to other homologous or heterologous SFG organisms (Figure 1, Panel A). In contrast to seroprevalence of SFG, seroprevalence of TG rickettsioses was low (4/1,611, <1%) and comparable to that reported among febrile patients in northern Tanzania (10). Considering that STG had not been reported in Kenya, its seroprevalence was surprisingly high (67/1,401, 5%) and was highest in Marigat (28/238, 12%) (Technical Appendix Figure 3). Marigat also had the highest number of persons with titers of 1:400 and 1:1,600 (Figure 1, Panel B). The reported determinants for STG are presence of rodents and vectors (chigger mites, especially Leptotrombidium deliense) that infest areas of heavy scrub vegetation. Exposure to scrub typhus increased with age; persons >26 years of age were more likely to be seropositive than younger persons. Similar results were reported in a study conducted in Sri Lanka (11). Scrub typhus seropositivity was associated with contact with goats, perhaps because the short dense shrubs that are forage for goats are also the habitat for Trombiculid mites. As in South Korea but not Japan (12), more girls and women were exposed to tsutsugamushi disease than boys and men, possibly because women’s culturally sanctioned activities expose them to plant tissues inhabited by chiggers.

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

e the short dense shrubs that are forage for goats are also the habitat for Trombiculid mites. As in South Korea but not Japan (12), more girls and women were exposed to tsutsugamushi disease than boys and men, possibly because women’s culturally sanctioned activities expose them to plant tissues inhabited by chiggers. This study had several limitations. First, the serum samples used were from a 1-time encounter with the patient (acute-phase sample only). Convalescent-phase serum samples would have better defined the cases. Second, to demonstrate the disease unequivocally, the Trombiculid mites and the infectious Orientia spp. will need to be identified. Last, it remains to be determined whether the findings of STG in Kenya represents spread of Orientia species outside the tsutsugamushi triangle (an area that includes Pakistan, Australia, Japan, South Korea, and Thailand), as reported recently (3,13), or identifies a hitherto unknown disease-endemic focus. Technical Appendix. Additional information regarding seroprevalence of IgG against spotted fever group rickettsiae and scrub typhus in patients recruited from different surveillance hospitals in Kenya Suggested citation for this article: Thiga JW, Mutai BK, Eyako WK, Ng’ang’a Z, Jiang J, Richards AL, et al. High seroprevalence of antibodies against spotted fever and scrub typhus bacteria in patients with febrile illness, Kenya. Emerg Infect Dis [Internet]. 2015 Apr [date cited]. http://dx.doi.org/10.3201/eid2104.141387

fulltextpubmed· Body· item Emerg_Infect_Dis_2015_Apr_21(4)_688-691.

Suggested citation for this article: Thiga JW, Mutai BK, Eyako WK, Ng’ang’a Z, Jiang J, Richards AL, et al. High seroprevalence of antibodies against spotted fever and scrub typhus bacteria in patients with febrile illness, Kenya. Emerg Infect Dis [Internet]. 2015 Apr [date cited]. http://dx.doi.org/10.3201/eid2104.141387 Acknowledgments We are grateful to the patients for taking part in this study. We thank project staff, including medical officers, nurses, and laboratory technicians. This work is published with the permission of the director, Kenya Medical Research Institute. Financial support for this study was from a grant from the Global Emerging Infection System and Division of the Armed Forces Health Surveillance Center. At the time of this study, Ms. Thiga was a master of science student at the Jomo Kenyatta University of Agriculture and Technology. Her research interests include rickettsial diagnosis and epidemiology.